Promoter-Specific Expression of the Imprinted IGF2 Gene in Cattle (Bos taurus)¹

Abstract

The domestic cattle (Bos taurus) has been a good animal model for embryo biotechnologies, such as in vitro fertilization and nuclear transfer. However, animals produced from these technologies often suffer from large-calf syndrome, suggesting fetal growth disregulation. The product of the insulin-like growth factor 2 (IGF2) gene is one of the most important fetal mitogens known to date. A detailed analysis of age-, tissue-, and allele-specific expression of IGF2 has not been performed in the bovine mainly because the majority of the bovine sequence has been unavailable. In the present study, we obtained virtually the entire sequence of the bovine IGF2 cDNA, identified expressed single-nucleotide polymorphisms (SNPs) in both exons 3 and 10, and determined the age-, tissue-, and promoter-specific expression of bovine IGF2 in fetal, calf, and adult tissues. We found that, similar to the human and mouse, bovine IGF2 is subjected to extensive transcriptional regulation through multiple promoters, alternative splicing and polyadenylation, as well as genetic imprinting. However, major differences were found in the regulation of the bovine IGF2 in nearly all aspects of age-, tissue-, promoter-, and allele-specific expression of IGF2, and the promoter-specific loss of imprinting from every other species studied, including cattle’s close relatives, the sheep and the pig. The data presented here are of important reference value to cattle produced from embryo biotechnologies.

Introduction

Genomic imprinting is defined as an allele-specific modification that leads to differential expression between the parental alleles in somatic cells. This phenomenon is thought to be unique to placental mammals because imprinted genes have not yet been found in the egg-laying mammals (Monotremata) [1–4]. However, variations on the imprinted genes and their expression are found in mammals with different placental types [5, 6].

Insulin-like growth factor 2 (IGF2) is an essential fetal mitogen and was the first imprinted gene identified [7]. It is paternally expressed and maternally silenced in the mouse, human, sheep, pig, and cattle [7–11]. The IGF2 gene contains 10 exons in all species studied to date and it is translated in a pre-pro-form. The mature form of IGF2, however, contains only the last three exons (exons 8, 9, and 10), with part of the translated product of exon 10, the E domain, cleaved off. The other exons, together with four promoters (P1–P4), are involved in tissue- and/or developmental stage-specific expression of IGF2. This has been studied in great detail in the mouse and human and, to a lesser extent, in the pig and sheep [7, 12–14]. Complex and significant differences in the expression of IGF2 have been found among different species [12, 15]. For instance, in the mouse, all four promoters direct monoallelic expression of the IGF2 gene for its tissue-specific expression [16]. In the human, however, the promoters P2, P3, and P4 direct monoallelic expression throughout all stages of development, while P1 directs biallelic expression in the adult liver and choroid plexus/leptomeninges of the central nervous system [17–21].

In domestic artiodactylous species, such as cattle (Bos taurus) and the pig, the placental types are dramatically different from those of the human and mouse, suggesting differences in imprinting regulation [5, 6]. Although the bovine IGF2 has been shown to be preferentially paternally expressed in the placenta and liver of hybrid Bos gaurus and Bos taurus fetuses [10], has at least two polyadenylation sites, and has multiple transcripts of different sizes [22], a detailed analysis of the age-, tissue-, or promoter-specific allelic expression of the bovine IGF2 gene has not been reported. This is primarily due to a lack of sequence information for the bovine IGF2 gene. The regulation mechanism of IGF2 in cattle from conventional breeding is important to understand not only because species differences may exist but also because cattle generated from assisted reproductive biotechnologies, such as in vitro fertilization and nuclear transfer, often suffer from large-calf syndrome, suggesting fetal growth disregulation.

Imprinting is normally studied using genetic markers that can distinguish between the maternal and paternal alleles. Single-nucleotide polymorphisms (SNPs) are single base changes or insertion/deletions in the DNA sequence. SNPs have been widely used in imprinting studies because of their abundance in the mammalian genome and because they are inherited in a traditional Mendelian pattern. In this study, we aimed to 1) obtain the complete cDNA sequence of the bovine IGF2 gene; 2) identify expressed polymorphisms in the exons of IGF2; 3) examine the age-, tissue-, and promoter-specific transcription of IGF2; and 4) determine the allelic expression of each promoter-specific transcript.

Materials and Methods

Tissue Samples, Extraction of Genomic DNA, and Total RNA

Blood samples were obtained from 270 dairy and beef cattle from the research herds at the University of Connecticut and the South China Agricultural University. These samples were used for identification of SNPs, heterozygosity screening, and allele-frequency determination. Organ/tissue samples, including liver, kidney, heart, brain, lung, placenta, thymus, tongue, bladder, spleen, muscle, pancreas, and/or stomach were collected from 33 animals, including 19 fetuses, 5 newborn calves, and 9 adults from a cattle slaughterhouse. All organ samples were frozen immediately after collection and stored at −80°C until analysis. Genomic DNA was extracted from blood and organ samples using DNeasy kit from Qiagen (Valencia, CA) and total RNA was extracted from frozen organ samples using the RNeasy kit (Qiagen). The extracted RNA was treated with RNase-free DNase to remove any possible contaminating genomic DNA. The Institutional Animal Care and Use Committee at the University of Connecticut and an equivalent organization at the South China Agricultural University approved all procedures involving the use of animals.

Reverse Transcription-Polymerase Chain Reaction and DNA Sequencing

The reverse transcription-polymerase chain reaction (RT-PCR) was conducted using the one-step RT-PCR kit (Qiagen) with >10 ng/μl of total RNA, 0.6 pmol/μl primers, and 2 μl reverse transcriptase in a total volume of 25 μl at 55°C for 30 min. Primers for bovine IGF2 were designed according to homologous sequences of the human (AF517226), swine (AY044828), and ovine IGF2 (AH005355). The following amplification conditions were used for PCR: an initial denaturation step at 94°C for 2 min was followed by 35 cycles of denaturation at 94°C for 30 sec, annealing at 60–62°C for 30 sec, extension at 72°C for 10 sec, and a finishing hold at 72°C for 5 min. The PCR fragments were then subcloned into the TOPO TA Cloning vector (Invitrogen, Carlsbad, CA) and sequenced using the Bigdye kit on ABI PRISM Model 3700 (Applied Biosystems Inc., Foster City, CA). In some cases, the bovine IGF2 sequences were obtained by 3′-rapid amplification of cDNA ends (3′-RACE; Clontech Laboratories, Palo Alto, CA) and PCR (Invitrogen). Briefly, 3′-RACE was performed using RNA samples and oligo-dT primers conjugated to anchor primers. It was then followed by amplification using the anchor primer and a gene-specific primer designed as described above. The resultant PCR products were analyzed on a 0.8% agarose gel by electrophoreses. The specific bands from the 3′-RACE were then sequenced to obtain novel bovine sequences of IGF2.

Identification of Expressed SNPs in Bovine IGF2 and Determination of Allele Frequency

Primers that would give rise to PCR products of 150–400 base pairs (bp) were designed according to the newly generated cDNA sequences of bovine IGF2 in every exon and are shown in Table 1. For exons larger than 400 bp, multiple pairs of primers were designed so the products would be smaller than 400 bp and the PCR products would have short overlaps. PCR was conducted to amplify each exon and the PCR products were subjected to single-stranded conformational polymorphism (SSCP), which can detect polymorphisms in 95–100% of PCR products 150–400 bp in size [23–25]. PCR conditions were as described above. The PCR products were first resolved on 1% agarose gels to confirm the specific amplification of the products by size, and then they were subjected to SSCP analysis. The SSCP was conducted on 12% polyacrylamide gels at 4°C and 200 V overnight. The gels were then subjected to silver staining [24], dried in a gel drier, and the images archived. The appearance of different banding patterns among different samples by SSCP for exons 3 and 10 using primer pairs F1/R1 and F5/R4 indicated the existence of polymorphisms. The PCR products from these primers were then directly sequenced to identify the base changes of the polymorphisms.

Table 1

PCR primers used in this study for the exons of the bovine ICF2 gene.

Exon	Primer name	Primer sequence (5′—>3′)	Directiona	Product size (bp)	Tm (°C)
1	JY785	TGCAGCTGGACAGGAGGCT	F		70.7
3	F1	AGGGGACGAAGAGTCAC	F		60.9
	R1	TCAGTTCTGAGCAGGTGG	R	197	60.1
4	JY509	GCGGGAAGTTTCTCTCGTCC	F		67.2
	JY510	CAGTCCCCAGTGTCCGGG	R	183	69.3
	JY617	CCCAGCGCGGTCTCTGCA	F		73.7
	JY618	CGCGAGGCTGGAGGCCGA	R		76.7
	F2	GGGTCTTCCAACGGACTGG	F	385	66.8
5	JY615	GTTTCCCCAGACCCTCAAAT	F		63.9
	JY616	CTGAATGGCCGAGCTCAC	R	159	64.8
6	JY309	CCCAGCTCCTTGCCTCCAA	F		69.8
	JY308	GATTCTTTAGGGAGGACGGG	R	323	63.5
	JY607	AGCTGACCTCATTTCCCGAT	F		62.6
	JY608	CACCTTCCTGCTGCGTATTG	R	252	62.1
	JY611	CTCAGCACCTTCCCCGGC	F		70.6
	JY612	TTAATCCACTTTGGGACGGC	R		65.7
	F3	GCCCGTCCTCCCTAAAGAAT	F	204	65.2
7	JY786	TGCAGCTGGACAGGAGGCT	R		68.8
	F4	AGCCTTCCAGACTCCTCCT	F		61.9
8	JY311	ATCAATGGGGATCACAGCA	F		64.1
	R2	TGAAGTAGAAGCCGCGTCC	R	160	65.4
9	JY613	AGCCGCATAAACCGACGCA	F		70.8
	R3	CGGAAGCACGGTCGTAGAG	R	138	65.9
	JY313	ACGACGTCACCGCATACC	F		64.8
10	JY314	CTCCAGCTCCTTGGCGAG	R	134	66.3
	JY503	GGTCGCACGCTCGCCAAGGA	F		77
	JY504	CAGGACGGTACAGGGATTTCA	R	236	65.9
	F5	AATCCCTGTACCGTCCTGTC	F		68.3
	R4	TTTGCTTTTCTGGTGTTGCT	R	273	65.6

^a

F, forward;R, reverse.

The allele frequency was determined by genotyping all blood samples and calculated by using the following formula: frequency of an allele = (2 × number of animals homozygous for this allele + number of animals heterozygous for this allele)/2 × total number of animals examined.

Age-Specific Expression of IGF2 in Cattle

Because IGF2 is a potent fetal mitogen, the age-specific expression of bovine IGF2 was studied in three age groups, fetuses (n = 5), calves (n = 5), and adults (n = 5). Exon 10, which is present in all full-length forms of IGF2, was used as a marker to determine its expression with the use of primers F5 and R4. RNA from the liver, heart, spleen, lung, bladder, brain, placenta, and kidney were used as templates and were amplified using the one-step RT-PCR kit (Qiagen).

Promoter-Specific Expression of IGF2 in Different Age Groups

The bovine IGF2 gene structure and promoter locations were adapted from those of the human and pig (Fig. 1). The presence of a transcript from the putative bovine promoter P1 was determined by detecting the presence of exon 3 using primer F1 and R1 (Fig. 1 and Table 1), which is only present in P1 transcripts. Due to the presence of at least two polyadenylation sites in the bovine IGF2, the full-length transcripts from the putative bovine promoters P2–P4 were determined using the following forward primers: F2 located in exon 4 for P2 transcripts, F3 located in exon 6 for P3 transcripts, and F4 located in exon 7 for P4 transcripts, together with a common reverse primer: R4 located in exon 10. The presence of truncated forms of transcripts from P2, P3, and P4 were detected using primer pairs F2/R3, F3/R3, and F4/R3, respectively. RNA from organ samples of fetuses (n = 5), calves (n = 5), and adults (n = 5) were used as templates and a one-step RT-PCR kit was used to amplify each promoter-specific transcript, which was confirmed by size as determined by agarose gel electrophoresis.

Fig. 1

The putative gene structure of bovine IGF2 (adapted from the sheep). Numbered boxes represent exons, their approximate sizes, and locations. Solid bent arrows represent the transcriptional start sites for the putative promoters, P1–P4. Open arrows in the boxes indicate the locations of the primer pairs used for PCR and SSCP

Allele-Specific Expression of IGF2 in Cattle

All animals were genotyped using the primer pair F5/R4 (Fig. 1 and Table 1). Animals that were heterozygous for the SNP in exon 10 and for which organ samples were available were used in the allele-specific gene expression analysis. These included three fetuses, two calves, and two adults. One-step RT-PCR was conducted on all tissue samples from these heterozygous animals and the PCR products were then subjected to SSCP. In the case of monoallelic expression (imprinting), one parental band will be detected by SSCP; however, in the case of biallelic expression (no imprinting), two bands of equal density will be detected, in the case of leaky expression two bands of unequal density will be seen.

Promoter-Specific Loss of Imprinting

If biallelic (no imprinting) or leaky expression was detected in a tissue, it would be necessary to determine from which promoter imprinting had been lost, as the above experiment only examined allele-specific IGF2 expression from all expressed promoters. Full-length transcripts of promoters P2–P4 were then amplified from organs that exhibited biallelic or leaky expression by using primer pairs for promoter-specific expression analysis. Although truncated forms of transcripts will not be examined by the use of exon 10, the specific promoters that directed expression of either the full-length or truncated forms of the transcripts are the same, and therefore conclusions can be reached from the full-length transcripts. Nested PCR was then performed using each full-length transcript as a template to amplify a small fragment suitable for SSCP, which contained the SNP in exon 10, by the primer pair F5/R4. The nested PCR products were subjected to SSCP and subsequent allelic expression analysis. Putative promoter P1 was analyzed using the primer pair F1/R1 on all tissue samples from all animals heterozygous for the SNP in exon 3 (two calves).

Results

The Sequence of Bovine IGF2 cDNA

In this study, we obtained virtually the entire cDNA sequence of the bovine IGF2 gene. Previously, only the sequence of the bovine IGF2 exon 2 was available in the GenBank (AY23743). As in the mouse, sheep, pig, and human, the bovine IGF2 gene contains 10 exons. The nomenclature of the exons was adapted from that of the sheep, to which the bovine sequence is very homologous [13]. We have also found that the bovine IGF2 gene is highly GC rich, ranging from 58% to 67% (Table 2). Exon 1 could not be amplified by our PCR method using primers designed from consensus sequences of human, pig, and sheep IGF2, suggesting that large variations exist in the sequence of this exon between the bovine and the other species. Details of the sequence identities for bovine IGF2 exons, as compared with those of sheep and pigs, are shown in Table 2.

Table 2

Comparative exon organization of the cattle ICF2 gene to those of the pig and sheep.

Exona	Cattle		Sheep		Pig
	Length (bp)	G/C Content (%)	Length (bp)	Sequence identity (%)	Length (bp)	Sequence identity (%)
1	?		57		112
2	217b	62	?		193	80
3	221	67	219	61	232
4	436	67	397	94	389	82
5	165	60	157	98	165	92
6	601	63	927	98	1148	86
7	93	64	93	99	115	85
8	163	60	163	98	163	91
9	150	63	150	99	145	89
10	611	58	652	97	615	77
Total/Average	2657	62.6	2815	93	3277	85

^a

Exons were numbered according to the sheep system.

^b

Data were obtained from the Genbank (AY237543).

Identification of Expressed SNPs in Bovine IGF2 and Allele Frequency of the SNPs

A specific band, 197 bp in length within exon 3 of bovine IGF2, was obtained by PCR using the primers F1 and R1 and cattle genomic DNA as the template. A band shift was detected for this PCR product among different samples by SSCP (Fig. 2a). One SNP, a G/A transition, was identified at the 34th nucleotide of exon 3 after sequencing (Fig. 2c). A second polymorphism was detected in exon 10. A specific band of 273 bp was amplified in this exon using primers F5 and R4 (Fig. 2b). A shift in the banding pattern was also detected among different samples by SSCP. One SNP, also a G/A transition, was identified at the 408th nucleotide of exon 10 (Fig. 2d).

Fig. 2

Single-nucleotide polymorphisms in exons 3 and 10 of bovine IGF2 as shown by SSCP images and sequence chromatography. a) An SSCP image of three animals of different genotypes for the SNP in exon 3. Lanes 1–2: animals homozygous for the A and G alleles, respectively. Lane 3: an animal heterozygous for the A and G alleles (genotype AG). b) An SSCP image of three animals of different genotypes for the SNP in exon 10. Lanes 1–2: animals homozygous for the A and G alleles, respectively. Lane 3: an animal heterozygous the A and G alleles (AG). c) Sequence chromatographs of bovine IGF2 near the SNP of exon 3. The top two chromatographs show the forward and reverse sequencing results of an animal homozygous for the A allele. The bottom two chromatographs show the forward and reverse sequencing results of an animal homozygous for the G allele, as indicated by the black arrow. d) Chromatograph of the bovine IGF2 near the SNP in exon 10 showing an animal heterozygous (double peaks for A and G) for the SNP as indicated by the black arrowhead

Blood samples from dairy (Holstein and Jersey) and beef cattle were analyzed to determine the allele frequencies of the SNP in exons 3 and 10 of bovine IGF2. The frequency of the G allele is greater than that of the A allele (Table 3). Similarly, the frequency of the SNP in exon 10 was also skewed in favor of the G allele in Holstein cattle (Table 3).

Table 3

Allele and genotype frequencies of the SNPs of the bovine IGF2 gene in the research herds at the university of Connecticut and South China Agricultural University.

Breed	Exon	No. animals	No. of genotypes (%)			Allele frequency (%)
			AA	GG	AG	A	G
Holstein	3	122	1 (0.8)	116 (95.1)	5 (4.1)	2.9	97.1
Jersey	3	20	1 (5.0)	12 (60)	7 (35)	22.5	77.5
Angus/Hereford	3	17	0 (0)	17 (100)	0 (0)	0	100
Holstein	10	111	3 (2)	76 (68.5)	32 (28.8)	17.1	82.9

Age-Specific Expression of Bovine IGF2

We determined the age-specific expression of bovine IGF2 using samples from fetuses, calves, and adult cattle. Using exon 10, which is present in all full-length IGF2 cDNA, we detected IGF2 expression in all tissues of all age groups examined (data not shown), suggesting that IGF2 is expressed and may play important roles in all stages of development for the tissues examined.

Promoter-Specific Expression of IGF2 in Three Age Groups

In tissue samples from each of three different age groups, we found that P1 transcripts amplified with primers F1 and R2 (Fig. 3, lane 2) had an expected size of about 0.3 kb and were present in nearly all tissues of fetal, calf, and adult animals (Table 4A).

Table 4

Tissue- and age-specific expression of IGF2 promoter specific splice variants.

Promoter	Exons	Organ	Fetus*	Calf*	Adult*
A
P1	3-8 (3-9)	Liver	4/4	5/5	3/3
		Spleen	-	1/5	1/3
		Heart	4/4	0/5	3/3
		Bladder	2/4	1/5	-
		Lung	4/4	5/5	3/3
		Brain	4/4	4/4	2/3
		Kidney	3/4	3/4	2/3
		Placenta	5/5	4/5	-
B
P2	4-10 (4-9)	Liver	2/4	5/5	0/5 (4/5)
		Spleen	-	0/5 (5/5)	0/4 (1/3)
		Heart	0/4 (4/4)	0/5 (5/5)	0/5 (0/3)
		Bladder	0/4 (4/4)	0/5 (5/5)	-
		Lung	1/4	2/5	0/5 (2/5)
		Brain	0/4 (2/4)	0/5 (2/3)	0/5 (2/3)
		Kidney	3/4	4/4	0/4 (3/3)
		Placenta	0/5 (5/5)	0/5 (4/5)	-
C
P3	6-10 (6-9)	Liver	5/6	5/5	3/5†
		Spleen	-	2/5†′	2/4
		Heart	5/5	5/5	3/5
		Bladder	5/5	5/5	-
		Lung	5/6	4/5	3/5
		Brain	1/6 (5/5)	0/5 (5/5)	2/5† (3/5)
		Kidney	6/6	5/5	2/4
		Placenta	0/5 (5/5)	2/5 (3/5)	-
D
P4	7-10 (7-9)	Liver	5/5	5/5	0/5 (3/5)
		Spleen	-	4/5	1/4† (3/4)
		Heart	5/5	5/5	3/5
		Bladder	5/5	5/5	-
		Lung	5/5	5/5	4/5
		Brain	1/5 (4/4)	1/5	2/5 (3/3)
		Kidney	4/5	4/5	4/4†
		Placenta	3/5	2/5	-

^*

Data are presented as the number of animals tested positively over all animals examined. The ratios in parentheses are the data from the truncated variants. - Indicates that the particular tissue was unobtainable for that age group.

^†

The band was very weak.

Fig. 3

A representative agarose gel showing promoter-specific expression and alternative splicing for bovine IGF2. Lanes 1, 3, 5, 7, 9, 11, 13: 1 kb+ DNA ladder. Lane 2: P1 transcript amplified with F1 and R2 resulting in a band of the expected size of 0.3 kb containing exons 3–8. Lane 4: Full-length P2 transcripts. Alternative splicing of exon 5 resulted in two bands of the expected sizes of approximately 1.1 and 1.2 kb. Lane 6: Truncated forms of P2 transcripts detected in tissues with no expression of the full-length transcript. Alternative splicing resulted in two transcripts of the expected sizes of approximately 0.5 and 0.6 kb. Lane 8: Full-length P3 transcript amplified with F3 and R4 resulted in a band of the expected size of approximately 1.1 kb. Lane 10: Truncated P3 transcript, with an expected size of approximately 0.5 kb, was found in tissues with no expression of the full-length P3 transcript. Lane 12: A full-length P4 transcript containing exons 7–10 was amplified with primers F4 and R4 resulting in the expected size of approximately 1.1 kb. Lane 14: A truncated P4 transcript containing exons 7 and 8 with an expected size of approximately 0.4 kb detected in tissues that displayed no expression of the full-length P4 transcript

Two full-length P2 transcripts, of 1.1 kb and 1.2 kb in size (Fig. 3, lane 4), were found to be rarely expressed in fetal and calf tissues and completely absent in adults (Table 4B). The presence of two P2 transcripts was due to alternative splicing; one transcript contains exon 5 and the other does not. The few fetal and calf tissues that did express the full-length P2 transcript include the liver, kidney, and sometimes the lung (Table 4B). Interestingly, two truncated forms of P2 (Fig. 3, lane 6), both missing exon 10 but one splice variant contains exon 5 and the other does not, were found in all tissues from all three age groups in which the full-length P2 transcript was not found, with the exception of the adult heart, where neither the full-length nor the truncated P2 (Table 4B) was detected.

Expression of the full-length P3 transcript (Fig. 3, lane 8) was found in almost every tissue and age group studied; however, expression of the full-length P3 in the brain in all age groups gave very weak signals; therefore, a truncated P3 transcript was tested and detected positively in the brain. A truncated P3 transcript was also found in the placenta (Fig. 3, lane 10, and Table 4C).

Expression of the P4 transcript (Fig. 3, lane 12) was found in all fetal tissues with the exception of one fetal brain. Expression of the full-length P4 transcript appeared to decrease with age until full-length transcripts were primarily detected only in a small number of tissues of adult animals. Similar to P3, a truncated transcript of P4 (Fig. 3, lane 14), missing exon 10, was detected in tissues that did not express the full-length P4 transcript, such as in the liver, spleen, and brain of the adult group (Table 4D).

A complete summary of all exon combinations detected and their approximate sizes is listed in Table 5. These exon combinations were produced by alternative splicing and by the use of alternative polyadenylation sites.

Table 5

Detected exon combinations in promoter specific transcripts of bovine IGF2 using primers from Table 1.

Promoter	Detected exon combinations	Expected size (bp)
P1	3,8	310
P2	4, 8, 9, 10	1074
	4, 8, 9	463
	4, 5, 8, 9, 10	1239
	4, 5, 8, 9	628
P3	6, 8, 9, 10	1124
	6, 8, 9	513
P4	7, 8, 9, 10	1017
	7, 8, 9	406

Allele-Specific Expression of Bovine IGF2

Three fetuses, two calves, and two adults were heterozygous for the SNP in exon 10 and were analyzed for allele-specific IGF2 expression in all major organs by RT-PCR-SSCP. In fetuses, the paternal allele of IGF2 was found to be monoallelically expressed in all organs examined (Fig. 4a), except for the brains (Fig. 4a, lane 5). In the calf group, while the majority of the tissues examined expressed the paternal allele monoallelically or nearly monoallelically (Fig. 4b), leaky expression of the maternal allele was observed in the spleen and heart of one calf (Fig. 4b, lanes 2 and 5). In the two adult animals, much more leaky expression was observed. For example, the muscle, lung, and brain (Fig. 4c, lanes 1, 3, and 6) from an adult were found to have monoallelic expression while the heart and liver (Fig. 4c, lanes 4 and 5) were found to have nearly biallelic expression. Additionally, the spleen (Fig. 4c, lane 2) and skin samples (data not shown) were available from the other adult and found to be nearly biallelic.

Fig. 4

Representative SSCP images of the allele-specific expression of the bovine IGF2 gene. a) Allelic expression of a Holstein fetus. Lanes 1 and 2: genotypes of the mother and her fetus. The fetus had two bands, indicating the animal was heterozygous for the SNP while the mother only had one band (allele G), indicating she was homozygous and the calf inherited the G allele from the mother. Lanes 3–15: Allelic expression of IGF2 in the fetal heart, liver, brain, lung, kidney, stomach, pancreas, thymus, tongue, muscle, bladder, spleen, and placenta. All organs monoallelically or nearly monoallelically expressed the paternal (A) allele except for the brain, which expressed both parental alleles. b) Allelic expression of a Holstein calf. Lanes 1–5: kidney, spleen, liver, lung and heart. The predominantly expressed allele is A. Low levels of leaky expression of the G allele are seen in the spleen (lane 2) and heart (lane 5). c) Allelic expression of an adult Holstein. Lanes 1–6: muscle, spleen, lung, heart, liver, and brain. The predominantly expressed allele is G, and strong leaky to nearly biallelic expression is seen in the spleen (lane 2), heart (lane 4), and liver (lane 5)

Promoter-Specific Loss of Imprinting

In the above experiment, the allelic expression of IGF2 was directly examined in exon 10, which could be transcribed from all promoters, therefore, promoter-specific allelic expression of the full-length form of IGF2 was further determined in all organs in which leaky or nearly biallelic expression was shown. The P1 transcript was analyzed using the SNP within exon 3 in two heterozygous calves and was found to have lost imprinting in the liver and sometimes in the kidney and retained imprinting in all other organs such as the placenta, lung, bladder, spleen, and heart (Fig. 5a). To analyze P2, P3, and P4 in biallelic organs, promoter-specific full-length transcripts were first amplified by RT-PCR and then exon 10 from a specific transcript was amplified by nested PCR. In fetuses, the full-length P2 transcripts were not biallelically expressed and determination of loss of imprinting was not necessary. For calves that expressed the full-length P2 transcript, a loss of imprinting could not be conducted because the animals were not heterozygous for the SNP in exon 10. Promoter-specific loss of imprinting for P3 (Fig. 5b) and P4 (Fig. 5c) transcripts were detected in all tissues in which strong leaky or nearly biallelic expression was seen, including fetal brain, calves, and adults.

Fig. 5

SSCP images of promoter-specific loss of imprinting in animals heterozygous for the SNPs in exons 3 and 10. a) A representative SSCP image showing imprinting of P1 transcripts. Lanes 1–6: kidney, liver, spleen, placenta, heart, and lung of different heterozygous calf for the SNP in exon 3. Lanes 7–10: spleen, bladder, liver, and kidney of a calf heterozygous for the SNP in exon 3. b) A representative SSCP image showing a loss of imprinting of P3 transcripts. Lane 1: the brain of a fetus. Lanes 2 and 3: spleen and heart of a calf. Lanes 4 and 5: the heart and liver of an adult. c) A representative SSCP image showing a loss of imprinting of P4 transcripts in three age groups. Lane 1: the brain of a fetus. Lane 2: the kidney of a calf. Lanes 3 and 4: the liver and lung of an adult

Discussion

In this study, the coding sequence of bovine IGF2 was obtained for the first time, except exons 1 and 2, which either could not be amplified specifically or were already available [26]. Differences in the lengths of exons were observed among the bovine, ovine, and porcine IGF2, but they share the same gene structure and good homology, ranging from 61% to 99% for different exons [13, 15]. In the bovine IGF2 coding regions, we identified two novel SNPs, both of G/A transitions, one in exon 3 and another in exon 10. The allele frequencies of both expressed SNPs are extremely skewed in the animals in our research herds. This could possibly be due to the relative inbreeding of cattle from a limited number of sires.

Although IGF2 is a potent mitogen for fetal growth, we found that this gene is expressed in all tissues of the three age groups examined, suggesting that IGF2 also plays important roles after fetal development. This is similar to the observations in the sheep, pig, human, and mouse [12, 13, 15, 27].

The expression of bovine IGF2 is highly regulated by at least four different promoters in an age-related and tissue-specific manner. We found that, unlike any other species studied, transcripts from P1 are present in most fetal, calf, and adult tissues tested, with the exception of the brain, while transcripts from the homologous promoter in the mouse are only present in the fetal placenta [27]. The transcription pattern of P2 is also different from that in the human, sheep, and pig. For example, in the human, P2 transcripts have only been detected in certain cancer cell lines [12]. In the sheep, transcription of promoter P2, beginning with exon 5 instead of exon 4, as is the case in the bovine, was found in both the fetal and adult liver [13]. Among all four promoters of the bovine IGF2, the expression of the P3 transcript is most consistent with that of other species studied [12, 13, 15, 28]. It is expressed ubiquitously throughout fetal, calf, and adult life in all tissues tested, making it the most active promoter among different tissue types. In contrast, P4 transcripts are expressed in virtually all fetal and calf tissues tested while the truncated form is expressed in most adult tissues studied.

In the present study, we found that alternative splicing occurred in transcripts from all promoters. The use of alternative polyadenylation sites occurred in P2–P4, resulting in truncated forms of transcripts from these promoters, missing the major portion of exon 10. Interestingly, the truncated transcripts are always present in tissues in which the full-length transcripts are absent. It appears that the full-length transcripts from promoters P2 and P4 were detected largely in fetal and calf tissues, while P3 transcripts were found in all age groups. As the animals age, the truncated forms of P2 and P4 became the major transcripts in most tissues of adults. Because exon 10 is the major component of the E-domain of the IGF2 protein, the truncated translation products may be a way for the tissues to differentially regulate the levels of the mature form of IGF2 and its E-domain, whose function is still to be defined. This speculation is consistent with data in the rat, where the presence of the E-domain peptide in serum is very high at birth and declines markedly in the adult [29].

The bovine IGF2 was found to be monoallelically expressed in all of the fetal organs except for the brain, where biallelic expression was seen, which is in agreement with the sheep and human studies. Monoallelic expression was seen in some adult cattle brain samples, suggesting that biallelic expression occurs in certain parts of the brain, as is reported in humans choriod plexus/leptomeninges, and monoallelic expression in other parts of the brain. We have found that a loss of imprinting occurs in various bovine organs. However, there seems to be a randomness in the loss of imprinting, as the same organs are found to be either imprinted or not imprinted among different animals within the same age group.

We have also determined the specific promoters from which a loss of imprinting has occurred. We found that, unlike in humans and sheep, where promoter P1 is used to direct biallelic expression [12, 13, 28], a loss of imprinting appears least likely to occur from promoter P1 in cattle, as approximately only half of the organs analyzed were monoallelically expressed. Also different from the mouse, where there is a general loss of imprinting with age from all of the promoters, cattle’s loss of imprinting is primarily from P3 and P4, and they are expressed nearly biallelically in the majority of tissues studied. This observation may suggest that imprinting of the IGF2 gene is most important in fetal growth and the loss of imprinting observed in the adult age group is well tolerated and may be necessary for development.

In summary, the findings of our extensive study illustrate the evolutionary divergence of the expression regulation of bovine IGF2 with respect to age-, tissue-, promoter-, and allele-specific expression as well as promoter-specific loss of imprinting from that of all other species studied, including those closely related to cattle, such as the pig. These observations demonstrate the importance of determining imprinting regulation in a species-specific manner. The detailed analysis of IGF2 in conventionally bred cattle should be a great reference for studies of cloned animals.

Acknowledgments

The authors would like to thank Drs. Charles Bormann, Brian Enright, and Gary Kazmer for taking the blood samples from dairy and beef cattle and Hamed Kian and Yuqin Zhang for tissue collection from the slaughterhouse.

Author notes

¹

Supported by NIH (HD40889) and USDA (02402) to X.C.T. S.Z. was partially supported by a scholarship from The China Education Fund.

³

These authors contributed equally to this work.