Functional improvement and maturation of human cardiomyocytes derived from human pluripotent stem cells by barbaloin preconditioning

Abstract

The development of human pluripotent stem cell-derived cardiomyocytes (hPSC-CMs) is a significant advancement in our ability to obtain cardiomyocytes in vitro for regenerative therapies and drug discovery. However, hPSC-CMs obtained via existing protocols usually exhibit a markedly immature phenotype, compared with adult cardiomyocytes, thereby limiting their application. Here we report that barbaloin preconditioning dramatically improves the morphology, structure-related cardiac gene expression, calcium handling, and electrophysiological properties of hPSC-CMs, which means that barbaloin may have the potential to induce the maturation of hPSC-CMs, providing a novel strategy to generate more adult-like cardiomyocytes and promoting the application of hPSC-CMs in regenerative medicine, drug development, and disease modeling.

pluripotent stem cell, cardiomyocyte, maturation, barbaloin

Introduction

Cardiovascular disease (CVD) is a major cause of death worldwide, making it a central research problem for clinicians and scientists throughout the globe [1]. Myocardial cell reduction is a major cause of pathological deterioration of the injured heart [2]. The discovery of the human pluripotent stem cells (hPSCs) and directed cardiac differentiation techniques made it possible to obtain cardiomyocytes in vitro, providing a platform for drug screening, disease modeling, and cell-based cardiac therapy [3]. However, cardiomyocytes derived from hPSC (hPSC-CMs) obtained via existing protocols typically exhibit an immature phenotype, compared with adult cardiomyocytes, in terms of morphology, contractile apparatus, electrophysiological properties, calcium handling, and excitation-contraction coupling [4]. Specifically, smaller cell size [5], shorter sarcomere length [6], and lower expression levels of many cardiac genes [7] have been noted in these cells, which greatly affects physiological structure and function of the cardiomyocytes. To improve the maturation of hPSC-CMs, efforts have been mainly made to modify the culture conditions of the cardiomyocytes [8–10]. Optimizing compositions of culture medium for cardiomyocytes is the most common means to improve cell function. For example, Ribeiro et al. [5] reported that T3 thyroid hormone-containing medium promoted contractile force and electrophysiological activities in hPSC-CMs. However, no generally accepted method consistently produces hPSC-CMs that mimic adult cardiomyocytes, and the potential toxicity and side-effects of various modified medium need to be studied further. Therefore, present application of hPSC-CMs in human especially in adult CVD research is still limited because it is a big challenge to appropriately culture cardiomyocytes in vitro that exhibit the same mature characteristics as the adult ones in vivo.

Barbaloin [10-β-D-glucopyranosyl-1,8-dihydroxy-3-(hydroxymethyl)-9(10H)-anthracene; Fig. 1] is an essential medical component of Chinese traditional medicine, Aloe vera, a kind of perennial liliaceous plants [11]. It has been reported that this extract induces various anti-bacterial, anti-tumor, and anti-oxidants effects [12–14]. Recently, several studies have indicated that barbaloin showed great potential in cardiovascular protection. Cao et al. [15] showed that barbaloin could be an effective antiarrhythmic drug. Additionally, Zhang et al. [16] found that barbaloin pretreatment may attenuate myocardial ischemia/reperfusion-induced injury via activation of AMP-activated protein kinase (AMPK) or inhibition of CNPY2-PERK pathway.

Figure 1

Chemical structure of barbaloin C₂₁H₂₂O₉.

Collectively, these investigations suggested that barbaloin might facilitate the function of hPSC-CMs in vitro. Therefore, in the present study, we used a modified Wnt signaling pathway to acquire highly purified human cardiomyocytes from hPSCs, and then barbaloin was added to the culture medium to precondition these cardiomyocytes derived from hPSCs (hPSC-CMs). Finally, our data revealed that the morphology, structure-related cardiac gene expression, calcium handling, and electrophysiological properties of barbaloin-treated hPSC-CMs were dramatically improved, which means that barbaloin may have the potential to induce the maturation of hPSC-CMs. A new method was established via combining barbaloin, the composition of Chinese herbal Aloe vera, with common hPSC-CMs culture medium to produce mature hPSC-CMs. It can provide a novel strategy to generate more adult-like cardiomyocytes and promote the application of hPSC-CMs in disease modeling, drug discovery, safety, pharmacology, and regenerative medicine.

Materials and Methods

Cardiac differentiation

The hPSC line H7 was obtained from Wicell Research Institute (Madison, USA) with a specific Material Transfer Agreement. Initially, mTeSR1 medium was used to culture H7. During the following cardiac differentiation, RPMI/B-27 without insulin, combination of RPMI1640 (Gibco, Grand Island, USA) and B-27 minus insulin (Life Technologies, Carlsbad, USA) was used as culture medium on Day 0–5. On Day 0–3, cells were treated with 12 μM CHIR-99021 (Selleck, Houston, USA). On Days 4–5, IWR-1 (Selleck) was added to the medium. From Days 6 to 14, the medium was changed into CDM3 [combination of three components: RPMI 1640 basal medium, l-ascorbic acid 2-phosphate (Sigma, St Louis, USA), and bovine serum albumin (Sigma)] [17]. On Days 7–10 after cardiac differentiation, spontaneous beating and contraction of cells was observed. At Day 14, cells were dissociated into single cells and transferred into 12-well plates and cultured in Dulbecco minimum essential medium (DMEM) (Gibco) supplemented with 10% FBS and 10 μg/ml barbaloin (Sigma) for another 7 days for further analysis. The control cells were cultured in basal culture medium (DMEM supplemented with 10% FBS). All cells were cultured under 5% CO₂ environment at 37°C.

Flow cytometry

Cultured cardiomyocytes at Day 14 were dissociated as previously reported [18]. In brief, cells were treated with collagenase I (1 mg/ml, Sigma) and DNase I (Sigma) in phosphate buffered saline (PBS) for 25 min and then with 0.05% trypsin/EDTA (Sigma) for 8 min at 37°C. Dissociated cells were collected and resuspended in PBS, and then transferred into special flow cytometry tubes (BD Biosciences, Franklin Lakes, USA). To analyze cTnT positive cardiomyocytes from differentiated hPSC, BD solution (BD Biosciences) was used to fix and permeabilize cells for 30 min at room temperature, then cells were incubated with primary anti-cTnT antibody (Abcam, Cambridge, UK) for 60 min at 37°C, followed by incubation with fluorescein isothiocyanate (FITC)-conjugated secondary antibody (Abcam) for 30 min at 37°C. The isotype control sample was stained only with FITC-conjugated secondary antibody. Then cells were washed with BD Perm/wash buffer, centrifugated, and resuspended in 200 μl of PBS. Finally, all the samples were assessed with a FACSCalibur (BD Biosciences) and Flowjo software.

Selection of appropriate working concentration of barbaloin

Barbaloin (200, 100, 50, 10, and 1 μg/ml) were added into the basal culture medium (DMEM contained 10% FBS) to culture hPSC-CMs, the basal culture medium was served as control group, and the cell adherent activity was evaluated by using the xCELLigence system (ACEA Biosciences, San Diego, USA). Briefly, 5000 hPSC-CMs were cultured in 16-well E-Plate arrays with respective medium containing different concentrations of barbaloin and incubated for 5 min at room temperature. Then E-plates were put into the Real-Time Cell Analyzer (RTCA) station. xCELLigence software was set to read impedance at 5 min intervals for 18 h. The cell index value indicated the adherent degree of the cells and the electrical impedance reflected the cell adherent status. The normalized cell index (NCI) was calculated as the cell index at the start time point divided by the cell index at the normalization time point as previously described [19].

Electrophysiology assessment

Microelectrode array (MEA) chips were coated with 0.1% gelatin for 2 days and incubated for 2 h at 37°C. Beating cells were digested and replanted on standard 60-channel voltage amplifier MEA probe (Multi-channel Systems, Reutlingen, Germany). Further recording was performed by the MEA data acquisition system MEA-2100 (Multi-channel Systems). During recording, temperature was kept at 37°C. SPIKE 2 software (Multi-channel Systems) was used to analyze the final data.

Table 1

Sequence of primers used in quantitative RT-PCR

Gene	Forward primer (5′ to 3′)	Reverse primer (5′ to 3′)
MYL2	TGTCCCTACCTTGTCTGTTAGCCA	ATTGGAACATGGCCTCTGGATGGA
MYL7	GGAGTTCAAAGAAGCCTTCAGC	AAAGAGCGTGAGGAAGACGG
CTNT	TCTGAGGGAGAGCAGAGACC	ATGAACGACCTGGGCTTTGG
CTNC	GGCCGCATCGACTATGATGA	CAGGACTCAGCTGGAGTTGG
CTNI	CTCACTGACCCTCCAAACGC	TGCAATTTTCTCGAGGCGGA
ATP2A2	TCACCTGTGAGAATTGACTGG	AGAAAGAGTGTGCAGCGGAT
CASQ2	GTTGCCCGGGACAATACTGA	CTGTGACATTCACCACCCCA
PLN	ACAGCTGCCAAGGCTACCTA	GCTTTTGACGTGCTTGTTGA
RYR2	TTGGAAGTGGACTCCAAGAAA	CGAAGACGAGATCCAGTTCC
Nkx2.5	GCCGCCAACAACAACTTC	TACCAGGCTCGGATACCAT
MYH6	TCAGCTGGAGGCCAAAAGTAAAGG	TTCTTGAGCTCTGAGCACTCGTCT
MYH7	TCGTGCCTGATGACAAACAGGAGT	ATACTCGGTCTCGGCAGTGACTTT
ANF	GAACCAGAGGGGAGAGACAGAG	CCCTCAGCTTGCTTTTTAGGAG
BNP	TTCCTGGGAGGTCGTTCCCAC	CATCTTCCTCCCAAAGCAGCC
GAPDH	GGAGCGAGATCCCTCCAAAAT	GGCTGTTGTCATACTTCTCATGG

Real time PCR analysis

Total RNA was extracted using Trizol reagent (Life Technologies, Carlsbad, USA) and cDNA was synthesized with the ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan) according to the manufacturer’s protocol. Then real-time polymerase chain reaction (PCR) was performed on the CRX96TM Real-time System instrument (BIO-RAD, Hercules, USA), utilizing the SYBR^® Green Real-time PCR master mix (TOYOBO). Each reaction was repeated three times to minimize the variation. Measurements were calculated via the 2^-ΔΔCt method. The housekeeping gene GAPDH was used as an internal control. The primers were listed in Table 1.

Figure 2

Cardiac differentiation and selection of barbaloin-working concentration (A) Schematics of modified chemically defined cardiac differentiation of H7 to cardiomyocytes and barbaloin preconditioning protocol. (B) Flow cytometry analysis of the percentage of cTnT positive cells derived from hPSC post differentiation. Data are shown as the mean ± SEM from three independent experiments. (C) Selection of appropriate working concentration of barbaloin, cells cultured in the medium containing 10 μg/ml barbaloin kept a higher adherence and growth rate.

Figure 3

Barbaloin promotes morphological changes of hPSC-CMs (A) Immunostaining of α-actinin and cTnT of hPSC-CMs (scale bar = 50 μm). Upper right corner panels show enlarged views and detailed staining patterns of the boxed areas in the third merged images. (B) Compared with hPSC-CMs cultured in basal medium (control), barbaloin preconditioned hPSC-CMs exhibited significant changes in cell size, sarcomere length. n > 100 per condition. Data are shown as the mean ± SEM. ^*P < 0.05, ^**P < 0.01, by two-tailed Student’s t-test.

Immunofluorescence staining

Cells were fixed with 4% paraformaldehyde for 5 min, washed with PBS, then permeabilized with 0.05% Triton X-100 for 15 min, washed again, and blocked with goat serum for 30 min. Then cells were incubated with primary anti-cTnT antibody (Abcam) and anti-sarcomeric α-actinin antibody (Abcam) at 4°C for 12 h. Then, cells were washed and incubated with Alexa Fluor 594- and 488-conjugated secondary antibodies (Abcam) at 37°C for 60 min. Finally, cells were stained with DAPI for 15 min. Images were collected under a Leica DMi8 fluorescence microscope (Leica, Wetzlar, Germany).

Ca²⁺ imaging

Cultured cardiomyocytes at Day 21 were dissociated and incubated in 20-mm glass bottom dish (Thermo Fisher Scientific, Waltham, USA) with Tyrodes Solution containing Cal-520™ and 0.02% Pluronic F-127 (AAT Bioquest, Sunnyvale, USA) at 37°C for 20 min and then washed with warm fresh medium. The Intracellular spontaneous Ca²⁺ transients were recorded by Line (X-T)-scan mode with an LSM-710 laser scanning confocal microscope (Carl Zeiss, Heidenheim, Germany). During recording, the glass bottom dish was kept in an environmental chamber (37°C, 5% CO₂). MATLAB software (MathWorks) was used to analyze the Ca²⁺ images.

Statistical analysis

All data were shown as the mean ± SEM. Two groups of normally distributed data were compared using a Student’s t-test. P < 0.05 was considered as statistically significant difference.

Results

Generation of human cardiomyocytes

H7 cells were differentiated into the cardiomyocytes using the modified Wnt signaling pathway according to Burridge et al. [17] and Lian et al. [20]. The detailed protocol used in this study is shown in Fig. 2A. We successfully differentiated H7 into cardiomyocytes, and spontaneously contracting cells were observed on Day 8 post induction of differentiation. Fluorescence-activated cell sorting (FACS) study based on anti-human cardiac troponin T (cTnT) antibody at Day 14 post-differentiation confirmed that about 96% effective cardiac differentiation was achieved via our modified differentiation protocol (Fig. 2B).

Selection of appropriate concentration of barbaloin

Barbaloin, the primary active ingredient of Aloe vera leaf exudates, has been shown to have a cardioprotective effect [15,21]. In order to select the proper concentration of barbaloin for hPSC-CMs, we prepared the basal culture medium supplemented with 1, 5, 10, 50, 100, or 200 μg/ml of barbaloin, then used the respective medium to culture hPSC-CMs for 18 h and evaluated their adherent and growth activity. Cells cultured in basal culture medium were served as control. The results showed that cells cultured in the medium containing 10 μg/ml barbaloin kept the highest adherence and growth rate compared with cells in other groups (Fig. 2C), suggesting that 10 μg/ml of barbaloin was the appropriate concentration for culturing hPSC-CMs. We subsequently dissociated the beating cardiomyocytes clusters derived from hPSCs at Day 14 into single hPSC-CMs and preconditioned with 10 μg/ml barbaloin for another 7 days for further analysis.

Barbaloin promotes morphological changes of hPSC-CMs

Single dissociated hPSC-CMs preconditioned with 10 μg/ml barbaloin maintained spontaneous contraction and expressed cardiac-specific sarcomeric proteins such as cTnT and sarcomeric α-actinin (Fig. 3A). A well-developed morphology and larger cell area were observed after preconditioning with barbaloin (control, 3858 ± 376.4 μm²; barbaloin, 5545 ± 619.8 μm², P < 0.05; Fig. 3B). The sarcomere length of these cells also exhibited a significantly longer sarcomere length (control, 5.774 ± 0.3838 μm; barbaloin, 7.997 ± 0.5651 μm, P < 0.005; Fig. 3B). These results indicated that barbaloin preconditioning promoted morphological changes of hPSC-CMs.

Barbaloin upregulates cardiac-specific gene expression

To evaluate whether the barbaloin affects the inherent gene expressions of hPSC-CMs, we analyzed cardiac-specific gene expressions of hPSC-CMs preconditioned with barbaloin at 1 week by quantitative real-time PCR (RT-PCR). As shown in Fig. 4, compared with the control, the expression of the NKX2.5 gene that is involved in cardiac development was upregulated after barbaloin pretreatment, and the expressions of genes related to the contractile activity (cTnT, cTnC, cTnI, and MYH6) were also significantly upregulated. Expression levels of B-type natriuretic peptide (BNP) and atrial natriuretic factor (ANF), the markers of cardiomyocyte maturation that are also involved in normal and abnormal heart physiology, were significantly upregulated after barbaloin preconditioning, compared with those cells cultured in basal culture medium. Furthermore, the expressions of genes encoding sarcomere protein MYL2 (MLC2v) and MYL7 (MLC2a) were also increased, and the ratios of MYL2/MYL7, MYH7/MYH6 were increased noticeably, indicating a trend of better maturation when barbaloin was present.

Figure 4

Barbaloin upregulates cardiac-specific gene expression RT-PCR analyses of the expressions of cardiac-associated genes, normalized to GAPDH expression. Data are shown as the mean ± SEM from three independent experiments. ^*P < 0.05, ^**P < 0.01, by two-tailed Student’s t-test.

Barbaloin promotes the Ca²⁺ handling activity of hPSC-CMs

Calcium handling behavior is an important factor in determining the cardiomyocyte to mature [10]. To study its activity in cardiomyocytes, we accordingly measured the spontaneous calcium transients of hPSC-CMs by using fluorescent Ca²⁺ dye Cal-520 acetoxymethyl ester (Fig. 5A,B). In contrast to the control group, hPSC-CMs preconditioned with barbaloin have larger calcium transient amplitudes, significantly shortened transient duration 50s, peak to peak time, and shortened decay time which resulted in faster beating activity (Fig. 5C) corresponding to shorter durations to release Ca²⁺ into and remove Ca²⁺ from the sarcoplasm. The improved calcium handling properties observed in the barbaloin-preconditioned hPSC-CM were accompanied with an upregulated gene expression of ATP2A2 (SERCA2α or Ca²⁺-ATPase), RYR2 (ryanodine receptor 2), CASQ2 (calsequestrin 2), PLN (phospholamban) (Fig. 5D), which plays a pivotal role in excitation-contraction coupling and couples with the translocation of calcium in mature cardiomyocytes.

Figure 5

Barbaloin promotes Ca²⁺handling activity of hPSC-CMs (A) Ca²⁺ imaging analyses of control hPSC-CMs using the fluorescent Ca²⁺ dye Cal-520 acetoxymethyl ester. (B) Ca²⁺ imaging analyses of hPSC-CMs preconditioned with barbaloin. (C) The barbaloin-preconditioned cells exhibited larger calcium transient amplitudes (mean ΔF/F0) and significantly shorter decay time, transient duration 50, peak to peak time, compared to the control cell. Data are shown as the mean ± SEM from independent experiments, n ≥ 3. ^*P < 0.05, ^****P < 0.0001 by two-tailed Student’s t-test. (D) RT-PCR analyses of the transcriptional expressions of calcium handling genes, normalized to GAPDH expression. Data are shown as the mean ± SEM from three independent experiments. ^*P < 0.05, ^**P < 0.01 by two-tailed Student’s t-test.

Barbaloin promotes the electrical activity of hPSC-CMs

MEAs have been developed as a crucial platform to measure electrical activity from the multicellular level accurately [22,23]. We next examined the electrophysiological activity of the hPSC-CMs at Day 21 post induction. As shown in Fig. 6A,B, hPSC-CMs with barbaloin preconditioning had normal element of electrophysiological activities and showed a faster beating rate and a shorter interspike interval, when compared with control hPSC-CMs. Since the function of β-adrenergic receptor system depends on the CaV1.2 channels and intracellular calcium reserves, the responses to β-adrenergic agonists are an indicator of phenotypic maturation [24,25]. Upon treatment with epinephrine (an adrenergic receptor agonist), both groups showed a positive chronotropic response, but hPSC-CMs with barbaloin preconditioning showed a higher amplitude of variation (Fig. 6C). These results suggested that hPSC-CMs preconditioned with barbaloin have well-matured molecular ion channels that enhance a rapid spread of electrical activation and subsequent contraction.

Figure 6

Barbaloin promotes electrical activity of hPSC-CMs MEA recording of the contraction rate of the hPSC-CMs before (baseline) and after treatment with epinephrine. (A) Control hPSC-CMs. (B) Barbaloin-preconditioned hPSC-CMs. (C) Analysis of contraction rate recording of the hPSC-CMs. Data are shown as the mean ± SEM from more than three independent experiments. ^*P < 0.05, ^**P < 0.01 by two-tailed Student’s t-test.

Discussion

The discovery and development of hPSCs have unlimited prospective in the development of regenerative medicine and drug selection, as well as the possibility of cell therapy and tissue transplantation [26,27]. However, the lack of morphological and functional maturity of the cardiomyocytes has markedly limited their application in both drug development and regenerative therapies [7,28,29]. In the present study, we developed an improved method for the maturation of human cardiomyocytes derived from hPSCs by barbaloin preconditioning. Barbaloin has excellent anti-tumor, anti-inflammatory, and anti-oxidant properties, which participates in many important physiological functions [13,30]. Barbaloin also has been shown to have a cardioprotective effect. For example, Cao et al. [15] demonstrated that barbaloin could alleviate ventricular arrhythmia via regulating voltage-gated ion channels and Zhang et al. [16] also showed that barbaloin pretreatment inhibited myocardial oxidative stress by activating the AMPK signaling pathway, thereby alleviating myocardial ischemia–reperfusion injury. Cui et al. [21] demonstrated that barbaloin pretreatment reduced myocardial ischemia–reperfusion injury by inhibiting the CNPY2-PERK apoptotic pathway which is involved in the development of myocardial ischemia–reperfusion injury by initiating the PERK-CHOP signaling pathway [21]. These data are all based on rodent models, and the effect of barbaloin on human cardiomyocytes remains largely unknown. To the best of our knowledge, the study described herein constitutes the first example to explore the effect of barbaloin on hPSC-derived cardiomyocytes.

Morphology of cell is most widely investigated and utilized in the measurement of maturation of cardiomyocytes [31–33]. Barbaloin preconditioning was strongly associated with significant phenotypic changes in hPSC-CMs. After 7 days of preconditioning, cells were noticeably larger and exhibited more myocyte-like appearance (a more defined rod-like sarcomere structure and cytoskeletal organization) than cells cultured in basal culture medium. Furthermore, it was accompanied by upregulated gene expressions of structure-related genes, such as MYL2, MYL7, MYH6, and MYH7. In the present study, we demonstrated that barbaloin facilitated the contraction of cardiomyocytes and shortened interspike intervals, which might be cause by increased expressions of cTnT, cTnC, and cTnI genes that regulate CM contraction by forming a complex and binding with intracellular Ca²⁺ that facilitate the rapid spread of electrical activation and subsequent contraction.

Ca²⁺ is involved in many important cellular activities, such as cardiac excitation-contraction coupling and intra-cellular signaling pathways [7,34]. Thus, maintaining Ca²⁺ homeostasis is of great importance in regulating general physical health status. ATPase plays a significant role in maintaining intracellular Ca²⁺ homeostasis [35,36]. Our results also suggested that barbaloin preconditioning improves calcium handling. It is possible that barbaloin is involved in the protective mechanisms through scavenging tBHP- or AAPH-derived radicals in the aqueous phase. An efficient free radical scavenger in the culture medium is especially effective in protecting cells, since its presence could limit the damage of free radicals to membrane lipids and proteins [14]. The resultant preservation of membrane structure, such as Ca²⁺-ATPase, is essential for the survival of cells. The improved calcium handling properties observed in the barbaloin-preconditioned hPSC-CM were accompanied by an upregulated gene expression of ATP2A2 (also named as SERCA2α or Ca²⁺-ATPase) that plays a pivotal role in the excitation-contraction coupling and calcium translocation in mature cardiomyocytes.

It is worth noting that high doses of barbaloin are toxic to hPSC-CMs. As shown in Fig. 2C, high concentration of barbaloin (≥50 μg/ml) inhibited the adhesion and growth of hPSC-CMs, indicating a degree of toxicity to cardiomyocytes. There are also some limitations in our study: a deeper analysis of sarcomere organization will help us further understand how barbaloin preconditioning increases hPSC-CMs’ area and induces cardiomyocyte morphology organization while increasing cTnT, cTnC, and cTnI expression as well as contractility.

In summary, we demonstrated that barbaloin preconditioning facilitated positive changes in the morphology, expressions of structure-related cardiac genes, calcium handling, and electrophysiological properties of hPSC-CMs, which means that barbaloin may have the potential to improve functional maturation of hPSC-CMs. This study may shed light on a new method for the maturation of hPSC-CMs, which was established via preconditioning with barbaloin, a key component of Aloe vera. Therefore, this investigation provides a novel strategy to generate adult-like cardiomyocytes and may promote the application of hPSC-CMs in regenerative medicine, drug development, and disease modeling.

Funding

This work was supported by the grant from the Natural Science Foundation of Shanghai, China (No. 17ZR1404800).

Author notes

Hui Yang and Weiyi Zhong contributed equally to this work.