https://orcid.org/0000-0002-4146-2071
Abstract
Autoimmune ovarian disease (AOD) is considered to be a major cause of premature ovarian failure (POF). The immunomodulatory properties of human amniotic epithelial cells (hAECs) have been studied in many disease models. We previously reported that hAECs restored ovarian function in chemotherapy-induced POF mice, but the immunomodulatory mechanism of hAECs is still unclear. To investigate the effect of hAECs on recipient mice, especially on regulatory Treg cells, hAECs and hAEC-conditioned medium (hAEC-CM) were intravenously injected into AOD mice immunized with zona pellucida protein 3 peptides (pZP3). Ovarian function was evaluated through estrous cycle, hormone secretion, follicle development, and cell apoptosis analysis. Immune cells including CD3, CD4, CD8 and Treg cells in the spleens were tested by flow cytometry. To elucidate the effect of hAEC-CM on macrophage function, inflammation model in vitro was established in RAW264.7 cells induced by lipopolysaccharide (LPS). hAECs and hAEC-CM regulated estrous cycles, promoted follicle development, ameliorated cell apoptosis and fibrosis in ovaries of AOD mice. In addition, hAECs significantly reversed the decrease of pZP3-induced Treg cells in the spleens. In vitro, hAEC-CM significantly inhibited the inflammatory reaction induced by LPS in RAW264.7 cells via up-regulating the expression of M2 macrophage genes. Further study demonstrated that hAEC-secreted transforming growth factor-beta and macrophage inhibitory factor played important roles in the macrophage polarization and migration under inflammatory stimulation. Taken together, hAECs restored ovarian function by up-regulating Treg cells in the spleens and reduced the inflammatory reaction via modulating the activated macrophage function in a paracrine manner in the ovaries of AOD mice.
Introduction
Premature ovarian failure (POF) is the cessation of ovarian function before 40 years of age, which is characterized by low estradiol (E2) and an elevated level of follicle-stimulating hormone (FSH). The reasons for POF are varied, including genetic predisposition, autoimmune and enzymatic disorders, infections, and iatrogenic causes [1]. Autoimmune ovarian disease (AOD) is chronic inflammatory disease [2] and is reportedly associated with many autoimmune diseases in approximately 20% to 30% of women with POF disorder [3]. The immunopathology of AOD is mostly composed of autoimmune oophoritis with predominant infiltration of lymphocytes into the ovary, ovarian atrophy, and serum autoantibodies to ovarian antigens [4]. The ovarian dysfunction induced by autoimmune disease may be related to zone pellucida protein 3 (ZP3, an ovary-specific glycoprotein) antigens. Research has demonstrated that the presence of ZP3 and serum antibodies to ZP antigen (AZPAb) is related to alteration in ovarian function and interferes with normal follicular development, leading to follicular depletion and amenorrhea [5]. Therefore, an experimental murine AOD model could be established via immunization with a peptide of ZP3 (pZP3) to imitate the pathological changes of AOD patients in a clinical setting [6].
Currently, stem cell transplantation is a promising therapy for tissue regeneration and disease treatment. A previous study demonstrated that stem cells derived from various tissues had the ability to restore ovarian function in chemotherapy-induced POF mice, yet more effective were placental derivates [7]. Human amniotic epithelial cells (hAECs) derived from the placenta possessed stem cell-like properties and could differentiate into various types of cells in vivo or in vitro [8–11]. The therapeutic effect of hAECs on ovarian function was highlighted in our previous studies [12–15]. Our research first reported that transplanted hAECs differentiated into granulosa cells (GCs) in the injured ovary [12], and inhibited GC apoptosis induced by chemotherapy [14]. Meanwhile, hAEC-secreted cytokines promoted follicular development and enhanced angiogenesis in ovaries of chemotherapy-induced POF mice [13,15]. Therefore, two different scenarios illustrate the potential effects of hAEC therapy on diminished ovarian function. On one hand, grafted hAECs migrate into the injured ovary and directly differentiate into GCs, participating in follicle development. On the other hand, hAECs help to construct a healthy ovarian microenvironment via secretion of cytokines such as transforming growth factor-beta (TGF-β), growth differentiation factor-9 (GDF-9), bone morphogenetic growth protein-15 (BMP-15), and vascular endothelial growth factor (VEGF), contributing to ovarian function recovery. Increasing evidence indicates that the therapeutic potential of hAECs is associated with immune regulation function in injured tissue. A recent study demonstrated that hAECs ameliorated the pathological progression of experimental autoimmune uveitis through modulation of T cell subsets [16]. In addition, hAECs inhibited inflammation and promoted function recovery in systemic lupus erythematosus models by down-regulating the ratio of Th17/Treg cells [17]. However, there is no evidence as to whether placenta-derived hAECs repair ovarian function through regulating immune function of recipient mice.
In the current study, we investigated the effect of hAECs and hAEC-CM on ovarian function of AOD model mice injected with murine pZP3. Ovarian function and immune response, including estrous cycle, serum hormone levels, ovarian morphology, and Treg cells in the spleen were evaluated respectively. Results demonstrated that hAECs and hAEC-CM transplantation regulated the disordered estrous cycle induced by pZP3 injection, recovered the serum levels of E2 and FSH, increased the number of mature follicles, alleviated the interstitium fibrosis and cell apoptosis in the injured ovaries, and up-regulated the number of Treg cells (CD4+CD25+Foxp3+) in the spleen of AOD mice. Furthermore, hAEC-CM significantly suppressed the inflammatory reaction induced by lipopolysaccharide (LPS) in RAW264.7 macrophages. Importantly, hAEC-secreted TGF-β and macrophage inhibitory factor (MIF) played vital roles in regulating macrophages polarization and migration under inflammatory stimulation. Taken together, these results demonstrated that hAECs restored ovarian function in pZP3-induced AOD mice through up-regulating the number of Treg cells in the spleen and ameliorated inflammatory reaction in a paracrine manner.
Materials and Methods
Peptides
The murine pZP3 was synthesized by an automatic peptide synthesizer (Sangon Biotech, Shanghai, China), and the purity was greater than 97% as determined by high-performance liquid chromatography (HPLC) analysis. The amino acid sequence of the murine pZP3 used in this study was NSSSSQFQIHGPR (ZP3 amino acid residue 330–342).
Establishment of the AOD mouse model
The pZP3-induced AOD mouse model was established according to the literatures [6,18,19]. Female B6AF1 mice of 4 weeks of age were obtained from Shanghai Experimental Animal Center of Chinese Academy of Sciences (Shanghai, China). pZP3 was dissolved in double-distilled water at a concentration of 1 mM and sterilized by ultrafiltration (0.45 μm filter; Millipore, Billerica, USA). Then, they were emulsified in an equal volume of complete Freund’s adjuvant or incomplete Freund’s adjuvant (Sigma, Saint Louis, USA). Mice were immunized subcutaneously in both hind footpads and fore footpads received 0.15 ml pZP3 solution (containing 50 nmol pZP3) three times at different time points. Mice in the sham group received 0.15 ml of double-distilled water. All procedures for animals were approved by the Institutional Animal Care and Use Committee of Shanghai and were performed in accordance with the National Research Council Guide for Care and Use of Laboratory Animals. Efforts were made to minimize animal suffering and limit the number of animals used in the study.
Preparation of hAECs and hAEC-CM
All experiments using hAECs were performed with approval from the Institutional Ethics Committee of the International Peace Maternity and Child Health Hospital, and written informed consent was obtained from all participants. hAECs were isolated as previously described [15]. Briefly, human placentas were obtained at term pregnancy during uncomplicated caesarean sections with written and informed consent from women who tested negative for HIV-I, and hepatitis B and C. Amniotic membranes were mechanically separated from the chorion of the placenta and dissected into several segments after wash with pre-cooled phosphate-buffered saline (PBS). The membrane segments were digested with 0.25% trypsin/EDTA at 37°C for 25min. The resulting cell suspensions were seeded in 10-cm cell culture plates containing DMEM/F12 medium (Gibco, Grand Island, USA) supplemented with 10% fetal bovine serum (FBS; Gibco), streptomycin (100 μg/ml; Gibco), and penicillin (100 U/ml; Gibco) and incubated at 37°C in an incubator containing 5% CO2. Once the density of cells reached 80% to 90% confluency, cells were collected for subsequent experiments.
To prepare hAEC-CM, hAECs (a total of 1×107 cells) were added to 10-cm plates. The complete culture medium was substituted with 10 ml of serum-free DMEM/F12 medium and cultured for 24 h, and the supernatant was aspirated gently, filtered through a 0.22 μm filter, transferred to ultrafiltration conical tubes (Amicon Ultra-15 with membranes selective for 3 kDa), and centrifuged to concentrate the hAEC-CM. The final concentration was adjusted to 10 times the concentration of collected hAEC-CM.
Characterization of hAECs and schematic of transplantation in an AOD model (A) Isolated hAECs showed a cobble stone-like morphology in vitro. (B) Cell surface markers HLADR, SSEA4 and CD324 were analyzed by flow cytometry. The isotypes (ISO) of SSEA4 and CD324 were used as negative controls. (C) Immunostaining images showed the high expression of stem cell markers (OCT4 and TRA-1-60) and epithelial marker (CK7), and the low expression of mesenchymal markers (Vimentin and N-Cadherin) in hAECs. (D) The workflow of the animal experiment conducted in this study. Mice were injected subcutaneously with pZP3 three times at the 5th, 7th, and 9th week. hAECs and hAEC-CM were injected into mice immunized with pZP3 through the tail vein, respectively, at the 6th, 8th, and 10th week. Estrous cycles were monitored from the 10th to 11th week. Scale bar: 100 μm.
Identification of cultured hAECs
To identify hAECs, cells were harvested and stained with primary labeled antibodies as follows according to the technical data sheets: SSEA4 (BioLegend, San Diego, USA), CD324 (BioLegend) and HLADR (BioLegend) for 30 min at 4°C. Cells were then washed with pre-cooled PBS and flow cytometry was performed at once using a FC500 flow cytometer (Beckman Coulter Inc., Miami, USA).
hAECs were further characterized by using the immunofluorescence staining technique. Cells were fixed with 4% paraformaldehyde, and then incubated at 4°C overnight with primary antibodies against the following proteins: OCT4 (1:1000; Cell Signaling Technology, Danvers, USA), TRA-1-60 (1:1000; Cell Signaling Technology), cytokeratin 7 (CK7) (1:200; Boster Biological Technology, Wuhan, China), Vimentin (1:200; WanLeibio, Shenyang, China) and N-Cadherin (1:200; Boster Biological Technology). After that, cells were incubated with secondary antibody conjugated with Alexa Fluor 488 and 594 (1:3000; Cell Signaling Technology). Cells were counterstained with DAPI (Abcam, Cambridge, UK) and examined under a DMi8 fluorescence microscope (Leica, Wetzlar, Germany).
Systemic administration of hAECs and hAEC-CM
According to the experimental design, 2 × 106 hAECs in 200 μl of PBS or an equal volume of the concentrated hAEC-CM were injected into AOD mice through the tail vein three times at different time points, as shown in Fig.1D.
Vaginal smear procedure and estrous cycle phase analysis
Vaginal smears from all animals were performed for 7 consecutive days. At 9:00 am, sterile saline solution was heated to 40°C and carefully inserted into the vagina using a 200 μl pipette. Drops containing vaginal smears were mounted on glass slides, stained with Giemsa Solution (Servicebio, Wuhan, China), and observed under the Leica DMi8 microscope.
The estrous cycle phases of mice were analyzed by two researchers independently using a previously described method [20]. There are four distinct stages in the normal estrous cycle that typically last 4 to 5 days. Each stage of the estrous cycle, including pro-estrus (PE), estrus (E), metestrus (ME), and diestrus (DE), has a unique proportion of epithelial, cuboidal, and leukocytes cells: pro-estrus phase, clusters of nucleated, epithelial cells; estrus phase, numerous cuboidal cells as well as needle-like cornified cells in aggregates; metestrus phase, a mix of leukocytes, epithelial cells, and cuboidal cells in approximately the same proportions; diestrus phase, the same mix of cells as the metestrus phase but with a greater relative percentage of leukocytes.
Histology and immunohistochemistry analysis
Ovaries were collected from different treatment groups (including sham group, PBS, hAECs and hAEC-CM-treated group) and fixed in Bouin’s solution (containing 5% acetic acid, 9% formaldehyde and 0.9 % picric acid), embedded in paraffin, and serially sectioned at a thickness of 5 μm. Hematoxylin-eosin (HE) staining was used to evaluate the morphological structure of the ovary, which was observed under the light microscopy. Follicles at different stages were categorized and counted in the paraffin sections of the ovary. Briefly, a primordial follicle was defined as GCs surrounding a single fusiform oocyte. A primary follicle was surrounded by at least three GCs, resulting in a cubic shape, and a secondary follicle appeared surrounded by at least two layers of GCs with no follicular cavity. Mature follicles (antral follicles) contain at least two layers of GCs, which shows the evidence of follicular cavity [15].
For Caspase-3 and α-SMA immunostaining assays, sections were incubated with monoclonal rabbit anti-α-SMA antibody (1:2000; Servicebio) and anti-Caspase-3 antibody (1:500; Cell Signaling Technology) respectively overnight at 4°C after dewaxing. The sections were incubated with the corresponding biotinylated secondary antibodies (1:200; Vector Laboratories, Burlingame, USA), followed by incubation with avidin-biotin-peroxidase (1:200). The immunoreactivity was visualized using 0.05% diaminobenzidine (Sigma). The sections were then counterstained with hematoxylin. Negative controls received identical treatment except for the omission of primary antibodies, which showed no specific staining.
For the double staining of CD68 and CD163, sections were incubated with primary mouse monoclonal anti-CD68 antibody (1:1000; Abcam) and rabbit monoclonal anti-CD163 antibody (1:1000; Abcam) overnight at 4°C after dewaxing. After wash with PBS, the sections were incubated with the corresponding secondary antibodies conjugated with Alexa Fluor 594 and 488 (1:3000; Cell Signaling Technology). The fluorescent signals were captured with a TCS SP5 confocal laser scanning microscope (Leica).
Flow cytometry
Spleens were minced with a razor blade, washed with PBS, and filtered through 70-μm filter. Erythrocytes were lysed from the samples using a red blood lysis solution (eBioscience, San Diego, USA). For surface staining, cells were incubated with anti-CD3e-FITC, anti-CD4-PE-Cy7, and anti-CD8a-Pacific Blue antibodies (eBioscience) for 30 min. For Treg cell staining, splenocytes were stained using Foxp3 T regulatory cell staining kit (eBioscience) according to the manufacturer’s protocol. Briefly, the samples were incubated with anti-CD4-FITC and anti-CD25-APC antibodies (eBioscience) for 30 min. Samples were then washed, resuspended, and incubated with fixation/permeabilization buffer for 45 min, followed by two washes with permeabilization buffer and incubation with anti-Foxp3-PE antibody (eBioscience) for 30 min. The samples were washed, suspended in PBS with 0.1% bovine serum albumin, and analyzed using the flow cytometry instrument.
Establishment of inflammatory reaction model
Mouse RAW264.7 macrophages were purchased from China Center for Type Culture Collection (Shanghai, China) and cultured in DMEM supplemented with 10% FBS, streptomycin (100 μg/ml), and penicillin (100 U/ml). Incubators were set at 37°C and contained 5% CO2. RAW264.7 cells were plated into 6-well plates and cultured for 24 h and then treated with 1 μg/ml LPS (Yeasen, Shanghai, China). At the same time, the conditioned medium derived from hAECs was added into the culture medium of RAW264.7 cells. Anti-TGF-β antibody (10 ng/ml; Abcam) was added to the hAEC-CM to neutralize the function of TGF-β protein. After 24 h, RAW264.7 cells were collected to detect the expression of inflammation-related genes and the expression of key proteins.
Quantitative real-time polymerase chain reaction analysis
Total RNA was isolated from the ovaries of mice and RAW264.7 cells by using Trizol (Invitrogen, Carlsbad, USA). Quantitative real-time polymerase chain reaction (qRT-PCR) was performed in triplicate, using the SYBR Green Real-time PCR Master Mix (Takara, Tokyo, Japan). PCR primers were designed according to cDNA sequences in the NCBI database (Table1). Cycling conditions for the PCR machine were as follows: 95°C for 5 min, 60°C for 34 s, for 35 cycles. Gene expression levels were evaluated using the delta-delta CT method, standardized to level of GAPDH amplification.
PCR primers used to detect gene expression in mouse ovaries and RAW264.7 macrophages
| Gene | Primer sequence (5′→3′) | Fragment size (bp) |
|---|---|---|
| TNF-α | Forward: CACCATGAGCACAGAAAGCA | 154 |
| Reverse: TAGACAGAAGAGCGTGGTGG | ||
| IL-6 | Forward: CTGCAAGAGACTTCCATCCAG | 131 |
| Reverse: AGTGGTATAGACAGGTCTGTTGG | ||
| IL-1|$\beta $| | Forward: TGCCACCTTTTGACAGTGATG | 220 |
| Reverse: AAGGTCCACGGGAAAGACAC | ||
| iNOS-2 | Forward: CAGCTGGGCTGTACAAACCTT | 95 |
| Reverse: CATTGGAAGTGAAGCGTTTCG | ||
| IL-10 | Forward: TAAGGCTGGCCACACTTGAG | 209 |
| Reverse: GTTTTCAGGGATGAAGCGGC | ||
| CD206 | Forward: GTTCACCTGGAGTGATGGTTCTC | 116 |
| Reverse: AGGACATGCCAGGGTCACCTTT | ||
| FIZZ | Forward: CCCAGGATGCCAACTTTGA | 223 |
| Reverse: AGGAGGCCCATCTGTTCA | ||
| Arg-1 | Forward: CAAGACAGGGCTCCTTTCAG | 160 |
| Reverse: GTAGTCAGTCCCTGGCTTATGG | ||
| GAPDH | Forward: CCAATGTGTCCGTCGTGGATCT | 149 |
| Reverse: GTTGAAGTCGCAGGAGACAACC |
| Gene | Primer sequence (5′→3′) | Fragment size (bp) |
|---|---|---|
| TNF-α | Forward: CACCATGAGCACAGAAAGCA | 154 |
| Reverse: TAGACAGAAGAGCGTGGTGG | ||
| IL-6 | Forward: CTGCAAGAGACTTCCATCCAG | 131 |
| Reverse: AGTGGTATAGACAGGTCTGTTGG | ||
| IL-1|$\beta $| | Forward: TGCCACCTTTTGACAGTGATG | 220 |
| Reverse: AAGGTCCACGGGAAAGACAC | ||
| iNOS-2 | Forward: CAGCTGGGCTGTACAAACCTT | 95 |
| Reverse: CATTGGAAGTGAAGCGTTTCG | ||
| IL-10 | Forward: TAAGGCTGGCCACACTTGAG | 209 |
| Reverse: GTTTTCAGGGATGAAGCGGC | ||
| CD206 | Forward: GTTCACCTGGAGTGATGGTTCTC | 116 |
| Reverse: AGGACATGCCAGGGTCACCTTT | ||
| FIZZ | Forward: CCCAGGATGCCAACTTTGA | 223 |
| Reverse: AGGAGGCCCATCTGTTCA | ||
| Arg-1 | Forward: CAAGACAGGGCTCCTTTCAG | 160 |
| Reverse: GTAGTCAGTCCCTGGCTTATGG | ||
| GAPDH | Forward: CCAATGTGTCCGTCGTGGATCT | 149 |
| Reverse: GTTGAAGTCGCAGGAGACAACC |
PCR primers used to detect gene expression in mouse ovaries and RAW264.7 macrophages
| Gene | Primer sequence (5′→3′) | Fragment size (bp) |
|---|---|---|
| TNF-α | Forward: CACCATGAGCACAGAAAGCA | 154 |
| Reverse: TAGACAGAAGAGCGTGGTGG | ||
| IL-6 | Forward: CTGCAAGAGACTTCCATCCAG | 131 |
| Reverse: AGTGGTATAGACAGGTCTGTTGG | ||
| IL-1|$\beta $| | Forward: TGCCACCTTTTGACAGTGATG | 220 |
| Reverse: AAGGTCCACGGGAAAGACAC | ||
| iNOS-2 | Forward: CAGCTGGGCTGTACAAACCTT | 95 |
| Reverse: CATTGGAAGTGAAGCGTTTCG | ||
| IL-10 | Forward: TAAGGCTGGCCACACTTGAG | 209 |
| Reverse: GTTTTCAGGGATGAAGCGGC | ||
| CD206 | Forward: GTTCACCTGGAGTGATGGTTCTC | 116 |
| Reverse: AGGACATGCCAGGGTCACCTTT | ||
| FIZZ | Forward: CCCAGGATGCCAACTTTGA | 223 |
| Reverse: AGGAGGCCCATCTGTTCA | ||
| Arg-1 | Forward: CAAGACAGGGCTCCTTTCAG | 160 |
| Reverse: GTAGTCAGTCCCTGGCTTATGG | ||
| GAPDH | Forward: CCAATGTGTCCGTCGTGGATCT | 149 |
| Reverse: GTTGAAGTCGCAGGAGACAACC |
| Gene | Primer sequence (5′→3′) | Fragment size (bp) |
|---|---|---|
| TNF-α | Forward: CACCATGAGCACAGAAAGCA | 154 |
| Reverse: TAGACAGAAGAGCGTGGTGG | ||
| IL-6 | Forward: CTGCAAGAGACTTCCATCCAG | 131 |
| Reverse: AGTGGTATAGACAGGTCTGTTGG | ||
| IL-1|$\beta $| | Forward: TGCCACCTTTTGACAGTGATG | 220 |
| Reverse: AAGGTCCACGGGAAAGACAC | ||
| iNOS-2 | Forward: CAGCTGGGCTGTACAAACCTT | 95 |
| Reverse: CATTGGAAGTGAAGCGTTTCG | ||
| IL-10 | Forward: TAAGGCTGGCCACACTTGAG | 209 |
| Reverse: GTTTTCAGGGATGAAGCGGC | ||
| CD206 | Forward: GTTCACCTGGAGTGATGGTTCTC | 116 |
| Reverse: AGGACATGCCAGGGTCACCTTT | ||
| FIZZ | Forward: CCCAGGATGCCAACTTTGA | 223 |
| Reverse: AGGAGGCCCATCTGTTCA | ||
| Arg-1 | Forward: CAAGACAGGGCTCCTTTCAG | 160 |
| Reverse: GTAGTCAGTCCCTGGCTTATGG | ||
| GAPDH | Forward: CCAATGTGTCCGTCGTGGATCT | 149 |
| Reverse: GTTGAAGTCGCAGGAGACAACC |
Western blot analysis
Protein was extracted from cells using radio immunoprecipitation assay buffer (Beyotime, Shanghai, China) supplemented with protease inhibitor cocktail (TransGen Biotech, Beijing, China) and phosphatase inhibitor (TransGen Biotech), and the concentrations were quantified using a bicinchoninic acid protein assay kit (Boster). An equivalent amount of the proteins (20 μg) was loaded and separated on 12% SDS-polyacrylamide gel and transferred to PVDF membranes (Millipore). The membranes were blocked with 5% milk in TBST (Tris-buffered saline, 10 mM Tris-HCl, pH 7.5, 150 mM NaCl, and 0.1% Tween-20) for 1 h at room temperature and incubated with primary antibodies at 4°C overnight. The following primary antibodies and dilutions were used: mouse anti-CD68 (1:500), rabbit anti-CD163 (1:500), rabbit anti-iNOS (1:500; Cell Signaling Technology), and anti-GAPDH (1:10,000; Yeasen). Then, the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (1:1000; Yeasen) for 1 h at room temperature. The visualization of the blots was performed using the standard protocol for the enhanced chemiluminescence kit (Santa Cruz Biotechnology, Santa Cruz, USA).
Enzyme-linked immunosorbent assay
Blood samples of mice were collected, and centrifuged at 900 g for 15 min to harvest the serum. Levels of E2, FSH and AZPAb were measured using enzyme-linked immunosorbent assay (ELISA) kits (Westang, Shanghai, China) according to the manufacturer’s instruction.
The hAEC-CM (1#, 2#, 3#, and 4#) was harvested from different primary hAECs (from four different amniotic samples). According to the instruction manual, human MIF and IL2 were measured using the corresponding ELISA Kits (Lianke, Hangzhou, China) and the results were calculated based on the standard curve.
Transwell migration assay
RAW264.7 cells (1×105) were added to each upper compartment containing serum-free DMEM, while medium with 10% FBS used as a chemical inducer was added to the lower compartment (8-μm pore size transwell system; Corning Co., Corning, USA). To the upper compartment, 1 μg/ml LPS was added with or without hAEC-CM. At the same time, anti-MIF antibody (10 ng/ml; Cell Signaling Technology) was used to neutralize the MIF protein in hAEC-CM. After 24 h, 0.1% crystal violet was used to stain the cells on the underside of the cell membrane. The cells on the underside of the transwell membrane were measured and counted under the Leica DMi8 microscope.
Statistical analysis
Results were graphed and analyzed using the GraphPad Prism Soft System. Data are expressed as the mean±SEM. Differences between the groups were evaluated by Student’s t-test. Statistical significance was established at P< 0.05.
Results
Identification and characterization of hAECs
The isolated hAECs exhibited a cobble stone-like morphology under microscope (Fig.1A). Flow cytometry was used to detect the phenotype of hAECs. Results showed that cultured hAECs did not express HLADR (MHC class II), and the majority of hAECs expressed stem cell marker SSEA4 (98.7%) and epithelial marker CD324 (99.8%) (Fig.1B). Morphologically, hAECs strongly expressed stem cell markers OCT4 and TRA-1-60, epithelial marker CK7, and the expressions of mesenchymal markers Vimentin and N-Cadherin were low (Fig.1C), suggesting that highly purified hAECs were isolated.
hAECs and hAEC-CM transplantation regulated estrous cycle disorder induced by pZP3 injection
The experimental AOD mouse model was established by injecting with pZP3 three times at the beginning of the fifth week. During that time, hAECs and hAEC-CM were injected into the AOD mice via the tail vein, respectively, as shown in Fig.1D.
Effects of hAECs and hAEC-CM on the estrous cycles and ovarian function of AOD mice (A) Morphological characteristics of vaginal smear cells at different stages, including diestrus (DE), proestrus (PE), estrus (E) and metestrus (ME). (B) The estrous cycles of each mouse were monitored for 7 consecutive days in the different treatment groups. (C) The column showed the percentage of substages of DE, PE, E and ME in the different treatment groups. (D) The levels of serum E2, FSH, and AZPAb of mice in different treatment groups were detected by ELISA. Data are presented as the mean±SEM. *P<0.05 vs Sham group; #P<0.05 vs AOD group.
Effect of hAECs and hAEC-CM transplantation on follicular development in the ovaries of AOD mice (A) Representative images of HE-stained ovarian sections obtained from different groups after hAECs and hAEC-CM treatment. Mature and secondary follicles were indicated by the black arrow and arrowhead, respectively. (B) The column displayed the number of primordial, primary, secondary, and mature follicles per ovary section in the different treatment groups. (C) Immunohistochemisty of Caspase-3 and α-SMA in the ovaries of mice in different treatment groups. (D) The column displayed the number of α-SMA positive cells in the different groups. (E) Double immunofluorescent staining of CD68 and CD163 in ovarian section. (F) Inflammatory-related genes expression in ovarian tissues was detected in different treatment groups by qRT-PCR. Scale bar: 100 μm. Data are presented as the mean±SEM. *P<0.05 vs Sham group; #P<0.05 vs AOD group.
The estrous cycles of each mouse in the different groups were observed for 7 consecutive days before sacrifice. Vaginal smears were performed, and morphological characterization of the smears in every sub-stage was shown (Fig.2A). Normal female mice in the sham group expressed regular estrous cycles with a duration of 4 to 6 days: diestrus for 1 to 2 days, proestrus for 1 day, estrus for 1 to 2 days, and metestrus for 1 day. However, mice immunized with pZP3 (AOD group) presented an irregular estrous cycle, including prolonged diestrus and lack of estrus compared with the sham group. Importantly, hAECs and hAEC-CM transplantation regulated the disordered estrous cycle induced by pZP3 injection (Fig.2B). According to the ratio of the sub-stage, mice in the AOD group displayed a shortened estrus (red) and prolonged diestrus (purple). The percentage of estrus in hAECs and hAEC-CM treatment groups was longer than those in the AOD group (Fig.2C). Following pZP3 injection, the serum FSH and AZPAb levels were significantly higher than those in the sham group, but the E2 level was lower. Compared with the AOD group, hAECs and hAEC-CM treatment partially increased the level of E2 and decreased FSH and AZPAb levels in the serum of AOD mice (Fig.2D, P<0.05). These data indicated that hAECs transplantation or hAEC-CM injection could regulate estrous cycle and restore ovarian function of AOD mice.
hAECs and hAEC-CM transplantation promoted follicle development in the ovaries of AOD mice
Histological examination was conducted in different groups to evaluate ovarian function. A large number of healthy follicles, including mature follicles and secondary follicles, existed in the ovaries of the sham group (Fig.3A, a,e). Mice immunized with pZP3 showed a significant loss of growing follicles in AOD group (Fig.3A, b,f). However, healthy mature follicles were observed in hAECs and hAEC-CM treatment groups (Fig.3A, c,d,g,h). Follicle counting results showed that pZP3 injection significantly disturbed follicular development, manifested as the reduction of primordial, primary, and mature follicles; however, transplantation of hAECs and hAEC-CM significantly increased the number of primordial and mature follicles in the ovaries of AOD mice (Fig.3B, P<0.05). Research demonstrated that ovarian oophoritis and fibrosis were the main features in mice immunized with pZP3, which severely influenced follicle development [18]. In the current study, Caspase-3 was observed in the interstitial cells and granulosa cells in the ovaries of AOD mice. At the same time, the number of α-SMA positive cells in the AOD group was significantly increased compared with the sham group. Intriguingly, hAECs and hAEC-CM treatment reduced cell apoptosis and the fibrosis of ovaries induced by pZP3 injection (Fig.3C,D, P<0.05).
Effect of hAECs and hAEC-CM transplantation on immune cells in the spleen of AOD mice (A–C) CD3, CD4 and CD8 surface stainings were carried out in splenocytes of mice in different treatment groups. (D) The percentage of Treg cells (CD4+CD25+Foxp3+) in lymphocytes was compared among the groups. Data are presented as the mean±SEM. *P<0.05 vs Sham group; #P<0.05 vs AOD group.
To further study the effect of hAECs and hAEC-CM on macrophage polarization, immunofluorescent staining was used to observe macrophage polarization in the ovaries of AOD mice. CD68 and CD163 are relative and commonly accepted markers for total macrophages and M2 macrophages, respectively. Results showed that pZP3 injection increased macrophage infiltration (CD68+) in ovaries compared with the sham group; however, hAECs and hAEC-CM treatment increased M2 macrophages (CD68+CD163+) in the ovaries of AOD mice (Fig.3E). Importantly, the expressions of anti-inflammatory genes, including CD206, FIZZ, and Arg-1 produced by alternatively activated macrophages, were significantly reduced in the ovaries of pZP3-immunized mice, whereas hAECs and hAEC-CM treatment partially increased the expressions of these genes in the ovaries of AOD mice (Fig.3F, P<0.05).
hAEC transplantation increased CD4+CD25+Foxp3+ Treg cells in the spleen of AOD mice
To further investigate whether Treg cells in recipient AOD mice are involved in the recovery of ovarian function induced by hAEC transplantation and hAEC-CM treatment, fresh splenocytes from different treatment groups were harvested to perform flow cytometry analysis. Results showed that the percentage of CD3+ was significantly decreased in the spleen of mice immunized with pZP3 compared with that in the sham group (Fig.4A, P<0.05). There was no significant difference in the proportion of CD4+CD3+ and CD8+CD3+ among the different treatment groups (Fig.4B,C). Interestingly, the percentage of Treg cells (CD4+CD25+Foxp3+) was significantly decreased in the spleen of AOD mice compared with that in the sham group. However, hAEC transplantation significantly increased the number of Treg cells in the spleen of AOD mice (Fig.4D, P<0.05). These results demonstrated that systemic hAEC transplantation exerted a direct immunomodulatory effect on AOD mice immunized with pZP3.
hAEC-secreted cytokines inhibited LPS-induced inflammatory responses by regulating the function of macrophages in RAW264.7 cells
Our previous study demonstrated that hAECs secreted large amounts of cytokines into the extracellular space during the culture process, including immune regulatory factors [15]. To elaborate the immunomodulatory effect of hAECs on ovarian function of AOD mice, we established an inflammatory reaction model in RAW264.7 cells stimulated with 1 μg/ml LPS. hAEC-CM was added into the culture medium of RAW264.7 cells. After 24 h, the expressions of pro-inflammatory and anti-inflammatory genes were detected by qRT-PCR. Results showed that LPS dramatically increased the expressions of pro-inflammatory genes, including tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), IL-1beta (IL-1β), iNOS-2 and decreased the expressions of anti-inflammatory genes IL-10 and CD206 in RAW264.7 cells. However, hAEC-CM significantly inhibited the expressions of pro-inflammatory genes, including TNF-α, IL-6 and iNOS-2, and increased the expressions of IL-10 and CD206 genes. Intriguingly, hAEC-CM had no significant effect on the expression of these genes in the absence of LPS (Fig.5A,B, P<0.05). In the previous study [15], hAEC-secreted TGF-β was found to protect granusola cells from chemotherapy-induced injury via regulating smad signaling pathway. In the current study, we found that hAEC-CM significantly inhibited the increased protein expression of pro-inflammatory iNOS (M1 macrophages) induced by LPS, and slightly up-regulated the protein expression of CD163 (M2 macrophages) (Fig.5C). Importantly, the anti-inflammation ability of hAEC-CM was partially attenuated when anti-TGF-β antibody was added into hAEC-CM to neutralize its function (Fig.5C).
Effect of hAEC-CM on inflammatory responses in RAW264.7 macrophage cells (A) Representative images of RAW 264.7 cells treated with 1 μg/ml LPS for 24 h with or without hAEC-CM. (B) qRT-PCR was preformed to detect the expressions of inflammatory-related genes in RAW264.7 cells. (C) Western blot analysis was used to detect the expression of iNOS, CD163, and CD68 protein in different treatment groups. (D) Relative expression of the enriched immunomodulatory cytokines in the hAEC-CM. (E) The concentration of MIF and IL-2 in conditioned medium was detected by ELISA. (F) Images showed the effect of hAEC-CM on the migration of activated macrophages induced by LPS. (G) The column displayed the proportion of migrated cells in different treatment groups. Scale bar: 50 μm. Data are presented as the mean±SEM. *P<0.05 vs DMEM group; #P<0.05 vs LPS+DMEM or LPS group; $P<0.05 vs LPS+hAEC-CM group.
Based on the previous hAEC-cytokine array results, a large number of immunoregulatory factors, including MIF and IL-2, existed in the hAEC-CM and might play vital roles in the process of immunomodulatory function (Fig.5D). ELISA was used to detect the concentration of MIF and IL-2 in the CM derived from the four separate hAEC samples, and results showed that hAECs could secrete high level of MIF into the conditioned media (Fig.5E). Furthermore, hAEC-CM significantly inhibited the migration of RAW264.7 cells induced by LPS. When MIF protein in conditioned media was neutralized with anti-MIF antibody, the inhibitory effect of hAEC-CM was attenuated (Fig.5F,G). These results indicated that hAECs played important roles in anti-inflammation reaction, mainly depending on the secretion of cytokines.
Discussion
To treat and avoid POF induced by autoimmune diseases, researchers have sought to explore new and effective treatment strategies. For instance, research indicated that co-administration of mZP3 DNA and protein vaccines could be used to treat established AOD [21], and ZP3 peptides administered orally also suppressed murine experimental AOD [18]. Accumulating studies revealed that stem cell transplantation may become one of the most potential approaches in the field of regenerative medicine, particularly in repairing ovarian function. Studies have confirmed that stem cell transplantation could restore ovarian function and re-establish fertility [22-26]. Importantly, successful clinical pregnancy has been achieved in women with POF after transplantation of umbilical cord mesenchymal stem cells on collagen scaffold [27]. Our previous studies demonstrated that hAECs had a good curative effect on ovarian dysfunction in chemotherapy-induced POF mice and partially elucidated the molecular mechanism in the process of ovarian function recovery. Recently, a great number of studies showed that hAECs had immunomodulatory properties in the process of repairing tissue function. In a lung injury model, hAECs repaired lung injury via mediation of macrophage function depending on regulatory T cells [28]. With hAEC administration in a lung disease mice model, fewer pro-inflammatory immune cells were presented to the lungs, and their activity was suppressed [29]. Furthermore, hAECs inhibited the infiltration of inflammatory cells, activated the early recruitment of the M2 macrophage subpopulation, and accelerated blood vessel as well as extracellular matrix remodeling through the secretion of modulatory factors [30].
In the current study, we established an AOD mouse model by pZP3 injection to imitate pathology features, including lymphocyte infiltration and clinically diminished ovarian function. Results showed that hAEC transplantation and hAEC-CM treatment regulated the estrous cycles of mice and restored the levels of serum E2 and FSH in AOD mice. In addition, the number of mature follicles was increased compared to that in the AOD group, and ovarian fibrosis was relieved. It was worth noting that CM from hAECs showed similar repair effect in AOD mice, suggesting that hAEC-secreted cytokines possessed the important biological function. Recent research showed that Treg cells were involved in the pathogenesis of AOD and that sufficient numbers of Treg cells could modify AOD in the early phase of d3tx mice [31]. Recently, human placenta-derived mesenchymal stem cells were found to restore ovarian function in autoimmune-induced POF mice via mediation of Treg cells and secreting cytokines [19]. It was also found that hAECs were unable to abrogate lung injury in surfactant protein C-knockout (Sftpc−/−) mice which have macrophages with impaired phagocytic ability, suggesting that normal macrophage function and responsiveness may be essential to the reparative effects of hAECs [32]. In the previous study, we reported 109 cytokines in the conditioned medium of hAECs, which are involved in the regulation of cell cycle, apoptosis, immune response and angiogenesis. It was found that the enriched TGF-β in the hAEC-CM could regulate GC function, promote follicle development and ovarian vessels reconstruction in the ovaries of chemotherapy-induced POF mice [15]. However, the function of cytokines related to the immune response needs to be studied further. In the current study, we found that hAEC transplantation and hAEC-CM treatment restored ovarian function accompanied by an increased number of Treg cells in the spleen and down-regulation of pro-inflammatory M1 macrophages gene expression in the ovaries of AOD mice.
The further extension of the investigation of stem cells, paracrine function has attracted increasing attention. It has been demonstrated that mesenchymal stem cell CM reduces cartilage damage and suppresses the immune response by enhancing the function of Treg cells and adjusting the Treg:Th17 cell ratio [33]. It has been reported recently that placenta-derived mesenchymal stem cells have an immunomodulatory effect on T cells by regulating Foxp3 expression [34]. Studies demonstrated that hAEC-CM mediated lung repair by directly modulating macrophage recruitment and polarization [35], and hAECs directly regulated brain microglia, probably via releasing trophic factor [36]. The current study demonstrated that hAEC transplantation repaired ovarian function, mainly depending on indirect secretion of cytokines and direct regulation of Treg cells in the spleens of AOD mice. In the in vitro experiment, 1 μg/ml of LPS was found to drastically increase pro-inflammatory genes expression in RAW264.7 macrophage cells. However, hAEC-CM significantly inhibited the inflammatory reaction induced by LPS through up-regulating the expressions of anti-inflammatory genes. In addition, we also found that TGF-β played an important role in the anti-inflammation activity of hAEC-CM. Consistent with the results of the cytokine array, a high concentration of MIF was detected in hAEC-CM. Although MIF has been considered to be associated with an acute inflammatory response and the secretion of cytokines (TNF-α, IL-1β) [37], reports have also suggested that thecal macrophages might be involved in the regulation of follicular growth and ovulation, which is important for the normal estrous cycle [38]. Research also revealed that ovaries treated with anti-MIF antibody had reduced number of growing follicles [39]. In the current study, we found that hAEC-CM affected the migration of activated macrophages induced by LPS via secreting MIF.
Many studies using stem cell transplantation have been carried out to evaluate the ovarian recovery in POF mice induced by chemotherapy. In the autoimmunization-induced AOD mice, we first proved that hAECs had the potential to inhibit inflammatory reaction, regulate Treg cell function in the spleen, and restore ovarian function. Additionally, we partially clarified the possible mechanism of hAEC-secreting TGF-β and MIF in the process of ovarian function recovery. Our results suggested that hAECs could serve as an effective and promising approach to treat ovarian injury induced by AOD. Furthermore, bioactive materials carrying hAEC-secreting bioactive cytokines may have potential to treat POF or other diseases.
Funding
This work was supported by the grants from the National Key Research and Developmental Program of China (Nos. 2018YFC1004800 and 2018YFC1004802), Shanghai Municipal Education Commission-Gaofeng Clinical Medicine Grant Support (No. 20152236), Shanghai Municipal Health Bureau, Shanghai, China (No. 20144Y0048), the National Natural Science Foundation of China (Nos. 81701397 and 81741013), the Opening Fund of Key Laboratory of the diagnosis and treatment research of reproductive disorders of Zhejiang Province (No. 2018001), and Interdisciplinary Program of Shanghai Jiao Tong University (Nos. YG2014QN12 and YG2015ZD11).
