Abstract
Divergent adaptation to different ecological conditions is regarded as important for speciation. For phytophagous insects, there is limited empirical evidence on species differentiation driven by climate and host plant. The recent application of molecular data and integrative taxonomic practice may improve our understanding of population divergence and speciation. Periphyllus koelreuteriae aphids feed exclusively on Koelreuteria (Sapindaceae) in temperate and subtropical regions of eastern Asia, and show morphological and phenological variations in different regions. In this study, phylogenetic and haplotype network analyses based on four genes revealed that P. koelreuteriae populations comprised three distinct genetic clades corresponding to climate and host plants, with the populations from subtropical highland regions and on Koelreuteria bipinnata host plants representing the most basal clade. These genetic lineages also showed distinct characteristics in terms of morphology and life cycle. The results indicate that P. koelreuteriae is a species complex with previously unrevealed lineages, whose differentiation may have been driven by climatic difference and host plant.
INTRODUCTION
It has long been recognized that environmental adaptation plays a very important role in speciation (Darwin, 1859). In recent decades, there has been considerable progress in empirical research on ecological speciation (Schluter, 2001, 2009; McKinnon et al., 2004; Loxdale et al., 2020). Climatic conditions in ecological adaptation have been studied extensively, and can affect the life cycle and geographical distribution of populations and cause reproductive isolation (Sutherst & Yonow, 1998; Lange et al., 2006; Sosa-Pivatto et al., 2020). The habitat fragmentation caused by climate (Hewitt, 1996, 1999) and the gradual adaptation of species to the changed climatic environment (Qvarnström et al., 2016) have profound impact on species divergence and global biodiversity patterns. Adaptation to different climatic environments usually depends on species’ physiological and genetic changes (Kearney & Porter, 2009), although sometimes there may be no obvious change in morphological characters (Doolittle & Sapienza, 1980). This may lead to an underestimation of the importance of climatic factors in species divergence.
Morphological characters are important for the identification of species in traditional taxonomy. The phenomenon that genetic material and physiology have changed while the phenotype remains relatively stable may cause confusion for morphological identification, and therefore underestimate existing biodiversity (Renner et al., 2017). In addition, in many studies, the number and geographical coverage of samples used to observe morphological characters are small (Winston, 1999; Eastop & Blackman, 2005), resulting in many representative samples not being included in taxonomic studies and decreasing the probability of discovering new species. Fortunately, advances in sequencing technology and new research tools such as DNA barcoding (Hebert et al., 2003b; Foottit et al., 2008; Li et al., 2020; Pfeiler et al., 2020) have contributed to understanding the evolutionary history of species at the population level.
The aphid group Chaitophorinae (Hemiptera, Aphididae), which originated in temperate regions of the Northern Hemisphere, consists of more than 170 species, most of which are distributed in the Palaearctic and Nearctic regions (Wieczorek et al., 2017). The host plants of Chaitophorinae are mainly from the Poaceae and Salicaceae (Blackman & Eastop, 2020), including many plant species of economic importance (Holman, 2009; Blackman & Eastop, 2020). The Chaitophorinae genus Periphyllus has a complex seasonal polymorphism (Essig & Abernathy, 1952; Junkiert et al., 2011; Blackman & Eastop, 2020). Most species of Periphyllus (about 41) feed on Acer and Aesculus (Sapindaceae, Aceroideae); Periphyllus koelreuteriae (Takahashi, 1919) is the only member of the genus that feeds exclusively on Koelreuteria (Sapindaceae, Sapindoideae) (Takahashi, 1919a, b; Blackman & Eastop, 2020). Unlike most Chaitophorinae species that are restricted to temperate regions, P. koelreuteriae is mainly distributed from the northern temperate to southern subtropical regions of East Asia, especially China, and has a holocyclic lifestyle (Wang et al., 1991; Liu et al., 1999b; Junkiert & Wieczorek, 2019). Moreover, the distribution of P. koelreuteriae closely matches the distribution range of its Koelreuteria host plants (Xia & Luo, 1995; Wang et al., 2013). The timing of different part of the life cycle of P. koelreuteriae varies greatly in different climate regions. For example, the sexual generation of P. koelreuteriae in temperate regions usually occurs from October to November (Wang et al., 1991; Junkiert & Wieczorek, 2019), while the sexual generation in subtropical regions appears in December to early February (Liu et al., 1999b). Aestivating forms of P. koelreuteriae in Shandong province, northern China, occur in early May (Wang et al., 1991), whereas aestivating forms in southern China are found in mid-March (Liu et al., 1999b). As phenological adaptation to different environment conditions may be a powerful driver of speciation (Taylor & Friesen, 2017; Powell et al., 2020), it is of interest to test whether genetic differentiation and possible speciation within P. koelreuteriae have occurred in different climate regions.
The morphological characters of viviparous individuals in spring and autumn differ significantly, and aestivating morphs with a particular phenotype appear in summer, hampering morphological identification of Periphyllus (Essig & Abernathy, 1952; Junkiert et al., 2011). The morphological characters of P. koelreuteriae have been discussed in previous studies (Wang et al., 1991; Liu et al., 1999a, b; Lin et al., 2001; Blackman & Eastop, 2020), but reaching a consensus regarding the morphological description of P. koelreuteriae is problematic due to sampling differences. Body shape and colour, the structure of spots on the abdominal tergites, and host plant information are the main characters used for identification of P. koelreuteriae in the field. Periphyllus koelreuteriae populations in Shandong province have a yellow-green body colour, a thorax spot and paired dorsal spots on abdominal tergites (Wang et al., 1990, 1991), whereas P. koelreuteriae in south-eastern China have a brown body colour, a longitudinal dark brown spot across the head and thorax, and paired spots on the dorsal abdomen (Liu et al., 1999b). Differences also exist in the description of mounted specimens of P. koelreuteriae due to varied sampling. In the key to P. koelreuteriae given by Zhang & Zhong (1983), 26 and 13–17 setae on antennal segment III and cauda were mentioned, respectively. However, the specimens of P. koelreuteriae described by Junkiert & Wieczorek (2019) collected from Tianjin (China) had only 16–17 and eight setae on antennal segment III and cauda, respectively. Although these observation might represent apterous viviparous sampled from different seasons, this indicates common morphological plasticity in this species. During many field collections across China, we have noted that the body coloration and other traits of P. koelreuteriae vary in different climatic regions. Although obvious morphological variations exist in different populations of P. koelreuteriae, there has been no study to test whether genetic differentiation underlies these morphological variations.
In a previous study on DNA barcoding of aphids in subtropical regions, we found that P. koelreuteriae samples from mountains in south-western China and from south-eastern China exhibited obvious genetic divergence, with a maximum 6.6% genetic distance of the cytochrome c subunit I (COI) gene (Li et al., 2020). Moreover, P. koelreuteriae populations from these regions also differed in morphology and life cycle. In the present study, we aimed to: (1) test whether population divergence of P. koelreuteriae has occurred across its distribution range and in different climate regions; (2) investigate whether population genetic differentiation corresponds to morphological and phenological variations; and (3) verify whether P. koelreuteriae in fact represent a species complex with previously unrevealed lineages. We utilized field samples across the distribution range of P. koelreuteriae from temperate to subtropical regions, together with several molecular markers, including the mitochondrial genes COI and Cytb (cytochrome b), nuclear gene EF-1α (elongation factor-1α), and the gnd gene (gluconate-6-phosphate dehydrogenase) of the primary aphid endosymbiont Buchnera.
MATERIAL AND METHODS
Aphid sampling and field observation
Samples of P. koelreuteriae were collected from different regions in mainland China representative of temperate climate (Beijing and Tianjin), subtropical humid climate (Fujian and Jiangxi) and subtropical highland climate (Yunnan). The three regions had different climate parameters: temperate, annual ≥10 °C accumulated temperature between 3200 and 4500 °C, annual precipitation <750 mm; subtropical humid, annual ≥10 °C accumulated temperature between 4500 and 6000 °C, annual precipitation >750 mm, average altitude <1000 m; subtropical highland, annual ≥10 °C accumulated temperature between 4000 and 5000 °C, average altitude >2000 m, annual precipitation about 1000 mm.
During fieldwork, representative morphological characters of live individuals were recorded, and photographs of aphids and host plants were taken with a digital camera (Canon EOS 7D plus Canon EF 100 mm f/2.8L Macro IS USM Lens). Periphyllus koelreuteriae samples were straighforward to identify in the field based on basic morphology. We also verified the identification with DNA barcoding. To reconstruct the phylogeny of P. koelreuteriae populations, samples of three other Chaitophorinae species (Periphyllus californiensis, Chaitophorus saliniger, Chaitophorus populeti) were used as outgroups. All specimens were placed into 95% ethanol and stored at −20 °C for subsequent molecular experiments. All voucher specimens were placed in the Insect Systematics and Diversity Lab at Fujian Agriculture and Forestry University. All the samples used in this study were apterous viviparous females. Detailed sample information is provided in Supporting Information Table S1.
DNA extraction, amplification and sequencing
Whole genomic DNA was extracted from single specimen of aphids using the DNeasy Blood &Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. Primer information for each gene is provided in Table 1. The polymerase chain reaction (PCR) was performed using a 30-µL reaction volume with the mixture of 3 µL template DNA, 0.6 µL forward and reverse primer (10 μm), 0.4 µL Taq DNA polymerase (5 U/μL), 20 µL double distilled H2O, 3 µL 10× buffer and 2.4 µL dNTP. An initial denaturation step of 5 min at 95 °C and final extension step of 10 min at 72 °C were included in all reactions. The thermal cycling programme for COI was: 35 denaturation cycles of 20 s at 94 °C, annealing at 50 °C for 30 s and extension for 2 min at 72 °C. The cycling conditions for Cytb included 35 cycles of denaturation at 92 °C for 1 min, annealing at 48 °C for 1.5 min and extension at 72 °C for 1 min. The 35 cycles for EF-1α was: 95 °C for 30 s, 51 °C for 1 min, and 72 °C for 1 min. The cycling conditions for gnd were: 35 cycles at 95 °C for 20 s, annealing at 53 °C for 30 s and extension at 72 °C for 2 min. The PCR products were verified by electrophoresis on a 1% agarose gel and bidirectionally sequenced by Sangon Biotech (Shanghai, China). All sequences obtained by sequencing were submitted to GenBank (Supporting Information, Table S1).
Primers used in this study.
| Primer | Primer sequence (5′–3′) | Reference |
|---|---|---|
| COI LepF | ATTCAACCAATCATAAAGATATTGG | Foottit et al. (2008) |
| COI LepR | TAAACTTCTGGATGTCCAAAAAATCA | Foottit et al. (2008) |
| Cytb CP1 | GATGATGAAATTTTGGATC | Harry et al. (1998) |
| Cytb CP2 | CTAATGCAATAACTCCTCC | Harry et al. (1998) |
| EF-1α EF3 | GAACGTGAACGTGGTATCAC | von Dohlen et al. (2002) |
| EF-1α EF2 | ATGTGAGCAGTGTGGCAATCCAA | von Dohlen et al. (2002) |
| gnd-BamHI | CGCGGATCCGGWCCWWSWATWATGCCWGGWGG | Clark et al. (1999) |
| gnd-ApaI | CGCGGGCCCGTATGWGCWCCAAAATAATCWCKTTG | Clark et al. (1999) |
| Primer | Primer sequence (5′–3′) | Reference |
|---|---|---|
| COI LepF | ATTCAACCAATCATAAAGATATTGG | Foottit et al. (2008) |
| COI LepR | TAAACTTCTGGATGTCCAAAAAATCA | Foottit et al. (2008) |
| Cytb CP1 | GATGATGAAATTTTGGATC | Harry et al. (1998) |
| Cytb CP2 | CTAATGCAATAACTCCTCC | Harry et al. (1998) |
| EF-1α EF3 | GAACGTGAACGTGGTATCAC | von Dohlen et al. (2002) |
| EF-1α EF2 | ATGTGAGCAGTGTGGCAATCCAA | von Dohlen et al. (2002) |
| gnd-BamHI | CGCGGATCCGGWCCWWSWATWATGCCWGGWGG | Clark et al. (1999) |
| gnd-ApaI | CGCGGGCCCGTATGWGCWCCAAAATAATCWCKTTG | Clark et al. (1999) |
Primers used in this study.
| Primer | Primer sequence (5′–3′) | Reference |
|---|---|---|
| COI LepF | ATTCAACCAATCATAAAGATATTGG | Foottit et al. (2008) |
| COI LepR | TAAACTTCTGGATGTCCAAAAAATCA | Foottit et al. (2008) |
| Cytb CP1 | GATGATGAAATTTTGGATC | Harry et al. (1998) |
| Cytb CP2 | CTAATGCAATAACTCCTCC | Harry et al. (1998) |
| EF-1α EF3 | GAACGTGAACGTGGTATCAC | von Dohlen et al. (2002) |
| EF-1α EF2 | ATGTGAGCAGTGTGGCAATCCAA | von Dohlen et al. (2002) |
| gnd-BamHI | CGCGGATCCGGWCCWWSWATWATGCCWGGWGG | Clark et al. (1999) |
| gnd-ApaI | CGCGGGCCCGTATGWGCWCCAAAATAATCWCKTTG | Clark et al. (1999) |
| Primer | Primer sequence (5′–3′) | Reference |
|---|---|---|
| COI LepF | ATTCAACCAATCATAAAGATATTGG | Foottit et al. (2008) |
| COI LepR | TAAACTTCTGGATGTCCAAAAAATCA | Foottit et al. (2008) |
| Cytb CP1 | GATGATGAAATTTTGGATC | Harry et al. (1998) |
| Cytb CP2 | CTAATGCAATAACTCCTCC | Harry et al. (1998) |
| EF-1α EF3 | GAACGTGAACGTGGTATCAC | von Dohlen et al. (2002) |
| EF-1α EF2 | ATGTGAGCAGTGTGGCAATCCAA | von Dohlen et al. (2002) |
| gnd-BamHI | CGCGGATCCGGWCCWWSWATWATGCCWGGWGG | Clark et al. (1999) |
| gnd-ApaI | CGCGGGCCCGTATGWGCWCCAAAATAATCWCKTTG | Clark et al. (1999) |
Data analyses
Sequences of four genes, COI, Cytb, EF-1α and gnd, were amplified for all samples. In addition, some sequences of P. koelreuteriae were also downloaded from GenBank (Supporting Information, Table S1) and combined with those obtained in this study for phylogenetic analysis. Based on the chromatograms, the raw forward and reverse DNA sequences were edited via BioEdit (Hall, 1999), and the consensus sequences were then subjected to multiple sequence alignment algorithms using MAFFT (Kazutaka & Standley, 2013). For the EF-1α sequences, all introns were removed according to the GT–AG rule and based on the coding region of Schizaphis graminum (GenBank accession number AF068479). Genetic distances based on the Kimura two-parameter (K2P) model were calculated in the MEGA software (Kumar et al., 2016). jModelTest (Darriba et al., 2012) based on the Akaike information criterion (AIC) was used to estimate the optimal nucleotide substitution models before maximum likelihood (ML) and Bayesian inference (BI) phylogenetic analyses. The models were: HKY+G for COI, GTR+R+G for Cytb, K80+I for EF-1α and HKY+I+G for gnd. Based on the K2P model and 1000 bootstrap replications, the aligned sequences were used to calculate the neighbour joining (NJ) tree in MEGA 7.0. RAxML (Stamatakis, 2014) was used to build the ML trees based on random starting trees with the GTRGAMMA substitution model and 1000 non-parametric bootstrap replicates. The BI trees were estimated by MrBayes 3.2.6 (Ronquist et al., 2012); one cold and three heated MCMC (Markov chain Monte Carlo) chains were run for 20 00 000 generations with trees being sampled every 100 generations. The first 25% of trees were discarded as burn-in and the remaining trees were used to construct Bayesian consensus trees. The phylogenetic trees were displayed and edited in iTOL (Letunic & Bork, 2016). To explore the population genetic structure, the sequences of P. koelreuteriae were used to analyse DNA polymorphism and generate a haplotype file in DnaSP 5.0 (Librado & Rozas, 2009), and then median-joining networks were constructed using Network 5 (Bandelt et al., 1999).
Morphometry and statistical analysis
Sixteen generally used morphological characters were measured and compared for a total of 27 P. koelreuteriae specimens from different climate regions (temperate, N = 10; subtropical humid, N = 10; subtropical highland, N = 7). The names and abbreviations of the morphological characters are provided in Supporting Information Table S2. All morphological measurements were undertaken using a research microscope (Nikon, Tokyo, Japan). The averages as well as the minimum and maximum values of each morphological character were calculated and recorded. A one-way ANOVA was performed to determine whether significant morphological differences exist among P. koelreuteriae samples in different climate regions. In addition, post-hoc multiple comparisons were performed based on least significant differences tests to detect pairwise differences of each morphological character between climate regions in SPSS v.24 (IBM, Chicago, IL, USA). To determine which characters contribute most to population differentiation, based on the characters showing significant variation (P < 0.05) in ANOVA, we performed principal component analysis (PCA) using R software v.4.0.2 (R Development Core Team, 2018).
RESULTS
Sequence characteristics and genetic distance
A total of 39 COI, 35 Cytb, 24 EF-1α and 35 gnd sequences were included in the final dataset (Supporting Information, Table S1). The COI alignment (560 bp; 38.5% T, 18.2% C, 34.3% A, 9.1% G) included 509 conserved sites, 51 variable sites and 48 parsimony-informative sites. The Cytb alignment (744 bp; T: 42.4%, C: 14%, A: 34%, G: 9.5%) included 699 conserved sites, 45 variable sites and 44 parsimony-informative sites. The gnd alignment (38.1% T, 9.6% C, 41.3% A, 11% G) included 655 conserved sites, 178 variable sites and 43 parsimony-informative sites. After introns were removed, the exons of EF-1α sequences were aligned to a final length of 765 bp (26.1% T, 21.4% C, 27.2% A, 25.3% G), which included 750 conserved sites, 15 variable sites and 12 parsimony-informative sites.
The genetic distance of samples between different climatic regions was much larger than for samples within the same region (Table 2). For example, COI genetic distances were 0–1.4% in temperate regions, 0–0.2% in subtropical humid regions and zero in subtropical highland regions, while the maximum COI genetic distance among all samples was 7.6%. Maximum genetic distances were between samples from the temperate and subtropical highland regions (Supporting Information, Table S5). The other three genes (Cytb, EF-1α and gnd) also exhibited similar patterns of genetic distances (Table 2).
The genetic distances of Periphyllus koelreuteriae in different climate regions
| Gene | Climatic characteristics | No. of samples | Sequence length (bp) | Genetic distance (K2P) | |
|---|---|---|---|---|---|
| Range (%) | Mean (%) | ||||
| COI (A) | Temperate climate | 21 | 560 | 0–1.4 | 0.3 |
| Subtropical humid climate | 15 | 560 | 0–0.2 | 0.0 | |
| Subtropical highland climate | 3 | 560 | 0.0 | 0.0 | |
| Total | 39 | 560 | 0–7.6 | 2.6 | |
| Cytb (B) | Temperate climate | 18 | 744 | 0–0.9 | 0.3 |
| Subtropical humid climate | 15 | 744 | 0–0.1 | 0.1 | |
| Subtropical highland climate | 2 | 744 | 0.1 | 0.1 | |
| Total | 35 | 744 | 0–4.8 | 2.0 | |
| EF (C) | Temperate climate | 7 | 765 | 0–0.8 | 0.3 |
| Subtropical humid climate | 14 | 765 | 0.0 | 0.0 | |
| Subtropical highland climate | 3 | 765 | 0.0 | 0.0 | |
| Total | 24 | 765 | 0–1.3 | 0.6 | |
| gnd (D) | Temperate climate | 17 | 833 | 0.0 | 0.0 |
| Subtropical humid climate | 15 | 833 | 0.0 | 0.0 | |
| Subtropical highland climate | 3 | 833 | 0.0 | 0.0 | |
| Total | 35 | 833 | 0–3.2 | 1.2 | |
| Gene | Climatic characteristics | No. of samples | Sequence length (bp) | Genetic distance (K2P) | |
|---|---|---|---|---|---|
| Range (%) | Mean (%) | ||||
| COI (A) | Temperate climate | 21 | 560 | 0–1.4 | 0.3 |
| Subtropical humid climate | 15 | 560 | 0–0.2 | 0.0 | |
| Subtropical highland climate | 3 | 560 | 0.0 | 0.0 | |
| Total | 39 | 560 | 0–7.6 | 2.6 | |
| Cytb (B) | Temperate climate | 18 | 744 | 0–0.9 | 0.3 |
| Subtropical humid climate | 15 | 744 | 0–0.1 | 0.1 | |
| Subtropical highland climate | 2 | 744 | 0.1 | 0.1 | |
| Total | 35 | 744 | 0–4.8 | 2.0 | |
| EF (C) | Temperate climate | 7 | 765 | 0–0.8 | 0.3 |
| Subtropical humid climate | 14 | 765 | 0.0 | 0.0 | |
| Subtropical highland climate | 3 | 765 | 0.0 | 0.0 | |
| Total | 24 | 765 | 0–1.3 | 0.6 | |
| gnd (D) | Temperate climate | 17 | 833 | 0.0 | 0.0 |
| Subtropical humid climate | 15 | 833 | 0.0 | 0.0 | |
| Subtropical highland climate | 3 | 833 | 0.0 | 0.0 | |
| Total | 35 | 833 | 0–3.2 | 1.2 | |
A, B, C and D and climatic characteristics correspond to those in Figure 1.
The genetic distances of Periphyllus koelreuteriae in different climate regions
| Gene | Climatic characteristics | No. of samples | Sequence length (bp) | Genetic distance (K2P) | |
|---|---|---|---|---|---|
| Range (%) | Mean (%) | ||||
| COI (A) | Temperate climate | 21 | 560 | 0–1.4 | 0.3 |
| Subtropical humid climate | 15 | 560 | 0–0.2 | 0.0 | |
| Subtropical highland climate | 3 | 560 | 0.0 | 0.0 | |
| Total | 39 | 560 | 0–7.6 | 2.6 | |
| Cytb (B) | Temperate climate | 18 | 744 | 0–0.9 | 0.3 |
| Subtropical humid climate | 15 | 744 | 0–0.1 | 0.1 | |
| Subtropical highland climate | 2 | 744 | 0.1 | 0.1 | |
| Total | 35 | 744 | 0–4.8 | 2.0 | |
| EF (C) | Temperate climate | 7 | 765 | 0–0.8 | 0.3 |
| Subtropical humid climate | 14 | 765 | 0.0 | 0.0 | |
| Subtropical highland climate | 3 | 765 | 0.0 | 0.0 | |
| Total | 24 | 765 | 0–1.3 | 0.6 | |
| gnd (D) | Temperate climate | 17 | 833 | 0.0 | 0.0 |
| Subtropical humid climate | 15 | 833 | 0.0 | 0.0 | |
| Subtropical highland climate | 3 | 833 | 0.0 | 0.0 | |
| Total | 35 | 833 | 0–3.2 | 1.2 | |
| Gene | Climatic characteristics | No. of samples | Sequence length (bp) | Genetic distance (K2P) | |
|---|---|---|---|---|---|
| Range (%) | Mean (%) | ||||
| COI (A) | Temperate climate | 21 | 560 | 0–1.4 | 0.3 |
| Subtropical humid climate | 15 | 560 | 0–0.2 | 0.0 | |
| Subtropical highland climate | 3 | 560 | 0.0 | 0.0 | |
| Total | 39 | 560 | 0–7.6 | 2.6 | |
| Cytb (B) | Temperate climate | 18 | 744 | 0–0.9 | 0.3 |
| Subtropical humid climate | 15 | 744 | 0–0.1 | 0.1 | |
| Subtropical highland climate | 2 | 744 | 0.1 | 0.1 | |
| Total | 35 | 744 | 0–4.8 | 2.0 | |
| EF (C) | Temperate climate | 7 | 765 | 0–0.8 | 0.3 |
| Subtropical humid climate | 14 | 765 | 0.0 | 0.0 | |
| Subtropical highland climate | 3 | 765 | 0.0 | 0.0 | |
| Total | 24 | 765 | 0–1.3 | 0.6 | |
| gnd (D) | Temperate climate | 17 | 833 | 0.0 | 0.0 |
| Subtropical humid climate | 15 | 833 | 0.0 | 0.0 | |
| Subtropical highland climate | 3 | 833 | 0.0 | 0.0 | |
| Total | 35 | 833 | 0–3.2 | 1.2 | |
A, B, C and D and climatic characteristics correspond to those in Figure 1.
Phylogeny and haplotype network
Whether using a single gene or a combination of multiple genes, the obtained phylogenetic trees of P. koelreuteriae diverged into three distinct clades (Figure 1). Based on the COI tree with the largest number of sequences, the three supported clades corresponded to samples from the temperate climate (blue: Beijing, Tianjin and Korea), subtropical humid climate (red: Fujian and Jiangxi) and subtropical highland climate (green: Yunnan). The samples from Yunnan were at the most basal point of the tree. Genetic distances within clades were much smaller than those between clades (Table 2; Supporting Information, Table S5).
The Bayesian phylogenetic trees of Periphyllus koelreuteriae based on COI (A), Cytb (B), EF-1α (C), gnd (D) sequences, and the combined data of all four genes (E). Different colour branches represent samples from different climatic regions (blue: temperate climate, red: subtropical humid climate, green: subtropical highland climate). Numbers around main nodes are bootstrap values (>60) of maximum-likelihood analysis and posterior probabilities (>0.90) of Bayesian analysis. Field photographs and main characteristics of P. koelreuteriae populations are shown on the right of the COI tree corresponding to regions of temperate climate (Clade 1), subtropical humid climate (Clade 2) and subtropical highland climate (Clade 3).
As shown in Figure 2, P. koelreuteriae showed a complex haplotype diversity, and the haplotype networks of different genes were clearly divided into three parts. Based on the COI haplotype network, all samples from Yunnan representing the subtropical highland climate were assigned as haplotype H_6, which had the most significant genetic difference with samples from other climate regions. Samples from the temperate climate region clustered together and had the highest haplotype diversity, including H_1, H_2, H_5, H_7, H_8 and H_9, while less genetic variation was found among samples from Fujian and Jiangxi (H_3 and H_4) representing the subtropical humid climate.
Haplotype network of Periphyllus koelreuteriae populations based on COI (A), Cytb (B), EF-1α (C), gnd (D) sequences and the combined data of all four genes (E). The circles represent different haplotypes, and the short line segments indicate mutated positions between haplotypes. The colours and sizes of the circles represent geographical regions and the relative numbers of sequences. Mv represents median vectors. The different colours of shading on the haplotype network represent samples from different climatic regions (light green: temperate climate, light red: subtropical humid climate, light purple: subtropical highland climate).
Phylogenetic pattern of morphological characters
The morphometric analyses indicated a wide range of morphological variation among the measured samples (Supporting Information, Tables S2–S4). While showing plasticity of morphological characters, our measurements showed distinct differences among samples from different climate regions (Figure 3), consistent with the phylogenetic pattern in Figure 1. The PCA biplot showed that about 65% of the variance was explained by the first two components (PC1: 37.6%; PC2: 27.1 %). The characters BL, Cauda_BW, Ant2, Cauda_L and Cauda_NS contributed to the separation of samples from the subtropical humid climate from samples in temperate and subtropical highland climate (PC2) regions, while the characters Ant3, BW, Ant_L, Ant_4 and Ant3_NS contributed most to the morphological divergence of subtropical highland samples from those from other regions. In addition, we observed in the field that the apterae from different climate regions had their own typical body shape and coloration patterns (Figure 1).
Principal component analysis (PCA) biplot based on the measurements of key morphological characters of Periphyllus koelreuteriae from different climate regions. The names and abbreviations of the morphological characters are provided in Supporting Information Table S2.
DISCUSSION
Genetic differentiation among populations in different climate regions
In taxonomic studies, insufficient specimen sampling from limited geographical or climatic regions may lead to an underestimation of genetic diversity and frequent occurrence of cryptic species in insect taxa (Hua & Wiens, 2013; Qvarnström et al., 2016). Previous reports on P. koelreuteriae have generally been limited to small geographical areas and focused on morphological and biological descriptions (Wang et al., 1991; Liu et al., 1999b; Gu et al., 2004; Junkiert & Wieczorek, 2019). In the present study, based on sampling across its distribution range, genetic distances (Table 2; Supporting Information, Table S5), phylogenetic tree topology (Fig. 1) and haplotype network (Fig. 2) analyses revealed that P. koelreuteriae exhibited distinct population genetic divergence corresponding to climate and host plant. In the subtropical highland climate region of south-western China, P. koelreuteriae populations were only recorded on the host plant K. bipinnata, and these samples occupied the most basal point of the phylogenetic tree. In the temperate regions of northern China and East Asia, P. koelreuteriae populations were only recorded on the host plant K. paniculata, and the temperate samples formed a separate clade that had closer phylogenetic relationships to samples from the subtropical humid climate regions of south-eastern China, where P. koelreuteriae populations were recorded on both K. bipennata and K. paniculata. The minimum genetic distances of the animal barcoding gene COI between the three genetic clades were 7.0% (subtropical highland vs. temperate), 6.4% (subtropical highland vs. subtropical humid) and 3.1% (temperate vs. subtropical humid) (Table S5). In DNA barcoding studies, genetic distance thresholds have been often used to identify different species (Hebert et al., 2003a; Hajibabaei et al., 2006; Weigand et al., 2013; Zahiri et al., 2014). Although the COI genetic distance thresholds proposed in previous studies vary slightly among different aphid groups, it has been generally accepted that 2.0–2.5% is a suitable threshold range for distinguishing different aphid species (Liu et al., 2013; Lee et al., 2017; Zhu et al., 2017; Li et al., 2020). The minimum COI genetic distances between the three clades in P. koelreuteriae thus all exceed the suggested threshold range for aphids, indicating that the three clades may represent different species.
Morphological and phenological differentiation among clades
Our results also showed significant difference in the morphology of P. koelreuteriae in different climatic regions, including characters related to body size, lengths of antennal segments, cauda, and numbers of seta on the cauda and 3rd antennal segment (Fig. 3; Supporting Information, Tables S2–S4). These morphological divergences matched phylogenetic correspondence to the three genetic clades. Based on previous reports (Liu et al., 1999b; Junkiert & Wieczorek, 2019) and our measurements, the body size of P. koelreuteriae individuals in temperate regions is generally smaller than that in subtropical regions, which may indicate adaptation to environmental temperatures in different regions.
As ectotherms, most of the biochemical and physiological processes of insects, such as foraging (Guarneri et al., 2003), flight (Taylor, 1963) and death-feigning (Miyatake et al., 2008), are regulated by external temperature (Smith, 1963; May, 1979). Mating behaviour, of course, is also regulated by temperature, mainly affecting the start time (Kanno & Sato, 1979), frequency (Cook, 1994) and duration (Katsuki & Miyatake, 2009) of mating. The different life-cycle strategies observed in P. koelreuteriae indicate phenological adaptation to different climatic conditions, as also observed in other aphids (Depa et al., 2015). For example, the appearance of the sexual generation in temperate regions (end of October to November) is about 2 months ahead of that in subtropical regions (late December to early February) (Liu et al., 1999b; Junkiert & Wieczorek, 2019). The divergence of mating time may lead to phenological asynchronization of P. koelreuteriae populations in different climatic regions, and with the accumulation of biological variations over time, distinct differentiation in P. koelreuteriae can be expected.
Possible scenario for differentiation in the P. koelreuteriae species complex
Periphyllus koelreuteriae represents a unique lineage in the aphid subfamily Chaitophorinae. It is the only species that feeds exclusively on Koelreuteria (Sapindoideae) (Blackman & Eastop, 2020), and unlike most Chaitophorinae species restricted to temperate regions, its distribution range spans from the temperate regions to subtropical regions of East Asia, especially China. In the present study, three distinct clades that may represent different species have been revealed in this lineage, and they correspond well to different climates as well as host plant species. A host plant shift has been recognized as an important driver shaping macroevolutionary patterns of aphids (Huang et al., 2012). As the other species of Periphyllus feed mainly on Acer and Aesculus (Aceroideae), one host plant transfer event to Koelreuteria occurred in the ancestor of the P. koelreuteriae lineage.
The diversification of the P. koelreuteriae species complex may correlate with the evolution of its Koelreuteria hosts. Three species of Koelreuteria occur in eastern Asia (Wu et al., 2007; Acevedo-Rodríguez et al., 2010). According to their natural distributions, K. paniculata is distributed mainly in temperate regions, while K. bipinnata is found mainly in subtropical regions of mainland China and K. elegans subsp. formosana is restricted to Taiwan (Xia & Luo, 1995). In mainland China, some K. paniculata populations also reach northern subtropical areas. A recent phylogenetic analysis of extant species of Koelreuteria based on four chloroplast genes revealed that K. bipinnata represents the most ancestral species and K. paniculata and K. elegans subsp. formosana diverged subsequently as sister species (Liu et al., unpubl. data). Previous studies also proposed that historical climatic changes affected the geographical distributions and early diversification of Koelreuteria as well as aphid species (Depa & Mróz, 2013; Wang et al., 2013; Jiang et al., 2019). The mountainous areas of south-western China may have served as refugia for K. bipinnata-type populations during periods of historical climate change (Li et al., 2016; Jiang et al., 2019). The extant K. paniculate, found mainly in temperate regions, should be the result of adaptation to a relatively colder climate (Wang et al., 2013). Historical climate changes may have affected the population expansion and divergent adaptation of both the plants and aphids. According to the P. koelreuteriae phylogeny, aphids from the subtropical highland climate regions of south-western China feeding only on K. bipinnata represent the most basal clade, corresponding exactly to the ancestral place of K. bipinnata and its distribution, which indicates that K. bipinnata was the ancestral host plant for P. koelreuteriae. The clade of P. koelreuteriae populations feeding only on K. paniculata also corresponds well with the distribution of the host plants in temperate regions, indicating their synergistic adaptation to a colder climate. However, for the separate clade formed by P. koelreuteriae populations from subtropical humid climate regions of south-eastern China, their feeding on K. bipennata and K. paniculata indicates that climate is more important than host plant for the adaptation and diversification of this clade. Although the Qinling Mountains in central China have been regarded as representing a dividing line between climates of northern and southern China, some overlap of the natural distributions of K. paniculata and K. bipinnata in northern subtropical areas do not support the Qinling Mountains as being a geographical barrier of their distributions. Phenological differences between P. koelreuteriae populations also indicate a closer relationship between differentiation and climate rather than geographical isolation.
Therefore, our results indicate that P. koelreuteriae is in fact a species complex with previously undescribed lineages adapted to different climate regions and host plants. Climate should be an important driver for the evolution of both this aphid group and its host plants. This study reveals a new case of an aphid lineage that originated and diversified from subtropical highland areas in a group mainly restricted to temperate regions of the Northern Hemisphere.
SUPPORTING INFORMATION
Additional Supporting Information may be found in the online version of this article at the publisher’s website:
Table S1. Sample information including voucher number, host plant, locality and GenBank accession number.
Table S2. Original morphometric data for P. koelreuteriae samples from different climatic regions.
Table S3. Statistics of morphometric data for P. koelreuteriae samples from three climatic regions.
Table S4. Results of one-way ANOVA and post-hoc least significant differences tests for morphological measurements of P. koelreuteriae samples from different climatic regions.
Table S5. Genetic distances of P. koelreuteriae samples between different climatic regions.
ACKNOWLEDGEMENTS
We thank Lingda Zeng and Zhixiang Liu for their help with specimen collection, and three anonymous reviewers for their helpful comments. This research was supported by National Key R&D Program of China (2016YFE0203100) and National Natural Science Foundation of China (Grant No. 31772504).
REFERENCES
