ABSTRACT
Obesity is one of the most common and major health concerns worldwide. Weight management through dietary supplements with natural plant extracts has become the focus of current research. Sweet orange essential oil (SOEO) is a natural plant extract, with many bioactivities. In order to evaluate the weight loss effect of SOEO microcapsules and investigate the underlying mechanism, we fed high-fat diet-induced obese SD rats with SOEO microcapsules for 15 days and found that SOEO microcapsules reduced body weight gain by 41.4%, decreased total cholesterol level, alleviated liver and adipose tissue pathological alteration. The results of fluorescence quantitative PCR revealed that decreasing the expression of peroxisome proliferators-activated receptor-γ, upregulating of uncoupling protein 2, hormone sensitive lipase and carnitine palmitoyltransferase I, inhibiting the expression of acetyl-CoA carboxylase appear to be the mechanism of SOEO microcapsules to lose weight. This study suggests that SOEO microcapsule is a potential dietary supplement for weight loss.
Abbreviations: SOEO: sweet orange essential oil; TC: total cholesterol; TG: triglyceride; LDL-c: low-density lipoprotein cholesterol; HDL-c: high-density lipoprotein cholesterol; PPARα: peroxisome proliferators-activated receptor-α; PPARγ: peroxisome proliferators-activated receptor-γ; UCP2: uncoupling protein 2; HSL: hormone sensitive lipase; CPT1: carnitine palmitoyltransferase I; ACC: acetyl-CoA carboxylase; NPY: neuropeptide Y; LEP: leptin; INS: insulin; ALT: alanine aminotransferase; AST: aspartate aminotransferase.
SOEO microcapsules had anti-obesity effect which suggest that SOEO microcapsules may be used as a diet supplement for weight loss.
Obesity, of which the main cause is the misbalance between energy intake and energy expenditure, is one of the most common and major health concerns worldwide [1,2]. It is forecasted that by 2030, there will be a further 65 million and 11 million obese adults than 2010 in the USA and UK, respectively [3]; on a global scale, cases will rise from 400 million obese adults in 2005 to more than 700 million in 2015, and this trend will continue towards 2030 [4]. Obesity is associated with a cluster of several metabolic disorders, including hypertension, hyperlipidemia, type 2 diabetes, cardiovascular disease and certain cancers, which have resulted in a significant economic burden and a low quality of life [5–7]. Usually, dieting and strenuous exercise are the most commonly used physical weight loss methods, but they require long-term persistence and are prone to rebound [6,8]. Drug therapy can reduce weight by changing the satiety and reducing the absorption of fat in the blood, but it cost highly and has serious side effects [6,9]. At present, diet supplement for weight loss has become a new research direction, and green, safe, natural herbal extract is the most important in this direction.
Citrus essential oil is a natural plant extract, mainly exists in the citrus fruit peel, which belong to the genus Citrus of the family Rutaceae [10]. Citrus essential oil is the most vital by-product of citrus processing and is broadly used as a natural food additive in several food and beverage products because it has been classified as generally recognized as safe [11]. Interestingly, accumulating evidence revealed that citrus essential oil exhibited many bioactivities including anti-oxidant, anti-cancer, anti-microbial and anti-allergy activities, anti-inflammatory, as well as cardiovascular effect, neuroprotective effect, and hepatoprotective effect etc [10,12]. In recent years, citrus essential oil or D-limonene (the main component of citrus essential oil) has been proved to be effective in the treatment of obesity. Jing et al (2013) found that high-fat diet enriched with D-limonene (0.5% w/w) reduced weight gain in female C57BL/6 mice [7]; Asnaashari et al (2010) fed ketotifen-induced obese mice with lime essential oil for 45 days and obtained that groups treated with lime essential oil displayed a reduction in body weight and food consumption [13]. However, the low water solubility and bioavailability of citrus essential oil limit the effect of weight loss, and further researches on the role of citrus essential oil in weight loss have rarely been reported by far.
In our previous study [14], microcapsules were prepared using sweet orange (genus Citrus) essential oil (SOEO) and beta-cyclodextrin (β-CD). SOEO was rich in monoterpenes and the components were analysed using GC-MS with the major component being D-limonene (93.72%, shown in Figure S1 and Table S1 in Supplemental Materials) [14]. We had revealed that the microcapsules increased the solubility and bioavailability of SOEO. The purpose of our study here was to evaluate the weight loss effect of SOEO microcapsules on obese SD rats, to investigate the potential mechanism and provided a novel dietary supplement to reduce body weight.
Materials and methods
Chemicals and reagents
Sweet orange essential oil (SOEO) was obtained from Kang Da Natural Perfume Oil Factory (Jiangxi province, China). β-CD was purchased from Cheng Du Ke Long Chemical Reagent Factory (Sichuan province, China). Rat neuropeptide Y (NPY), leptin (LEP) and insulin (INS) ELISA Kit were purchased from Shanghai Yuduo Biotechnology Co., Ltd. (Shanghai, China). Orlistat capsules were purchased from Zhongshan Wanhan Pharmaceuticals Co., Ltd. (Guangdong privince, China). SOEO microcapsules were prepared using SOEO and β-CD in our previous study, and the content of SOEO in each gram microcapsules was 29 mg.
Experimental animals
SD rats in a specific pathogen free (SPF) grade, weighing 200 ± 10 g (4–6 weeks), were obtained from Chongqing Tengxin Inc. (Chongqing, China) and maintained under standard environmental conditions, with free access to feed and water. The ambient temperature was of 23 ± 2°C with 12 h/12 h light/dark cycles. Experimental rats were housed according to the rules of experimental animal protection and use of Southwest University. The protocol for the experiments was approved by the Animal Ethics Committee of Chongqing Medical University (permit number: SYXK(Yu)2017–0001).
Obesity rats induction and diet intervention
In our study, rats were reared for 1 week to adapt to the environment, and the obese rats were induced by a high-fat diet (80% low-fat diet feed + 10% egg yolk powder + 10% lard). Rats were randomly divided into two groups, treated with low-fat diet and high-fat diet, respectively. The weight of the rats was measured 40 days later. In high-fat diet group, rats with significantly higher body weight than low-fat diet rats (P < 0.05) were defined as obese rats.
The obese rats were randomly divided into five groups: obese rats treated with high-fat diet + 2 mL normal saline (n = 6, HFD group); obese rats treated with high-fat diet + 2 mL suspension of β-CD (n = 6, HFD-β-CD group, containing 600 mg β-CD); obese rats treated with high-fat diet + 19 mg SOEO + 2 mL normal saline (n = 6, HFD-SOEO group, ignore the volume of SOEO); obese rats treated with high-fat diet + 2 mL suspension of SOEO microcapsules (n = 6, HFD-MC group, containing 19 mg SOEO in 630 mg microcapsules); obese rats treated with high-fat diet + 2 mL suspension of orlistat powder (positive drug) (n = 6, HFD-P group, containing 3.75 mg orlistat powder). Orlistat dose was based on the human dose in the instruction. The rats treated with low-fat diet + 2 mL normal saline were the control group (n = 6, HLD group). The experiment lasted for 15 days, weighing the body weight and food intake every two days, calculating the average energy intake in each rat. Body weight gain in MC group was significantly lower than that in HFD group, defined as success in weight loss.
Preparation of rat tissue samples
All rats fasted overnight for 12 h before they were sacrificed. Rats were dizzied by ether vapor. Blood was collected from the neck and placed in blood collection tubes at 4°C for 12 h. Then blood was centrifuged at 4000 rpm for 10 min (TGL-16G Desk centrifuge, Shanghai Anting Science Instrument Factory, Shanghai, China). Upper serum of each tube was collected, and stored at −80°C until analysis. The liver, prerenal and testicular fat was immediately collected, dried, weighed, transferred to liquid nitrogen, and stored at −80°C for further analysis (some fresh tissues were fixed with 5% formalin for histological examination).
Serum biochemical analysis
The serum stored at −80°C was removed and incubated in 37°C water bath until the serum was completely dissolved. TC, TG, high-density lipoprotein cholesterol (HDL-c), LDL-c, alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels in the serum were measured using an Rayto Chemray 240 Automatic biochemical analyzer (Rayto Life and Analytical Sciences Co., Ltd., Shengzhen, China). The contents of NPY, LEP and INS were determined with corresponding kits. The absorbance was measured at 450 nm wavelength using a BioTeK Epoch Microporous plate spectrophotometer (Vermont, America) and the sample concentration was calculated.
Histological examination
Fresh tissue was fixed with stationary solution for more than 24 hours and then dehydrated with gradient alcohol. The waxy tissue was embedded in the embossing machine (Wuhan Junjie Electronic Co., Ltd., Wuhan, China) and embedded in a paraffin slicing machine (Shanghai Leika instrument Co., Ltd.), with a thickness of 4 μm. The sections were stained with hematoxylin and eosin (HE) after dewaxing, and observed under an Nikon Eclipse E100 light microscope (Nikon, Tokyo, Japan) coupled with a Nikon DS-U3 image-forming system (Nikon, Tokyo, Japan).
RNA extraction and quantitative RT-PCR analysis
A hundred mg frozen tissues were homogenized in 1 mL of Trizol Reagent (Servicebio, Wuhan, China) by using TissueLyser KZ-II (Kangtao Technology Co., Ltd., Wuhan, China). Total RNA was extracted in accordance with the manufacturer’s recommendations (Servicebio, Wuhan, China). Extracted RNA was subjected to purity and concentration check using a Nanodrop 2000 spectrophotometer (Thermo Scientific, Delaware, USA). The excessive concentration of RNA was diluted in proper proportion, so that its final concentration was 200 ng/μL. Then, 2 μg of RNA was reverse transcribed to cDNA by using the cDNA synthesis kit (Thermo Scientific, Delaware, USA). The mRNA expression of hormone sensitive lipase (HSL), carnitine palmitoyltransferase I (CPT1), acetyl-CoA carboxylase (ACC), uncoupling protein 2 (UCP2), peroxisome proliferators-activated receptor-α (PPARα) and peroxisome proliferators-activated receptor-γ (PPARγ) were determined by RT-PCR with the ABI StepOnePlus RealTime PCR system (Applied Biosystems, USA). After an initial incubation for 2 min at 50°C, the cDNA was denatured at 95°C for 10 min, followed by 40 cycles of PCR (95°C, 15 s, 60°C, 60 s). The sequences of the primers (Servicebio, Wuhan, China) used were listed in Table 1. The gene mRNA levels were normalized using GAPDH, and the relative expression level of each gene was calculated using the 2−ΔΔCt method.
Sequences of quantitative PCR primers and product size.
| Gene name | Primer sequence | Product size (bp) | |
| Forward primer | Reverse primer | ||
| GAPDH | CTGGAGAAACCTGCCAAGTATG | GGTGGAAGAATGGGAGTTGCT | 138 |
| PPARα | GTGGCTGCTATAATTTGCTGTGG | GCGTCTGACTCGGTCTTCTTGA | 227 |
| PPARγ | TTTCAAGGGTGCCAGTTTCG | GGAGGCCAGCATGGTGTAGAT | 153 |
| UCP2 | TCCCAATGTTGCCCGAAATG | TCGTCTGTCATGAGGTTGGC | 99 |
| ACC | GGAGTAGTTGCTGTAGAAACCCG | CATTAGAGGTAGCCCTTCACGG | 174 |
| HSL | CTTTGAGGGCGATGAGGGAC | CTCTGGGTCTATGGCGAATCG | 238 |
| CPT1 | ATGATCCCTCAGAGCCACAGC | TAGGTCTGCCGACACTTTGCC | 91 |
| Gene name | Primer sequence | Product size (bp) | |
| Forward primer | Reverse primer | ||
| GAPDH | CTGGAGAAACCTGCCAAGTATG | GGTGGAAGAATGGGAGTTGCT | 138 |
| PPARα | GTGGCTGCTATAATTTGCTGTGG | GCGTCTGACTCGGTCTTCTTGA | 227 |
| PPARγ | TTTCAAGGGTGCCAGTTTCG | GGAGGCCAGCATGGTGTAGAT | 153 |
| UCP2 | TCCCAATGTTGCCCGAAATG | TCGTCTGTCATGAGGTTGGC | 99 |
| ACC | GGAGTAGTTGCTGTAGAAACCCG | CATTAGAGGTAGCCCTTCACGG | 174 |
| HSL | CTTTGAGGGCGATGAGGGAC | CTCTGGGTCTATGGCGAATCG | 238 |
| CPT1 | ATGATCCCTCAGAGCCACAGC | TAGGTCTGCCGACACTTTGCC | 91 |
Sequences of quantitative PCR primers and product size.
| Gene name | Primer sequence | Product size (bp) | |
| Forward primer | Reverse primer | ||
| GAPDH | CTGGAGAAACCTGCCAAGTATG | GGTGGAAGAATGGGAGTTGCT | 138 |
| PPARα | GTGGCTGCTATAATTTGCTGTGG | GCGTCTGACTCGGTCTTCTTGA | 227 |
| PPARγ | TTTCAAGGGTGCCAGTTTCG | GGAGGCCAGCATGGTGTAGAT | 153 |
| UCP2 | TCCCAATGTTGCCCGAAATG | TCGTCTGTCATGAGGTTGGC | 99 |
| ACC | GGAGTAGTTGCTGTAGAAACCCG | CATTAGAGGTAGCCCTTCACGG | 174 |
| HSL | CTTTGAGGGCGATGAGGGAC | CTCTGGGTCTATGGCGAATCG | 238 |
| CPT1 | ATGATCCCTCAGAGCCACAGC | TAGGTCTGCCGACACTTTGCC | 91 |
| Gene name | Primer sequence | Product size (bp) | |
| Forward primer | Reverse primer | ||
| GAPDH | CTGGAGAAACCTGCCAAGTATG | GGTGGAAGAATGGGAGTTGCT | 138 |
| PPARα | GTGGCTGCTATAATTTGCTGTGG | GCGTCTGACTCGGTCTTCTTGA | 227 |
| PPARγ | TTTCAAGGGTGCCAGTTTCG | GGAGGCCAGCATGGTGTAGAT | 153 |
| UCP2 | TCCCAATGTTGCCCGAAATG | TCGTCTGTCATGAGGTTGGC | 99 |
| ACC | GGAGTAGTTGCTGTAGAAACCCG | CATTAGAGGTAGCCCTTCACGG | 174 |
| HSL | CTTTGAGGGCGATGAGGGAC | CTCTGGGTCTATGGCGAATCG | 238 |
| CPT1 | ATGATCCCTCAGAGCCACAGC | TAGGTCTGCCGACACTTTGCC | 91 |
Statistical analysis
The results were analyzed statistically using SPSS software (version 20) and data were expressed as means ± standard deviations (S.D.). The LSD multiple range test was used to detect the differences in the means between groups. Differences were considered significant when P < 0.05. Figures were drawn using Origin 8.5.
Results
Effect of SOEO microcapsules on the body weight, food intake, energy intake and relative organ weight
The changes in body weight of experimental rats were shown in Figure 1(a). At the end of the experiment, the body weight gain of rats in HFD-MC group was significantly lower than that of HFD group (P < 0.01). Specifically, SOEO microcapsules reduced the weight gain of obese rats by 41.4%. Similar results was found in HFD-SOEO and HFD-P groups. This indicated that SOEO microcapsules and orlistat could effectively control the body weight gain on a high-fat diet. In Figure 1(b), the curve represented the average food intake in each rat. Overall, the food intake of HFD-P group was the lowest, and the difference was not obvious in other groups. By the end of the experiment, the average total food intake of rats in LFD group was 545.35 g, which was the highest in all group. While HFD-P group was the lowest, with a value of 463.5 g. Besides, the average total food intake in HFD and HFD-MC groups was close to each other, which was 527.83 and 518.99 g, respectively. In contrast to food intake, the energy intake in LFD group was generally lower than that in other groups (shown in Figure 1(c)). The fat rate was shown in Figure 1(d). We could find that there was no significant difference in fat rate between LFD, HFD-MC and HFD-P groups, and they were all significantly lower than HFD group (P < 0.01). This trend was also consistent with the trend of energy intake, which proved that fat rate was related to energy intake. In Figure 1(e), relative liver weight in HFD group was significantly higher than that in LFD group (P < 0.05) and there was no significant difference between HFD and HFD-MC groups. The effect of SOEO microcapsules on the relative liver weight was small. But, we found that the relative liver weight of HFD-P group was significantly lower than HFD group (P < 0.05), close to LFD group.
Body weight gain (a), food intake (b), energy intake (c), fat rate (d) and relative liver weight (e).
Effect of SOEO microcapsules on serum lipid levels and liver function indices
In this part, we studied the effect of SOEO microcapsules on serum lipid and monitored the related indices of liver function (shown in Figure 2). From Figure 2(a,b), we could see that the contents of TG and TC in HFD group were significantly higher than LFD group (16.2% and 52% higher, respectively). After SOEO microcapsules intervention, the content of TC in HFD-MC group was 3.72 ± 0.26 mmol/L, which was significantly decreased by 17.2% compared with HFD group. But there was no statistically significant difference in TG level among HFD, HFD-β-CD, HFD-SOEO and HFD-MC groups. Meanwhile, the contents of TG and TC in HFD-P group treated with orlistat were 0.99 ± 0.01 and 3.27 ± 0.12 mmol/L, respectively, which were significantly lower than that of HFD group. In Figure 2(c), the treatments of SOEO microcapsules and orlistat decreased the content of LDL-c in obese rats (the contents were 1.46 ± 0.13 and 1.40 ± 0.13 mmol/L, respectively) which was closed to LFD group (1.44 ± 0.07 mmol/L). In Figure 2(d), we found that SOEO microcapsules (HFD-MC group) did not increase the content of HDL-c, but orlistat (HFD-P group) did. In addition, Figure 2(e,f) showed the indices of liver function. The content of ALT in HFD group was 53.49 ± 0.48 U/L, which was significantly higher than LFD group (P < 0.01), but in HFD-SOEO, HFD-MC and HFD-P groups, the treatments decreased it significantly compared with HFD group (P < 0.05). It should be noted that, we have a similar conclusion in our study of AST.
Serum lipid levels and liver function indices.
Histological changes of liver and white adipose tissue
Obese individuals are usually accompanied by the accumulation of fat in the liver. In order to study the effect of SOEO microcapsules on liver morphology, HE staining was performed on the liver. Under HE staining, the cell nuclei of the liver were stained blue and the cytoplasm was purplish red. The normal hepatic lobules were perforated by central veins, showing a nearly circular or irregular blank area; the liver cells were arranged around the central vein to form a hepatic cord, and the cell gap formed hepatic sinusoid. As shown in LFD group of Figure 3, the hepatic cord was clear, and the liver sinusoid was long blank area with red blood cells inside. By contrast, we found fatty degeneration of hepatocytes in HFD group. Specifically, what we could observe was that fat in the cytoplasm aggregated into fat bodies, and then fused into fat droplets of varying sizes and globules. In HFD group, fat was dissolved in organic solvents and droplets were vacuolated; some cells had larger lipid droplets, squeezing the nucleus to one side. After the treatments of SOEO microcapsules and orlistat, the morphology of liver tissue in HFD-MC and HFD-P groups was similar to LFD group, and there was hardly any fat vacuoles in the visual field.
Histological changes of liver (dark color) and white adipose tissue (light color) (HE staining, scale bar: 100 μm).
The production of obesity is also closely related to the increase of adipocytes. Through HE staining, we found that the adipocytes in LFD group were small, the number of cells in the visual field was more, and the cells were arranged neatly and compactly. However, adipocytes in HFD group induced by a high-fat diet were significantly larger than LFD group, the size of the cells varied, and the number of cells in the visual field was small. Interestingly, SOEO, SOEO microcapsules and orlistat treatments (HFD-SOEO, HFD-MC and HFD-P groups, respectively) markedly reduced the size of adipocytes, and ameliorated the histological changes.
Effect of SOEO microcapsules on serum hormone levels
In order to study the effect of SOEO microcapsule on hormones, we determined the levels of INS, LEP and NPY in serum at the end of the experiment (shown in Figure 4). As shown in Figure 4(a), the INS content in HFD group was significantly increased by 9.4% over LFD group (P < 0.01). Compared with HFD group, treatments of SOEO microcapsules (HFD-MC group) and orlistat (HFD-P group) could decrease the INS content by 6.9% and 17.8% (P < 0.01), and the INS content in HFD-P group was the lowest. In Figure 4(b), we could obtain that the LEP content in HFD group was significantly higher than LFD group (P < 0.01), and the treatment of β-CD could not decrease the LEP level. We also found that there was no significant difference in LEP content between HFD-SOEO, HFD-MC and HFD-P groups, and the three groups were all significantly lower than HFD group. NPY was also an important hormone for rats to regulate body weight. In Figure 4(c), we could found the NPY content of HFD group was similar to LFD group, and the effects of SOEO and orlistat treatments on NPY content were not significant.
Serum hormone levels.
Effect of SOEO microcapsules on the mRNA expression of PPARs
PPARs are ligand dependent transcriptional regulatory factors, which are very important in regulating cell metabolism. In Figure 5(a), the mRNA expression level of PPARα in HFD group was remarkably upregulated by 25.2% compared with LFD group (P < 0.01). After treatment of SOEO microcapsules, the mRNA expression level of PPARα in HFD-MC group was significantly lower than HFD group (a decrease of 19%, P < 0.05). While the treatment of orlistat in HFD-P group upregulated the mRNA expression of PPARα (P < 0.05). We also found that in Figure 5(a), SOEO alone had no significant effect on the expression of PPARα. Figure 5(b) showed the effects of different treatments on the expression level of PPARγ. Obviously, the mRNA expression level of PPARγ in LFD group was the lowest in all group, and the high-fat diet increased the expression level of PPARγ by almost 6 times. The treatments of SOEO (HFD-SOEO group), SOEO microcapsules (HFD-MC group) and orlistat (HFD-P group) all exhibited remarkable decreases in the mRNA expression level of PPARγ compared with HFD group. The mRNA expression level of PPARγ in HFD-P group was closed to LFD group.
The mRNA expression of PPARα (Figure 5(a)) and PPARγ (Figure 5(b)) in liver and white adipose tissue, respectively.
Effect of SOEO microcapsules on the mRNA expression of PPARs target genes
PPARs regulate carbohydrate and lipid metabolism by regulating the expression of related target genes, including UCP2, HSL, CPT1 and ACC etc. The mRNA expression level of UCP2 was shown in Figure 6(a). We could obtain that the expression level of UCP2 in HFD group was 3.4 times higher than LFD group (P < 0.05) and the treatments of SOEO and SOEO microcapsules upregulated the expression level compared with HFD group (P< 0.05). In Figure 6(b), there was no significant difference in the mRNA expression of HSL between LFD, HFD and HFD-β-CD groups. But the other three groups obviously upregulated the mRNA expression (P < 0.01), and HFD-MC group was the highest. Interestingly, the similar results could also be found in Figure 6(c). High-fat diet did not significantly change the mRNA expression of CPT1 in rats liver, and so did SOEO alone and orlistat. While the treatment of SOEO microcapsules upregulated the expression level ramarkably. ACC, a rate-limiting enzyme in fatty acid synthesis, is also important . In Figure 6(d), the mRNA expression of ACC in groups HFD-SOEO, HFD-MC and HFD-P was significantly inhibited compared with HFD group. The treatment of β-CD not only did not downregulate the mRNA expression, but also upregulated it.
The mRNA expression of PPARs target genes.
Discussion
The imbalance between fat storage and expenditure leads to obesity, which is marked by excessive deposition of fat in adipose tissue [15]. So, changes in body weight and fat rate are important indicators to reflect the degree of obesity in rats [16]. In Figure 1, the rats treated with SOEO microcapsules and orlistat had lower body weight gain and fat rate than HFD group, which indicated that both SOEO microcapsules and orlistat could effectively control the weight of obese rats. Shen J (2005) studied the effect of grapefruit oil (primary component limonene) on rats body weight, and found that the scent of grapefruit oil could affect autonomic nerves of rats and reduce body weight [17]. Although the effect of citrus essential oil on weight loss had been confirmed in previous study [13], it had been found in this experiment that SOEO microcapsules had better weight loss than SOEO alone. It should be noted that there was little difference in the food intake of experimental groups except HFD-P group treated with orlistat. It is reported that orlistat is a specific gastrointestinal lipase inhibitor that effectively inhibits the absorption of fat and lose weight [18]. The results also indicated that the weight loss mechanism of SOEO microcapsules was different from that of orlistat.
Elevated serum lipid levels are the intrinsic manifestation of obesity in rats. In this study, we found that both SOEO microcapsules and orlistat significantly reduced TC in obese rats. But the effect of SOEO microcapsules on TG was not obvious. Jing Li (2013) found that 0.5% D-limonene (for 4 weeks) lowered serum TG in high-fat diet-fed C57BL/6 mice [7]. Similarly, Mehmet Ciftci (2018) reported that the essential oil mixture (containing 25% orange peel essential oil) supplementation considerably decreased serum TC and TG compared to the control group in low ambient temperature [19]. The different results here may be attributed to the low content of sweet orange essential oil. LDL-c, which is associated with a variety of cardiovascular diseases, is called “bad cholesterol”; HDL-c, which can be transformed into bile acid to excrete from the body and which has the effect of anti-atherosclerosis, is called “good cholesterol” [20,21]. In our study, SOEO microcapsules could obviously decrease the content of LDL-c, but it could not increase the content of HDL-c effectively. The reason of the result was unclear. AST and ALT are the relatively liver-specific enzymes; elevation of AST and ALT activities in serum is the result of leakage from damaged cells and therefore reflects hepatocyte damage [22]. In Figure 2(e,f), we obtained that SOEO alone, SOEO microcapsules and orlistat could significantly decreased the contents of ALT and AST compared with HFD group. This was consistent with Victor, who (2011) also found the activities of the hepatic marker enzymes (AST and ALT) were significantly decreased on supplementation with dietary D-limonene (the main component of SOEO) as compared to untreated rats [23]. In summary, the citrus essential oil does not have toxic effects particularly in reference to liver function test [24], orlistat neither.
Tissue section is a more intuitive indicator of the degree of obesity. In Figure 3, SOEO, SOEO microcapsules and orlistat treatments markedly ameliorated the histological changes of liver and fat, especially SOEO microcapsules and orlistat. This was consistent with the changes in body weight and fat rate. Not only that, Victor (2011) found that dietary supplementation with D-limonene (2%) for 4 weeks reversed the HFD-induced changes and restored pathological alteration of liver [23]; Jing Li (2013) reported that the treatment with 0.5% D-limonene for 4 weeks decreased the size of white adipocytes in high-fat diet-fed C57BL/6 mice [7]. These previous studies proved the effect of D-limonene (the main component in citrus essential oil) on ameliorating histopathological alteration. In this study, we confirmed that SOEO microcapsules was more effective than SOEO alone.
Insulin (INS) and leptin (LEP) are important hormones regulating substance metabolism and controlling energy balance, and the imbalance of energy metabolism in the body caused by high-fat diet is considered to be the main factor leading to obesity [25,26]. It is well established that INS is lipolytic inhibitor acting via insulin receptors [12], and LEP can inhibit adipose tissue synthesis by acting on hypothalamic metabolic regulatory center, inhibiting appetite and reducing energy intake. However, in obese individuals, due to the resistance to insulin and leptin, the corresponding tissue regions could not accept hormone regulatory signals, which led to the increase of insulin and leptin levels in the serum [27,28]. In Figure 4, we found SOEO microcapsules and orlistat could significantly inhibit the increase of INS and LEP induced by high-fat diet, which suggested that SOEO microcapsules and orlistat might affect energy metabolism and balance by acting on the AMP-activated protein kinase pathway.
Nuclear receptor transcription factors – PPARα and PPARγ, have become the focus of attention in the study of the treatment of metabolic syndromes. PPARα belongs to the steroid hormone receptor superfamily, mainly expressed in liver and plays an important role in inducing the oxidation of fatty acids in liver [29,30]. PPARγ is a ligand-activated transcriptional factor (mediating gene expression) predominately expressed in adipose tissue that stimulates adipose differentiation and is very important in lipogenesis and lipid synthesis [31–33]. The upregulated expression of PPARα in obese rats (HFD group in Figure 5(a)) indicated that the fat content in the liver was high, which was consistent with the results of liver tissue sections. Interestingly, the treatment of SOEO microcapsules made the expression of PPARα downregulated. This might be due to the fact that SOEO microcapsules improved the steatosis of the liver and reduced the amount of fat in the liver. Orlistat made PPARα express higher than HFD group, which might be the mechanism of the drug’s ability to lose weight. In Figure 5(b), SOEO alone, SOEO microcapsules and orlistat all significantly reduced the expression of PPARγ, which indicated that SOEO microcapsules (SOEO) and orlistat inhibited the differentiation of preadipocytes into adipocytes.
To further investigate the role of specific genes in microcapsules losing weight, we measured the relative expression level of the genes, including UCP2, HSL, CPT1 and ACC. In Figure 6(a), SOEO and SOEO microcapsules upregulated the expression of UCP2 significantly. It is well known that UCP2 can uncouple the oxidation process of respiratory chain with phosphorylation process [34], and the results showed that SOEO microcapsules and SOEO promoted upregulation of UCP2 expression, limiting the synthesis of ATP, and leading to energy consumption in the form of heat [35]. Moreover, the treatment of SOEO microcapsules upregulated the expression of HSL and CPT1. It is now accepted that HSL is rate-limiting for lipid mobilization in the catabolism of triglyceride [31,36]; CPT-1 is a rate-limiting enzyme for fatty acyl-CoA transported into the mitochondria for β-oxidation [6]. This finding revealed the underlying mechanism for SOEO microcapsules to lose weight – promoting β-oxidation of triglyceride. This conclusion has been confirmed in some literatures [37,38]. In addition, ACC is a rate-limiting enzyme in fatty acid synthesis. From Figure 6(d), we found SOEO alone, SOEO microcapsules and orlistat could all inhibit the expression of ACC. This might also be another mechanism of weight loss for the above treatments.
In conclusion, we provided evidence that SOEO microcapsules reduced body weight gain and fat rate, decreased TC and LDL-c levels in serum. Besides, SOEO microcapsules could alleviate liver and adipose tissue pathological alteration, reduce insulin level. These results appear to be mediated through decreasing the expression of PPARγ, upregulating of UCP2, HSL and CPT1, inhibiting the expression of ACC. Our findings suggest that SOEO microcapsules may be used as a diet supplement for weight loss.
Author contribution
D. H. L, H. T. D. and H. J. W. designed research; D. H. L. conducted the research and wrote the manuscript; and H. T. D., H. J. W. edited the manuscript. All authors read and approved the final manuscript.
Acknowledgments
We acknowledge the staff of Citrus Research Institute for their help and support.
Disclosure statement
No potential conflict of interest was reported by the authors.
Supplementary material
Supplemental data for this article can be accessed here
