Abstract
Long-time consumption of high-fat food is a direct cause of cardiovascular diseases, and high-fat-related inflammation plays an important role in it. Toll-like receptors (TLRs), especially TLR2 and TLR4, play important roles in high-fat-related inflammation. However, the impact of TLR2 on high-fat-associated cardiovascular complications is still unknown. In this study, we try to investigate the relationship between TLR2 and high-fat-related cardiac injury. SD rats were allocated to either a control group which were fed with normal diet or a high-fat group which were fed with high-fat diet for 5 months. At the last month, rats fed with high-fat diet were intraperitoneally injected with control normal mouse IgG or anti-TLR2 antibody. Heart tissues were collected for further analysis. RT-qPCR and western blot analysis results revealed that TLR2 expression was increased in the heart tissues from rats fed with high-fat diet and anti-TLR2 antibody had no effect on TLR2 expression. However, anti-TLR2 antibody alleviated masson staining area, levels of TGF-β1 and Collagen I mRNA, and decreased TUNEL-positive myocardial cells and caspase-3 activity, suggesting that anti-TLR2 antibody protected cardiac cells against high-fat-induced cardiac fibrosis and cell apoptosis. By using immunohistochemistry, RT-qPCR and ELISA, we found that anti-TLR2 antibody blocked NF-κB activation, inhibited the expression of inflammatory factors such as TNF-α, IL-1β, IL-6 and IL-18 in the heart tissues from rats fed with high-fat diet. These results hinted that anti-TLR2 antibody might exert its protective effect via inhibition of the TLR2/NF-κB/inflammation pathway. Our findings suggest that anti-TLR2 antibody has a preventive function against high-fat-induced deleterious effects in the heart, and anti-TLR2 antibody may be used as an attractive therapeutic option for high-fat-induced cardiac injury.
Introduction
Long-term consumption of high-fat food induces obesity, which confers two-folds risk in the development of cardiovascular disease over the next 5–10 years [1,2]. It has been proved that chronic low-grade inflammation contributes greatly to high-fat-associated myocardial abnormalities [3]. Sustained inflammation accelerates myocardiocyte apoptosis and myocardial fibrosis [4,5].
Toll-like receptors (TLRs) are a family of receptors with critical roles in initiating inflammatory response [6]. Recent studies have proposed that TLR signaling is activated in high-fat condition [7]. For example, TLR4 and TLR2 expression is up-regulated in obese mice [8]. Lipopolysaccharide, a prominent TLRs activator, is significantly increased in mice fed with high-fat diet [9]. Saturated fatty acid and advanced glycation end product are two increased factors in high-fat condition and have functions in activating the TLR signaling pathway [10,11]. Human studies also proved that TLR2 and TLR4 expression is increased after a high-fat and high-calorie meal [12]. On the other hand, dominant-negative mutant of TLR4 or TLR2, or inhibition of TLR pathway, attenuates the progression of inflammation in mice fed with high-fat diet [13–15].
It has been proven that TLR4 could be activated and highly expressed in fatty acid-treated myocardial cells or in the heart of mice fed with high-fat diet [5,16,17]. Inhibition of TLR4 has beneficial effect on the heart [18]. Though there is increased evidence in the relationship between TLR4 and high-fat-associated cardiac damage, the impact of TLR2 on high-fat-associated cardiovascular complications is still not well understood. TLR2 is also an important member of the TLR family. It has been reported that TLR2-mediated inflammation is critically involved in heart under pathological conditions [19].
In this study, we performed experiments to examine whether TLR2 specific antibody has an protective effect on high-fat-associated cardiac damage and clarify the potential mechanism under it.
Materials and Methods
Chemicals and reagents
Primary antibodies against phospho-NF-κB (Cat No: 3033) and total-NF-κB (Cat No: 8242) were obtained from Cell Signaling Technology (Danvers, USA). HPR-labeled goat anti-rabbit antibody (Cat No: 65-6120) and bicinchoninic acid (BCA) assay kit (Cat No: 23250) were purchased from Pierce (Pierce Biotechnology, Rockford, USA). Commercial anti-TLR2 antibody (Cat No: ab191458) was purchased from Abcam (Shanghai, China). Normal mouse IgG (Cat No: bs-0296P) was obtained from Bioss Biotechnology (Beijing, China).
Generation and purification of anti-TLR2 monoclonal antibody
An extracellular peptide (405 T~573Q) of rat TLR2 was purified as reported by Liu et al. [20]. Four 6 to 8-week-old female BALB/c mice (Animal Center of Xi’an Jiaotong University, Xi’an, China) were injected three times with the purified TLR2-405T~573Q peptide every 2 weeks. The initial dose was 100 μg of TLR2-405T~573Q peptide emulsified with complete Freund’s adjuvant (CFA; Sigma, St Louis, USA) per mouse followed by 50 μg of TLR2-405T~573Q peptide emulsified with incomplete Freund’s adjuvant (IFA; Sigma) per mouse. Venous blood was obtained from the retromandibular vein of mice on Day 21. Serum antibody titers were evaluated by direct enzyme-linked immunosorbent assay (ELISA).
Based on the ELISA results, splenocytes from the better-immunized mice were collected 3 days after the last immunization and subsequently fused with SP2/0 mouse myeloma cells (Cell Center of Shanghai Institutes for Biological Sciences, Shanghai, China) by using 50% polyethylene glycol (PEG) (M: 4000; v/w: 50%; Sigma). Fused cells were washed with RPMI medium (ThermoFisher Scientific, Rockford, USA) and seeded into 96-well plates. HAT/HT selection medium (Sigma) was used to select fused cells. Then ELISA was adopted to initially screen hybridoma supernatants with TLR2-405T~573Q. The supernatant tested positive for TLR2-405T~573Q was considered positive for the presence of anti-TLR2 antibodies. The positive clone was subcloned at least three times with the limiting dilution method.
The hybridoma cells were cultured in Hybridoma-SFM medium (Cat No: 12045084; Life Technologies, Grand Island, USA). Cell culture supernatants were collected, and the anti-TLR2 monoclonal antibody was purified using rProtein A Sepharose® Fast Flow (Cat No: 17-1279-01; GE Health Care, Buckinghamshire, UK) according to the manufacturer’s instructions. The protein concentration of the purified fractions containing the anti-TLR2 antibody was determined using the BCA™ protein assay kit (ThermoFisher Scientific).
Animal experiment
Male Sprague Dawley rats (6 weeks old, weighing 225–250 g; Animal Center of Xi’an Jiaotong University) were used in this study. All animal care and experimental procedures were approved by Xi’an Jiaotong University Committee on Animal Care. All experiments conformed to the international guidelines on the ethical use of animals. Rats were randomly assigned into three groups. (1) Control group (n = 6), animals received normal diet for 5 months. (2) High-fat group (n = 8), animals were fed with high-fat diet for 5 months and at the last month animals were intraperitoneally injected with normal mouse IgG (0.5 ml of 1 mg/ml at Day 1, 0.5 ml of 0.5 mg/ml every other day from Day 2). (3) TLR2 antibody group (n = 8), animals were fed with high-fat diet for 5 months and at the last month animals were intraperitoneally injected with anti-TLR2 antibody (0.5 ml of 1 mg/ml at Day 1, 0.5 ml of 0.5 mg/ml every other day from Day 2). The composition of high-fat diet includes: 67% basic feed, 20% sucrose, 10% lard, 2% cholesterol and 1% pig bile salt, which are based on the previous report [21]. At the end of treatment, animals were sacrificed and the hearts were removed and immediately immersed in cold phosphate-buffered saline (PBS) to wash off blood. The hearts were then rapidly dissected into 3–4 parts. One part was fixed with 4% para-formaldehyde, the other parts were immediately immersed in liquid nitrogen and then stored at −80°C for subsequent use.
Masson staining
Masson staining was performed to analyze cardiac fibrosis. Briefly, paraffin-embedded heart sections were deparaffinized and rehydrated. Then the sections were stained with 0.1% Masson staining buffer to evaluate the collagen deposition. The respective Masson stained areas (blue, fibrosis) and non-Masson stained areas (red, normal) of the sections were measured digitally using Image J software. The fibrotic area = non-Masson stained area/ventricle area×100%.
TUNEL assay
In situ Cell Death Detection Kit (Cat No: ZK-8005) was purchased from Zhongshan Jinqiao Biotechnology (Beijing, China). TUNEL assay was conducted according to the manufacturer’s instructions. Briefly, paraffin-embedded sections were deparaffinized, rehydrated and incubated with 3% hydrogen peroxide for 10 min. The slides were then treated with Proteinase K working solution at 37°C for 15 min and washed with PBS twice. Sections were incubated with TUNEL reaction mixture for 60 min and subsequently with Converter-POD solution for 30 min. The slides were stained using DAB and counterstained with hematoxylin. TUNEL-positive nuclei (stained dark brown) were observed under a microscope (Olympus BX41; Olympus, Tokyo, Japan) at 400× magnification. The results were obtained semi-quantitatively by averaging the number of apoptotic cells/field at 400× magnification. Five fields were evaluated per tissue sample.
Caspase-3 activity assay
Caspase-3 activity was measured by using Caspase-3 Activity Kit (Cat No: C1115; Beyotime Biotechnology Company, Shanghai, China) according to the manufacturer’s instructions. Briefly, heart tissues were homogenized in lysis buffer using a glass homogenizer and left on ice for 5 min. The lysate was centrifuged at 16,000 g at 4°C for 15 min. Activities of caspase-3 in the supernatant were measured using substrate peptides Ac-DEVD-pNA. The release of p-nitroanilide (pNA) was qualified by determining the absorbance at 405 nm with a Safire2 spectrophotometric plate reader (Tecan Group Ltd, Zurich, Switzerland). The increase in activity was calculated as the ratio between values obtained from treated samples versus those obtained in normal controls.
RT-qPCR
Total RNA from each heart was isolated separately using RNeasy Mini Kit (Qiagen, Valencia, USA). One microgram of total RNA from each heart tissue was reverse transcribed separately into cDNA using the iScript cDNA Synthesis Kit (Bio-Rad, Hercules, USA). After reverse transcription, RT-qPCR was performed on a QuantStudio® 3 (Applied Biosystems, Foster City, USA) using SYBR Green quantitative PCR master mix (TaKaRa, Dalian, China) according to the manufacturer's instructions. All amplifications were normalized to β-actin. Data were analyzed using the comparison Ct (2−∆∆Ct) method and expressed as fold change compared to the corresponding control. The primer sequences used for the RT-qPCR assay were shown in Table 1.
Sequences of the primers used for RT-qPCR
| Gene | Forward primer (5′→3′) | Reverse primer (5′→3′) |
|---|---|---|
|
|
|
| IL-6 | TTCTTGGGACTGATGCTG | CTGGCTTTGTCTTTCTTGTT |
| IL-1β | TCGACAGTGAGGAGAATGACC | GAAGGTGCTTGGGTCCTCAT |
| IL-18 | TATCGACCGAACAGCCAACG | GTGTCCTGGCACACGTTTCT |
| TGF-β1 | TGGCCAGATCCTGTCCAAAC | GTTGTACAAAGCGAGCACCG |
| Collagen I | CACCCTCAAGAGCCTGAGTC | GTTCGGGCTGATGTACCAGT |
| β-actin | GAGGGAAATCGTGCGTGAC | GCATCGGAACCGCTCATT |
| Gene | Forward primer (5′→3′) | Reverse primer (5′→3′) |
|---|---|---|
|
|
|
| IL-6 | TTCTTGGGACTGATGCTG | CTGGCTTTGTCTTTCTTGTT |
| IL-1β | TCGACAGTGAGGAGAATGACC | GAAGGTGCTTGGGTCCTCAT |
| IL-18 | TATCGACCGAACAGCCAACG | GTGTCCTGGCACACGTTTCT |
| TGF-β1 | TGGCCAGATCCTGTCCAAAC | GTTGTACAAAGCGAGCACCG |
| Collagen I | CACCCTCAAGAGCCTGAGTC | GTTCGGGCTGATGTACCAGT |
| β-actin | GAGGGAAATCGTGCGTGAC | GCATCGGAACCGCTCATT |
Sequences of the primers used for RT-qPCR
| Gene | Forward primer (5′→3′) | Reverse primer (5′→3′) |
|---|---|---|
|
|
|
| IL-6 | TTCTTGGGACTGATGCTG | CTGGCTTTGTCTTTCTTGTT |
| IL-1β | TCGACAGTGAGGAGAATGACC | GAAGGTGCTTGGGTCCTCAT |
| IL-18 | TATCGACCGAACAGCCAACG | GTGTCCTGGCACACGTTTCT |
| TGF-β1 | TGGCCAGATCCTGTCCAAAC | GTTGTACAAAGCGAGCACCG |
| Collagen I | CACCCTCAAGAGCCTGAGTC | GTTCGGGCTGATGTACCAGT |
| β-actin | GAGGGAAATCGTGCGTGAC | GCATCGGAACCGCTCATT |
| Gene | Forward primer (5′→3′) | Reverse primer (5′→3′) |
|---|---|---|
|
|
|
| IL-6 | TTCTTGGGACTGATGCTG | CTGGCTTTGTCTTTCTTGTT |
| IL-1β | TCGACAGTGAGGAGAATGACC | GAAGGTGCTTGGGTCCTCAT |
| IL-18 | TATCGACCGAACAGCCAACG | GTGTCCTGGCACACGTTTCT |
| TGF-β1 | TGGCCAGATCCTGTCCAAAC | GTTGTACAAAGCGAGCACCG |
| Collagen I | CACCCTCAAGAGCCTGAGTC | GTTCGGGCTGATGTACCAGT |
| β-actin | GAGGGAAATCGTGCGTGAC | GCATCGGAACCGCTCATT |
Detection of inflammatory factors by ELISA assay
Heart tissues were homogenized in lysis buffer using a glass homogenizer and then centrifuged at 20,000 g at 4°C for 15 min. The supernatant was collected after centrifugation. The levels of TNF-α, IL-1β and IL-6 in the supernatant were measured using the corresponding ELISA kits (BGK16599, BGK5BKB0, BGK2060; Peprotech Company, Rocky Hill, USA) according to the manufacturer’s instructions. Briefly, samples were placed into the wells of the plate and the plate was then incubated for 30 min at 37°C. The liquid in the wells was removed, and the plate was washed with washing buffer for five times. Then enzyme labeling reagents (50 μl) were added to the wells and incubated for 30 min at 37°C. After that, the liquid in the wells was removed, and the plate was washed again with washing buffer for five times. Then Chromogenic agent A (50 μl) and Chromogenic agent B (50 μl) were added to each well, and the plate was incubated at 37°C for 15 min, followed by addition of 50 μl stop buffer into each well. The absorbance at 450 nm was measured using the spectrophotometric plate reader. The concentration standard curve was plotted and the concentrations in the samples were calculated according to the standard curve.
Deternination of malondialdehyde, protein carbonyl content and NADPH oxidase activity
Malondialdehyde content and protein carbonyl content in the supernatant were determined using the TBARS Assay Kit (Cat No: 10009055; Cayman Chemical Co., Ann Arbor, USA) and Protein Carbonyl Colorimetric Assay Kit (Cat No: 10005020; Cayman Chemical Co.) respectively according to the manufacturer’s instructions. NADPH oxidase activity in the supernatant was measured using the NADP/NADPH Quantification colorimetric Kit (Cat No: K347-100; BioVision Inc., Milpitas, USA).
Western blotting analysis
Heart tissues were homogenized in RIPA lysis buffer (Beyotime Biotechnology, Shanghai, China) using a tissue grinder and then centrifuged at 12,000 g at 4°C for 15 min. The supernatant was collected after centrifugation. Protein samples were separated by 10% SDS-PAGE and transferred to nitrocellulose membranes (ThermoFisher Scientific). After being blocked in 10% milk in TBST buffer (10 mM Tris-HCl, 120 mM NaCl, and 0.1% Tween 20, pH 7.4) for 1 h at room temperature, membranes were incubated with various primary antibodies at 4°C overnight. Membranes were then washed three times in TBST buffer, followed by incubation with HRP-conjugated goat anti-rabbit IgG (1:10,000 dilution; Pierce Biotechnology, Rockford, USA) as secondary antibody at room temperature for 1 h and washed three times in TBST buffer. Visualization was carried out using an enhanced chemiluminescence kit (Cat No: WBKLS0100; Millipore, Billerica, USA). The blot image after ECL was captured with a Chemiluminescence imager (G:BOX Chemi XRQ; Syngene, Cambridge, UK). The density of the bands was quantified by densitometry analysis of the imaged blots using Image J software.
Immunohistochemistry
Paraffin-embedded heart sections undergone deparaffinization and rehydration were immersed in citric buffer (0.01 M, pH 10.0) and then incubated with 3% H2O2 for 10 min. Then the sections were blocked with rabbit serum for 30 min at room temperature, followed by incubation with anti-phospho-NF-κB antibody (1:100) at 4°C overnight. After washing, sections were incubated with the HRP-conjugated goat anti-rabbit IgG secondary antibody. After washing, the sections were stained with DAB and counterstained with hematoxylin. The slides were observed under the microscope at 400× magnification. Phospho-NF-κB nuclear positive cell stained brownish yellow or tan. The ratio of phospho-NF-κB nuclear positive cells = Nuclear positive cell number per field/Total cell number per field. Five fields were evaluated per tissue sample.
Statistical analysis
Data were expressed as the mean ± SEM. Comparison of multiple groups was performed by one-way analysis of variance followed by Turkey’s post hoc test. A probability level of P less than 0.05 was used to establish significance.
Results
TLR2 expression was increased in heart tissues from rats with high-fat diet
To investigate the specificity of our monoclonal anti-TLR2 antibody against TLR2, we performed western blotting experiment. As shown in Fig. 1A, both the monoclonal antibody (1:1000 dilution) we prepared and the commercial anti-TLR2 antibody could detect TLR2 protein in the heart lysate. However, no band was detected when our monoclonal antibody was pre-incubated with purified 405 T~573Q peptide of rat TLR2 1 h before detection (data not shown). Rats with high-fat diet showed higher body weight than rats with normal diet. Our monoclonal anti-TLR2 antibody showed a tendency to decrease rat body weight under high-fat diet condition, but there was no statistical significance (P = 0.102; Fig. 1B). TLR2 expression in different heart tissues was also investigated by RT-qPCR and western blot analysis. Interestingly, both the mRNA level (Fig. 1C) and protein expression (Fig. 1D) of TLR2 were increased in heart tissues from rats with high-fat diet. However, anti-TLR2 antibody had no effect on high-fat-induced TLR2 overexpression. These data indicated that TLR2-related inflammatory response occurred in high-fat-related heart tissue.
TLR2 mRNA level was increased in the heart tissues from rats with high-fat diet (A) TLR2 was detected by our prepared monoclonal anti-TLR2 antibody or commercial anti-TLR2 antibody. (B) Rat body weight in different groups. Rats of the high-fat group showed higher body weight than the control group. Whereas, anti-TLR2 antibody showed a tendency to decrease rat body weight under high-fat diet condition. (C) RT-qPCR analysis of TLR2 mRNA level in the hearts. (D) Representative western blot analysis for TLR2 protein in the heart tissues. TLR2 level was increased in the heart tissues from the high-fat group as well as the TLR2 antibody group. Data were presented as the mean ± SEM, n = 6–8. *P < 0.05, **P < 0.01 vs control group.
Anti-TLR2 antibody attenuated high-fat-induced heart fibrosis
To explore whether anti-TLR2 antibody functions against high-fat-related cardiac fibrosis, we performed masson staining to detect the cardiac fibrosis area. In the high-fat group, the percentage of fibrosis area was 17.03% ± 1.02%. Anti-TLR2 antibody significantly reduced fibrosis area to 3.49% ± 0.33% under high-fat condition (Fig. 2A,B). Transforming growth factor-β1 (TGF-β1) and Collagen I are two common fibrosis bio-markers. Therefore RT-qPCR was performed to detect the mRNA expressions of TGF-β1 and Collagen I. Results showed that the mRNA levels of TGF-β1 and Collagen I were significantly increased in heart tissues from rats fed with high-fat diet. Administration of anti-TLR2 antibody significantly reduced the TGF-β1 and Collagen I transcription induced by high-fat treatment (Fig. 2C,D). These data indicated that high-fat diet could induce cardiac fibrosis and anti-TLR2 antibody could attenuate high-fat-related heart fibrosis.
Anti-TLR2 antibody attenuated high-fat-induced heart fibrosis (A) Represent images for masson staining in heart tissues from different groups of rats. (B) Quantitative analysis of Masson-staining area. Anti-TLR2 antibody decreased Masson-staining area. (C,D) RT-qPCR analysis of mRNA levels of TGF-β1 (C) and Collagen I (D) in heart tissues from different groups of rats. Administration of anti-TLR2 antibody reduced high-fat-induced TGF-β1 and Collagen I overexpression. n = 6–8. Data were presented as the mean ± SEM. ***P < 0.001 vs control group (Con); ###P < 0.001 vs high-fat group. Scale bar, 100 μm.
Anti-TLR2 antibody attenuated high-fat-induced myocardial apoptosis
To study the protective effect of anti-TLR2 antibody on cardiac cells, we performed TUNEL assay and detected caspase-3 activity in different heart tissues. Myocardial cell apoptosis was examined by TUNEL assay. Compared with the control, high-fat diet increased TUNEL-positive apoptotic myocardial cells to 22.67% ± 1.98%. In contrast, anti-TLR2 antibody significantly decreased high-fat-induced myocardial apoptosis rate to 8.00% ± 0.97% (Fig. 3A,B). Further analysis found that caspase-3 activity was increased in the heart tissues from rats of the high-fat group compared that in the controls; while anti-TLR2 antibody retarded the increase of caspase-3 activity in the heart tissues from rats of the high-fat group (Fig. 3C). These results confirmed the cardioprotective effect of anti-TLR2 antibody.
Anti-TLR2 antibody attenuated high-fat-induced myocardial apoptosis Represent images for TUNEL staining in heart tissues from different groups of rats. (B) TUNEL positive cells were counted. High-fat diet increased TUNEL positive cells and anti-TLR2 antibody decreased it. (C) Caspase-3 activity in heart tissues of different groups of rats. n = 6–8. Data were presented as the mean ± SEM. **P < 0.01, ***P < 0.001 vs control group; #P < 0.05, ###P < 0.001 vs high-fat group. Scale bar, 50 μm.
Anti-TLR2 antibody inhibited NF-κB activation
NF-κB is an important downstream target in the TLR2 signaling pathway [22,23]. We then detected NF-κB level by western blot analysis and immunohistochemical analysis in heart tissues from differently treated rats. It was shown that high-fat diet increased NF-κB phosphorylation and anti-TLR2 antibody attenuated high-fat-induced NF-κB phosphorylation (Fig. 4A,B). Immunohistochemistry staining further revealed that phosphorylated NF-κB was augmented in heart tissues of the high-fat group and anti-TLR2 antibody inhibited this effect (Fig. 4C,D). These data indicated that anti-TLR2 antibody may exert its cardiac protective effect against high-fat-induced heart injury by inhibition of NF-κB activation.
Anti-TLR2 antibody inhibited NF-κB activation (A,B) Representative western blots (A) and quantitative analysis (B) for NF-κB (p65) phosphorylation in heart tissues. High-fat diet increased NF-κB (p65) phosphorylation and anti-TLR2 antibody inhibited high-fat-induced NF-κB (p65) phosphorylation. (C,D) Immunohistochemical staining and quantitative analysis of nucleus phospho-NF-κB (p65) in heart tissues. n = 6–8. Data were presented as the mean ± SEM. **P < 0.01, ***P < 0.001 vs control group; ##P < 0.01 vs high-fat group. Scale bar, 50 μm.
Anti-TLR2 antibody attenuated the expression of inflammatory cytokines in the heart tissues from rats with high-fat diet
High-fat diet often induces inflammatory response in animals [24]. We then explored the expressions of IL-1β, TNF-α, IL-6, and IL-18 inflammatory cytokines in heart tissues by RT-qPCR and ELISA assay. IL-1β, TNF-α, IL-6, and IL-18 mRNA levels were remarkably increased in the hearts of high-fat group rats. Of note, the expression levels of these inflammatory factors were depressed by treatment with anti-TLR2 antibody (Fig. 5A–D). ELISA results further confirmed that IL-1β, TNF-α, and IL-6 protein expressions were also enhanced in the heart tissues from high-fat group rats and anti-TLR2 antibody inhibited the high-fat-induced expressions of these cytokine factors (Fig. 5E–G). These results hinted that TLR2 antibody attenuated the expression of inflammatory cytokines in the heart tissues from rats fed with high-fat diet.
Anti-TLR2 antibody diminished pro-inflammatory cytokines expression in rats with high-fat diet (A–D) RT-qPCR analysis of mRNA levels of IL-1β (A), TNF-α (B), IL-6 (C), and IL-18 (D). (E–G) ELISA analysis of protein levels of IL-1β (E), TNF-α (F) and IL-6 (G) in heart tissues from different groups of rats. IL-1β, TNF-α, IL-6, and IL-18 were highly expressed in the heart tissues from rats fed with high-fat diet. Anti-TLR2 antibody diminished these pro-inflammatory cytokines expression. Data were presented as the mean ± SEM, n = 6–8. ***P < 0.001 vs control group; ##P < 0.01, ###P < 0.001 vs high-fat group.
Anti-TLR2 antibody showed no effects on oxidative stress
Malondialdehyde and protein carbonylation are two by-products of lipid and protein oxidation, and NADPH oxidase is a major factor for reactive oxygen species production in the heart [25]. Here we assayed malondialdehyde content, protein carbonyl content and NADPH oxidase activity by using TBARS assay kit, protein carbonyl colorimetric assay kit and NADP/NADPH quantification colorimetric kit, respectively. The results showed that malondialdehyde and protein carbonylation levels were both increased in the heart tissues of high-fat group rats (Fig. 6A,B). NADPH oxidase activity was also significantly increased in the heart tissues from high-fat group rats (Fig. 6C). Anti-TLR2 antibody had no effect on high-fat-induced increase of malondialdehyde and protein carbonyl content, or NADPH oxidase activation (Fig. 6A–C). These data suggested that high-fat diet could induce oxidative stress, while anti-TLR2 antibody had no effect on the high-fat-induced accumulation of reactive oxygen species.
Anti-TLR2 antibody had no effects on oxidative stress (A–D) Malondialdehyde content (A), protein carbonyl contents (B), and NADPH oxidase activity (C) in the heart tissues of different groups of rats. Malondialdehyde contents, protein carbonyl contents and NADPH oxidase activity were increased in heart tissues from rats with high-fat diet. Anti-TLR2 antibody showed no effect on the high-fat-induced oxidative stress in the rat heart. Data were presented as the mean ± SEM, n = 6–8. **P < 0.01, ***P < 0.001 vs control group.
Discussion
Obesity, usually caused by high-fat diets, has been regarded as an independent risk factor and a direct cause of cardiovascular diseases. More than 50 years ago, accumulation of lipids around the heart epicardium was reported in obese patients and correlated with cardiac dysfunction [26]. It has been proved that obesity induces cardiac lipid accumulation, alters myocardial signal intensity [27], impairs systolic function and increases left ventricular mass [28]. Furthermore, pericardial fat and normal ectopic fat in obesity is highly associated with heart fibrosis [29].
Toll-like receptors (TLRs), as innate immunological factors, participate in the pathophysiological progression of heart disease, including myocardial ischemia-reperfusion (I/R) injury [30] and doxorubicin-induced heart failure [31]. TLRs, especially TLR4, also play key roles in the pathogenesis of high-fat-induced heart injury. Li W et al. reported that palmitic acid, a free fatty acid, could activate TLR4 in H9c2 myocardial cell [5]. Animal studies proved that TLR4 was highly expressed in myocardium under high-fat diet [17]. Hu et al. [18]. proved that absence of TLR4 attenuated high-fat-induced cardiac dysfunction. TLR2 also is an important member of TLR family. Previous reports revealed that TLR2 dominates over TLR 4 in stressful conditions for its detrimental role in the heart [32]. However, whether TLR2 has some effect on high-fat-related cardiac injury is still unknown. In this study, we proved that TLR2 was highly expressed in the hearts of rats fed with high-fat diet. Furthermore, we observed that anti-TLR2 antibody could rescue high-fat-induced cardiovascular fibrosis and cardiac cell apoptosis, evidenced by alleviated Masson staining area, decreased Collagen I and TGF-β1 mRNA levels, and reduced TUNEL-positive nuclei staining and caspase-3 activity. These findings indicated that TLR2 could be a target for the treatment of high-fat-related cardiac injury.
NF-κB is one of the famous downstream factors of TLRs activation [33]. Activation of TLR2 leads to NF-κB phosphorylation and activation [34,35]. NF-κB further induces the expression of pro-inflammatory genes, such as TNF-α, IL-1β, IL-6, and IL-18 [36,37]. Inhibition of the NF-κB pathway may have a beneficial effect in anti-inflammation. In accordance with previous reports [16,23,38], we also observed that high-fat diet induced NF-κB phosphorylation and increased the expressions of IL-1β, TNF-α, IL-18 and IL-6. Interestingly, anti-TLR2 antibody was found to block NF-κB activation and the expressions of downstream inflammatory cytokines. TLR2 has been suggested to mediate cardiac inflammation as well as dysfunction [39,40]. Perhaps, anti-TLR2 antibody may protect the heart against high-fat-related cardiac injury via blocking the TLR2/NF-κB/inflammation pathway.
Increased oxidative stress is a key contributor in the progression of diabetic cardiomyopathy and myocardial cell injury [41,42]. Our results also proved that high-fat diet increased NADPH oxidase activity and induced oxidative stress in the rat heart. However, anti-TLR2 antibody had no effect on the high-fat-induced oxidative stress in the rat heart. Some natural antioxidants obtained by simple nutritional approaches have been found to attenuate oxidative stress and suppress TLR expression, achieving the results similar to our monoclonal anti-TLR2 antibody, including inhibition of NF-κB activation and pro-inflammatory expression [43,44]. Therefore, increased oxidative stress may be an upstream factor of TLR2/NF-κB/inflammation.
In summary, we demonstrated for the first time that TLR2 expression was increased in the heart tissues from rats fed with high-fat diet. Anti-TLR2 antibody could block NF-κB activation, inhibit the expressions of IL-1β, TNF-α, IL-6, and IL-18, and alleviate high-fat-induced cardiac fibrosis and cell apoptosis. These novel results may help us to understand the important role of TLR2 in the metabolic syndrome-related heart damage.
Funding
The work was supported by the grants from the National Natural Science Foundation of China (No. 81400232), the Natural Science Foundation of Shaanxi Province (No. 2016JM8021), and the Fundamental Research Funds for the Central Universities.
References
Author notes
Wanzheng Wang and Litao Wu authors contributed equally to this work.
