In Utero Exposure to Di-(2-ethylhexyl) Phthalate Exerts Both Short-Term and Long-Lasting Suppressive Effects on Testosterone Production in the Rat

Abstract

We examined the effects of fetal exposure to a wide range of di-(2-ethylhexyl) phthalate (DEHP) doses on fetal, neonatal, and adult testosterone production. Pregnant rats were administered DEHP from Gestational Day (GD) 14 to the day of parturition (Postnatal Day 0). Exposure to between 234 and 1250 mg/kg/day of DEHP resulted in increases in the absolute volumes of Leydig cells per adult testis. Despite this, adult serum testosterone levels were reduced significantly compared to those of controls at all DEHP doses. Organ cultures of testes from GD20 rats exposed in utero to DEHP showed dose-dependent reductions in basal testosterone production. Surprisingly, however, no significant effect of DEHP was found on hCG-induced testosterone production by GD20 testes, suggesting that the inhibition of basal steroidogenesis resulted from the alteration of molecular events upstream of the steroidogenic enzymes. Reduced fetal and adult testosterone production in response to in utero DEHP exposure appeared to be unrelated to changes in testosterone metabolism. In view of the DEHP-induced reductions in adult testosterone levels, a decrease in the expression of steroidogenesis-related genes was anticipated. Surprisingly, however, significant increases were seen in the expression of Cyp11a1, Cy17a1, Star, and Tspo transcripts, suggesting that decreased testosterone production after birth could not be explained by decreases in steroidogenic enzymes as seen at GD20. These changes may reflect an increased number of Leydig cells in adult testes exposed in utero to DEHP rather than increased gene expression in individual Leydig cells, but this remains uncertain. Taken together, these results demonstrate that in utero DEHP exposure exerts both short-term and long-lasting effects on testicular steroidogenesis that might involve distinct molecular targets in fetal and adult Leydig cells.

Introduction

Endocrine disruptors include a large group of environmental pollutants that behave as agonists or antagonists of androgens and estrogens and that have long been suspected of being involved in the occurrence of male reproductive defects observed in humans, including cryptorchidism, hypospadias, testicular cancer, and poor semen quality [1]. Among these compounds, the phthalic acid esters, or phthalates, used in the production of plastics and cosmetics, are found at high levels in industrial areas where humans can be exposed. Exposure via ingestion [2], inhalation, and dermal contact [3] results in measurable levels of phthalates in blood [4], urine [5], semen [6], breast milk [7], and umbilical cord blood [8].

The most common of these compounds, di-(2-ethylhexyl) phthalate (DEHP), is found in amniotic fluid, placenta, and fetal tissues of rats following ingestion [9, 10], suggesting that DEHP might have an effect on the development of embryonic tissues. Although the typical human exposure to DEHP ranges from 3 to 30 μg/kg/day [11], specific medical conditions exist in which DEHP exposure can reach much higher levels, from 1.5 mg/kg/day during hemodialysis to between 10 and 20 mg/kg/day through neonatal transfusion or parenteral nutrition [12–14].

In rodents, phthalates have been reported to exert negative effects on the male reproductive system, reducing fertility and litter size as well as inducing cryptorchidism and testicular atrophy [1, 15, 16]. Although Sertoli cells were thought to be the primary targets of phthalate exposure [17, 18], exposures to DEHP and its metabolite, mono-(2-ethylhexyl) phthalate (MEHP), have been found to result in decreased testicular testosterone levels in mice [19, 20], suggesting that Leydig cells also might be targets. Indeed, previous studies showed that MEHP inhibited LH-stimulated testosterone secretion by purified adult rat and MA-10 mouse tumor Leydig cells [21, 22]. Moreover, in utero exposure to di-n-butyl phthalate (DBP), DEHP, butylbenzyl phthalate, and di-isononyl phthalate were found to disrupt the differentiation of androgen-dependent tissues in male rat offspring in a manner similar to the effects produced by antiandrogens [16, 23, 24].

A recent epidemiological study related fetal phthalate exposure to the increase in male reproductive disorders among humans, and it suggested that phthalate exposure might carry reproductive health risks for humans as well as rodents [25]. Governmental agencies have acknowledged this possibility and determined, based on available animal studies [14], the no-observed-adverse-effect level of DEHP for humans to be between 3.7 and 14 mg/kg/day for reproductive/developmental effects. These safety levels, however, do not account for the fact that humans are exposed to more than one endocrine disruptor at a time and, therefore, that additive or synergistic effects cannot be excluded. Clearly, understanding the consequences and the cellular and molecular mechanisms involved in the effects of each of these chemicals individually could be instrumental in recognizing their targets and, thus, their possible interactions.

The deleterious effects of exposure to phthalate esters on the male reproductive system have been described in several studies [23, 26–29], and several genes have recently emerged as potential targets of phthalates in fetal testes [30]. Most studies, however, have examined the effects of a single, very high phthalate dose. The few studies that have examined the dose effects of DEHP have not extended their experiments into adulthood. In the present study, the major objectives were to determine the effect of in utero exposure to a wide range of DEHP doses on steroid production from fetal life to adulthood and to relate functional, morphological, and molecular changes that might account for altered steroid production.

Materials and Methods

Materials

Corn oil and DEHP were purchased from Sigma. Anti-cytochrome P450 side-chain cleavage (P450scc; CYP11A1) antibody was from Chemicon, and anti-heat shock protein 90 (HSP90) antibody was from Stressgen Biotechnology. Anti-Wilms tumor protein (WT1) antibody was from Santa Cruz Biotechnology, Inc., and anti-testosterone, anti-17β-estradiol, and anti-5α-dihydrotestosterone (anti-DHT) were from ICN Pharmaceuticals. Secondary antibodies and immunoreaction reagents were from Zymed Laboratories, Inc. The [³H]testosterone, [³H]17β-estradiol, and [³H]DHT were obtained from NEN/DuPont. Purified hCG was a gift from Dr. A.F. Parlow (National Institute of Diabetes and Digestive and Kidney Diseases, National Hormone and Pituitary Program at the National Institutes of Health, Bethesda, MD). The RNA extraction reagents were from Arcturus Bioscience, Inc. Quantitative real-time PCR (Q-PCR) reagents were from Applied Biosystems, and primers were from Integrated DNA Technologies. Culture supplies were purchased from Mediatech.

Animals and Treatments

Timed pregnant Sprague-Dawley rats were purchased from Charles River Laboratories. Animals were kept on a 12L:12D photoperiod with ad libitum access to food and water. Pregnant rats were treated daily by gavage with vehicle (corn oil) alone or with vehicle containing from 58 to 1250 mg/kg/day of DEHP from Gestational Day (GD) 14 to the day of parturition (Postnatal Day [PND] 0). Doses were adjusted according to changes in animal weight. Male offspring at GD19, GD20, PND3, PND21, and PND60 were studied. Body weights, testis weights, anogenital distance, and occurrence of cryptorchidism were recorded. The animals were handled according to a protocol that was reviewed and approved by the Georgetown University Animal Care and Use Committee.

Organ Culture

Testes from GD20 fetuses or PND3 pups from three dams for each treatment were cut into 4–10 pieces and placed into 24-well plates in 0.5 ml of Ham F12/Dulbecco modified Eagle Medium (1:1) medium on Millipore filters (Millipore Corporation). Samples were incubated at 37°C in 3.5% CO₂. The media were collected for steroid determination, with fresh media added every 24 h. After 2 days in culture, some wells received 50 ng/ml of hCG to test the hormone responsiveness of the Leydig cells, with the media collected and changed at 24-h intervals for an additional day. At the end of Day 3, some tissue samples were processed for immunohistochemistry. Testosterone and DHT concentrations were determined by RIA in the supernatants of the cultures and adjusted to values per testis. Means were derived from the testes of male offspring from a given dam per treatment. Data are presented as the mean ± SEM of the values obtained for the three dams in each treatment point.

Adult Serum Androgen Measurements

Peripheral blood of PND60 offspring was collected, and the levels of circulating testosterone and 17β-estradiol were measured by RIA using commercially available antisera as described previously [22]. Blood samples were collected from the offspring of pregnant dams gavaged with oil (n = 5 pregnant dams) or with DEHP at 58 (n = 2), 117 (n = 3), 234 (n = 3), 469 (n = 3), 700 (n = 3), 750 (n = 5), 938 (n = 4), or 1250 (n = 3) mg/kg/day. Data are provided as described above, with a given dam representing n = 1.

RNA Isolation and Q-PCR Analysis

Testes were homogenized in RNAzol B, the RNA extracted, and the mRNA species quantified as described previously [31]. Briefly, total RNA was reverse transcribed using TaqMan Reverse Transcription Reagents, and Q-PCR was performed on an ABI PRISM 7700 Sequence Detector using a SYBR Green PCR Master Mix kit and specific sets of primers for the 18S rRNA and target gene amplicons (Table 1). The cycling conditions comprised an initial step at 50°C for 2 min, followed by 10 min at 95°C and then 40 cycles at 95°C for 15 sec and at 60°C for 1 min. The formation of PCR products was monitored by measuring the increase in SYBR Green dye fluorescence, and the quantities of the genes of interest were normalized to the endogenous reference (18S rRNA) by calculating the value of 2^ΔCt, with ΔCt being the difference between the threshold cycle (Ct) of the gene of interest and that of 18S rRNA. The results are expressed in relative units representing the mean ± SEM of the mRNA levels determined in samples obtained from the offspring of three dams per treatment point, with each sample processed in triplicate.

Table 1

List of primers used in quantitative real-time PCR analysis.

Primer position	Primers (5′–3′ sequences)	Accession no.
r-Vdac1
597U	CGAGTGACCCAGAGCAACTTT	AF048828
677L	CTCCGTCCCATCATTCACATTA
r-Shbg
1118U	AAGCCCTGAGCAGAAGCCA	M31179
1168L	GGCTCTGAGGGCAACTATGAGT
r-Cyp11a1
1208U	GAACGACCTGGTGCTTCGTAA	J05156
1288L	GATTCTCGACCCATGGCATAG
r-Star
3035U	TCCGAGTAAACGGTCTTAGTCGT	AB001349
3116L	GCGTTCCACGTTGTTCTGTTC
r-Cyp17a1
710U	ACCTAGAGGCCACAACTAACATCC	M21208
790L	GAGGCACTGGGACTAGCACCT
r-Tspo
171U	GCTGGACACTCGCTCCCA	J05122
221L	CATACCCCATGGCCGAATAC
r-Clu
965U	AGGGCCAGTGTGAGAAGTGC	M64723
1015L	TGGTCGAACAGTCCACAGACA
r-Igf1
1000U	TTGCTTCCGGAGCTGTGATC	M15481
1080L	CGGATGGAACGAGCTGACTT
r-Ace
3754U	CAGAGTCCAGTCGCGTCAAC	U03734
3804L	CCTGCTGTGGTTCCAGGTACA
r-Cebpb
838U	GTTTCGGGACTTGATGCAATC	X60769
904L	GTTGCGTCAGTCCCGTGTC
r-Hsd17b
785U	TCACGATTGGAGCTGAAACCT	AF035156
835L	TCGCCAAGATTTCATGAGCA
r-Ptch1
1518U	ATCCGAGTGGCCAGTGGTTA	AF079162
1568L	GGTTAAACAGGCATAGGCAAGC
r-Cyp19a1
1692U	GGTATCAGCCTGTCGTGGACTT	M33986
1742L	CGTCATCCTCCAGGGCTCT
r-Dbi
225U	TGTGGGCGATGTAAACACAGA	NM_031853
275L	TTGCCCTTGAGGTCCAACAG
r-Insl3
355U	CAGCAAGACCTTTTGGGTCTGT	NM_053680
405L	CCTGAGCCCTACAATCCTTCAGT
r-18s rRNA
1655U	TCCCAGTAAGTGCGGGTCAT	M11188
1735L	CCAATCGGTAGTAGCGACGG

Immunohistochemistry

Immunohistological analysis of fetal and postnatal testes was performed on paraffin sections (thickness, 5 μm) as reported previously [32]. In brief, an antigen retrieval method was used, followed by incubation of slides overnight at 4°C with primary antibody diluted (1:80 to 1:400) in PBS containing 10% calf serum and then with horse radish peroxidase-coupled secondary antibody (Histostain-Plus Kit; Zymed Laboratories). Sections were counterstained with hematoxylin. An antibody against CYP11A1 was used as a Leydig cell marker. As a negative control, nonspecific immunoglobulin G was used instead of specific antibodies. Sections were coated with Crystal-Mount (Biomedia) and examined using bright-field microscopy. Results obtained with offspring from two to four dams per treatment were compared. Representative results are shown.

Morphometric Analysis

Testes were fixed in 3.5% buffered formaldehyde and processed for immunohistochemisty as described previously [31]. An anti-CYP11A1 antibody was used to identify Leydig cells. The absolute volume of Leydig cells per testis was determined. Briefly, the number of Leydig cell nuclei was determined by point counting, using a 200-point grid positioned over five different areas of 5-μm testis sections that had been captured with an Olympus DP70 digital camera fitted on an Olympus BX40 microscope. At least four sections, corresponding to different areas in the testis, were examined for each sample. The number of points falling on the nuclei of CYP11A1-positive Leydig cells within the 200-point grid was determined and used to calculate the percentage represented by the Leydig cells in the section. Then, using the weight of the testis as an equivalent to its volume, the absolute volume occupied by the Leydig cells per testis was calculated by multiplying the percentage of Leydig cells by the testis volume. The same method was used to count Sertoli cell nuclei, except that sections were treated with an antibody against WT1 to allow Sertoli cell identification. Germ cells were quantified as described above in tubules at stages VII and VIII. An antibody against HSP90 and morphological criteria were used to identify germ cells. Germ cell counts were normalized to the number of Sertoli cell nuclei and the volume density of tubules to correct for tubule shrinkage before calculating absolute volumes per testis as described previously [31]. The final absolute volumes of Leydig cells, germ cells, and Sertoli cells per testis are expressed in mm³. Values are presented as the mean ± SEM obtained from pooled offspring of pregnant dams gavaged with oil (n = 6 pregnant dams) or with DEHP at 234 (n = 4), 469 (n = 3), 700 (n = 3), 938 (n = 4), or 1250 (n = 3) mg/kg/day at PND 21 and pregnant dams gavaged with oil (n = 6) or with DEHP at 234 (n = 3), 469 (n = 3), 700 (n = 3), 938 (n = 4), or 1250 (n = 3) mg/kg/day at PND60.

Statistical Analysis

Statistical analysis was performed using the unpaired t-test or one-way ANOVA followed by the Dunnett posttest from the statistical program of the GraphPad Prism (Version 4.02) package from GraphPad, Inc. In all experiments, the experimental unit was the pregnant dam, and the responses of pups from at least three dams for each treatment were examined independently. The mean and SEM for the results of combined experiments are presented, with n representing the number of dams for all graphs.

Results

Effects of In Utero DEHP Exposure on Litter Size, Adult Body Weight, Anogenital Distance, and Testis Weight in Prepubertal and Adult Rats

Pregnant rats were gavaged from GD14 to birth with corn oil (controls) or with DEHP at doses ranging from 234 to 1250 mg/kg/day. The highest dose was shown previously to induce alterations in the male reproductive system [29]. In utero DEHP exposure did not have significant effects on litter sizes (Fig. 1A), on numbers of male pups per litter (Fig. 1B), or on the body weights of PND21 (data not shown) and PND60 (Fig. 1C) rats at any DEHP dose used. The highest dose (1250 mg/kg/day) induced a significant decrease in the anogenital distance; lower doses did not have significant effects (Fig. 1D). Normal testicular descent occurred in rats that had been exposed in utero to DEHP doses of up to 750 mg/kg/day. At doses of 938 and 1250 mg/kg/day, 10% and 25% of the testes, respectively, were cryptorchid at PND60. Mean testis weights at PND21 (Fig. 1E) and PND60 (Fig. 1F) did not differ from those of controls at doses up to 750 mg/kg/day of DEHP. At 938 and 1250 mg/kg/day, some of the PND60 testes were reduced in weight by 40% or more compared to controls (Fig. 1F). These testes were classified as atrophied and were excluded from further studies.

Fig. 1

Long-term impact of in utero DEHP exposure on litter size, adult body weight, anogenital distance, and testis weight in prepubertal and adult rats. Pregnant rats were treated by gavage with either corn oil (control) or DEHP at the indicated doses from GD14 to birth, and their offspring were killed at PND21 or PND60. Number of pups per litter (A), percentage males per litter (B), body weight (C), and anogenital distance (D) at PND60 as well as testis weight at PND21 (E) and PND60 (F) are shown as the mean ± SEM of values obtained for rats from five, three, three, three, five, four, and three independent litters for DEHP doses of 0, 234, 469, 700, 750, 938, and 1250 mg/kg/day, respectively, at PND60 and from five, four, three, three, three, three, and two dams for the same DEHP doses, respectively, at PND21. In F, testes weights in adult rats exposed to 938 and 1250 mg/kg/day of DEHP were divided into two groups, one presenting normal weights (filled bars) and the second consisting of testes that were reduced in weight and classified as atrophied (hatched bars). *P < 0.05, **P < 0.01.

Effects of In Utero DEHP Exposure on Leydig Cell Distribution and Absolute Volume in Adult Testes

Although exposures to DEHP occurred during gestation and not thereafter, Leydig cells in the adult rats, 60 days after the last exposure, were nonetheless affected. The administration of 938 or 1250 mg/kg/day resulted in the appearance of hyperplastic foci of Leydig cells in PND60 testes that were not observed at doses from 234 to 700 mg/kg/day (Fig. 2A). Areas of apparent Leydig cell hyperplasia also were observed in the testes of PND21 rats in response to fetal exposure to high doses of DEHP (data not shown). Morphometric analyses were conducted to determine the total (absolute) volume of Leydig cells per testis as a function of DEHP dose administered during gestation. As shown in Figure 2B, DEHP exposures induced dose-dependent increases from 1.5- to 3-fold in the absolute volume of Leydig cells per testis, with significant effects seen even at the lowest dose of 234 mg/kg/day. The absolute volumes of germ cells and Sertoli cells were determined in adult seminiferous tubules at stages VII and VIII in the same samples to examine whether changes occurred in other testicular cell types present in adult testis. Surprisingly, no overall change was seen in the absolute volumes of germ cells (spermatogonia, preleptotene spermatocytes, pachytene spermatocytes, round spermatids, and elongated spermatids) at any of the DEHP doses examined. An increasing trend in Sertoli cell absolute volumes were noted in DEHP-exposed testes (Fig. 2C). It should be noted that atrophied testes, in which severe depletion of germ cells and Sertoli cells occurred but the Leydig cell population remained similar to control values (data not shown), were excluded from this and all other studies. Thus, at PND60, the only significant morphological changes after in utero DEHP exposure were increases in the absolute volume of Leydig cells.

Fig. 2

Effects of in utero DEHP exposure on Leydig cell distribution and absolute volume in adult testes. Testes from PND60 rats exposed in utero to DEHP were processed for histology using hematoxylin-and-eosin staining and for immunohistological analysis using antibodies against CYP11A1 to facilitate Leydig cell identification. A) Leydig cell morphology in sections of control (corn oil) and DEHP-exposed (234-1250 mg/kg/day) rat testes at PND60 examined by immunohistochemistry using CYP11A1 as a Leydig cell marker. The magnification was identical for all CYP11A1 immunostained micrographs (Bars = 25 μm). Representative results from the offspring of three to five dams per treatment are shown. B) The absolute volumes of Leydig cells per testis were measured by morphometric analysis using a point-counting method on testis sections of rats from three to five separate litters for each treatment. C) As a comparison, the absolute volumes of germ and Sertoli cell populations were determined using WT1 immunoreactivity to identify Sertoli cells and HSP90 immunostaining and cell morphology to identify the different types of germ cells present in stage VII and VIII tubules. Results are expressed as the total (absolute) volume of each cell population per testis in mm³ and are shown as the mean ± SEM. are shown. *P < 0.05, **P < 0.01.

Long-Term Effects of In Utero DEHP Exposure on Serum Testosterone

Testicular steroidogenic function in adult rats in response to in utero DEHP exposures of between 58 and 1250 mg/kg/day was assessed by measuring circulating testosterone concentrations at PND60. As shown in Figure 3A, a dose of 58 mg/kg/day of DEHP had no effect on testosterone levels, whereas a dose of 117 mg/kg/day induced a small (22%) but not significant decrease in testosterone levels. Exposure to DEHP at doses of 234 mg/kg/day or greater, however, resulted in significant decreases in peripheral blood testosterone concentrations (Fig. 3A). The decreases in circulating testosterone occurred despite an increase in the absolute volume of Leydig cells per adult testis (Fig. 2B). No significant differences were seen in the levels of circulating estradiol between control and treated groups (Fig. 3B), suggesting that increased conversion to estradiol was unlikely to be the explanation for decreases in serum testosterone concentration.

Fig. 3

Long-term impact of in utero DEHP exposure on circulating testosterone (A) and estradiol (B) levels in adult rats. Pregnant rats were treated by gavage with either corn oil (control) or DEHP at the indicated doses from GD14 to birth. Offspring were killed at PND60, peripheral blood collected, and steroid levels determined by RIA. Results are shown as the mean ± SEM of the testosterone and estradiol levels (pg/ml serum) measured in blood samples collected in rats from the offspring of five, two, three, three, three, three, five, four, and three independent litters gavaged with oil (0) or with DEHP at 58, 117, 234, 469, 700, 750, 938, or 1250 mg/kg/day, respectively. *P < 0.05; **P < 0.01.

Short-Term Effects of In Utero DEHP Exposure on Steroidogenesis by Fetal and Neonatal Testes

Having demonstrated that in utero exposure to DEHP had effects on circulating testosterone levels in the adult, we examined whether in utero DEHP exposure also had effects on the ability of fetal (GD20) (Fig. 4A) and neonatal (PND3) testes to produce testosterone. To this end, pregnant dams were administered either vehicle (corn oil) or DEHP (117–938 mg/kg/day), and the testes from the GD20 fetuses or PND3 pups were collected and put in organ culture to assess basal and hormone-dependent testosterone production. This was done by culturing testis fragments in vitro for between 1 and 3 days in the absence or presence of hCG and measuring testosterone concentrations in the media. In utero exposure to DEHP at between 117 and 938 mg/kg/day resulted in significant, dose-dependent reductions in basal testosterone formation by GD20 testis fragments cultured for 1, 2, or 3 days in the absence of hCG (Fig. 4A). In response to hormonal (hCG) stimulation, however, the testosterone produced by GD20 testes exposed to DEHP at between 117 and 469 mg/kg/day was comparable to that of controls; a reduction in hCG-stimulated testosterone production was seen only in response to the 938 mg/kg/day dose (Fig. 4A). This findings was in striking contrast to the reduced basal levels of testosterone production by GD20 testes seen even after a relatively low DEHP dose (117 mg/kg/day).

Fig. 4

Dose-response effects of in utero DEHP exposure on fetal Leydig cell steroidogenesis. Testis fragments isolated from GD20 fetuses exposed in utero to vehicle (control) or to 117, 234, 469, or 938 mg/kg/day of DEHP were maintained for up to 3 days in culture. The media were collected each day and replaced by fresh media. On Day 2 of culture, the media were collected and replaced by fresh media with or without hCG (50 ng/ml) for one additional day of incubation (Day 3). Testosterone (A) and dihydrotestosterone (B) formation were determined by RIA. Results are shown as the mean ± SEM of steroid levels (ng/testis) measured in testes from the offspring of three independent litters per treatment. *P < 0.05; **P < 0.01.

The production of DHT by cultured GD20 testis fragments was measured to determine whether the decrease in basal testosterone levels could be explained by increased conversion of testosterone to DHT. For all DEHP doses (117–469 mg/kg/day), the basal production of DHT by the testes showed average decreases, not increases as would be expected if, in fact, decreased basal testosterone resulted from the increased conversion of testosterone to DHT (Fig. 4B).

The PND3 offspring were from 4 to 5 days beyond DEHP treatment, whereas GD20 fetuses had been exposed to DEHP via maternal gavage on the day they were killed. Nonetheless, results obtained from PND3 testis fragments of rats exposed in utero to 938 mg/kg/day of DEHP were similar to those found with the GD20 testes. That is, basal testosterone production by the PND3 rat testes was inhibited significantly at each of Days 1 (control, 1028 ± 169 pg/testis; DEHP treated, 374 ± 84 pg/testis), 2 (control, 468 ± 138 pg/testis; DEHP treated, 199 ± 76 pg/testis), and 3 (control, 538 ± 84 pg/testis; DEHP treated, 239 ± 59 pg/testis), indicating a persistence of the effect on basal steroidogenesis several days after the end of acute DEHP exposure.

Effects of In Utero DEHP Exposure on Gene Expression in Testes from the Fetus to the Adult

With the knowledge that basal testosterone production was reduced in DEHP-exposed fetal and neonatal rats and that serum levels of testosterone were reduced in adult rats, we examined DEHP effects on the expression of several genes involved in the production or metabolism of testosterone, genes representative of different differentiation stages of Leydig cells, and two gene markers of Sertoli cells as a comparison. We quantified the mRNA expression levels of these genes by Q-PCR using testes from control and DEHP-exposed rats at GD19, PND3, PND21, and PND60. Testes from the male progeny of three dams per treatment and age were analyzed separately using 18S rRNA as reference. It should be pointed out that the weights of PND21 and PND60 testes did not differ regardless of DEHP treatments and that the overall proportions of germ cells in PND60 testes were similar between control and DEHP-exposed rats (Fig. 2C). Similarly, at PND21, no difference was found in the absolute volumes of all germ cell types present between control and DEHP-exposed rats (data not shown). Taken together, these results indicated that the proportion of RNA per testis corresponding to the Leydig cells was similar in control and DEHP-treated rats.

Given that serum testosterone levels were reduced in response to in utero DEHP exposure, we anticipated that genes with products involved in steroidogenesis also would be reduced. The Q-PCR analysis, however, showed that Cyp11a1 (P450scc) and Cyp17a1 (P450c17) were significantly increased at PND3, PND21, and PND60 in response to in utero DEHP exposure at 469 or 938 mg/kg/day, in contrast to their significant decreases at GD19 (Fig. 5A). Increases in gene expression also were observed in adult testes, but not in those at other ages, for the steroidogenic acute regulatory protein STAR, which is involved in the transfer of cholesterol from the cytosol to the outer mitochondrial membrane. In contrast, mRNA expression of 17β-hydroxysteroid dehydrogenase type 3 (Hsd17b3) was decreased in adult rats in response to DEHP at 469 or 938 mg/kg/day but was increased in testes exposed to 938 mg/kg/day at other ages. The transcript of Translocator Protein 18-kDa (TSPO; also referred to as peripheral-type benzodiazepine receptor), a protein involved in cholesterol transfer into the mitochondria [33], showed a small but nonsignificant increase in adult rats exposed in utero to DEHP but significant increases in fetal and neonatal testes in response to DEHP. The transcripts of two proteins that interact with TSPO, diazepam-binding protein (DBI) and voltage-dependent anion channel (VDAC1), were increased significantly in GD19 testes that had been exposed to 234 mg/kg/day of DEHP, and DBI (but not VDAC1) was increased in DEHP-exposed adult testes at the highest dose. The transcript for P450 aromatase (Cyp19a1), which metabolizes testosterone to estradiol and has been shown to be expressed in Leydig cells as well as in Sertoli and germ cells [34, 35], increased in the adult testis, but only at the highest DEHP dose (938 mg/kg/day), and generally was unaffected by DEHP exposure at other ages.

Fig. 5

Quantitative real-time PCR analysis of the short- and long-term effects of in utero DEHP exposure on gene expression in testis. Changes in mRNA expression of a selected set of genes were followed from GD19 to PND60 in testes from control and DEHP-exposed (234, 469, and 938 mg/kg/day) rats by Q-PCR. Included are Leydig cell genes involved in steroidogenesis expressed (A), Sertoli cell-specific genes (B), and several genes known to be expressed in fetal, immature, or mature Leydig cells. The results were calculated by the ΔCt method using 18S rRNA as an endogenous reference. Results are expressed in a relative unit as the mean ± SEM of the mRNA levels determined in samples obtained from the fetuses or the offspring of three dams per treatment point, with each sample processed in triplicate. *P < 0.05; **P < 0.01.

Because Sertoli cells have been shown to be affected by phthalate exposure, we also examined the expression of two genes expressed by Sertoli cells, sex hormone-binding globulin (Shbg; also referred to as androgen-binding protein [Abp]) and clusterin (Clu; also referred to as testosterone-repressed prostate message 2 [Trpm2]) [36, 37]. As shown in Figure 5B, the two genes showed preferential expression at PND21 and PND60, but little or no change was found in the expression of these genes at any age, suggesting that fetal exposure to DEHP had not altered Sertoli cell function.

To determine whether the DEHP-induced increases in absolute volumes of adult Leydig cells per testis might result from retention of fetal Leydig cells, we determined the mRNA expression levels of patched homolog 1 (Ptch1), a receptor for hedgehog proteins expressed in fetal Leydig cells [38]. The Ptch1 mRNA expression was highest in GD19 testes, as would be expected, and was greatly reduced in PND60 testes. Exposure to DEHP induced a small increase in Ptch1 at PND21 and PND60.

To further evaluate Leydig cell function, several transcripts known to be critical for Leydig cell steroidogenesis and proliferation or to represent specific stages in Leydig cell differentiation were examined by Q-PCR in addition to the genes involved in steroidogenesis. The mRNA expression of Igf1, a gene involved in the differentiation of fetal and postnatal Leydig cells [39, 40], showed a biphasic effect at GD19 in response to DEHP, significantly increasing at 234 mg/kg/day but decreasing at other doses. The mRNA expression of Igf1 showed a significant decrease in PND3 rats exposed to 469 mg/kg/day but no change at older ages. The mRNA expression of the adult Leydig cell marker Ace2 [41] was low at GD19, PND3, and PND21 and then dramatically increased at PND60. Exposure to DEHP significantly increased the mRNA levels of Ace2 at GD19 and PND3 but did not have a consistent effect in adult testis. The mRNA expression of Cebpb, a gene expressed in adult Leydig cells and regulated by LH [42], was significantly increased in response to DEHP exposure at all postnatal ages but showed a biphasic profile at GD19. By contrast, expression of insulin-like 3 (Insl3) mRNA, a marker of fully differentiated fetal and adult Leydig cells [43], decreased significantly in fetal testes exposed to 469 and 938 mg/kg/day of DEHP but increased in testes at older ages.

Discussion

The primary goals of the present study were to identify the short- and long-term effects of fetal exposure to increasing doses of DEHP on testicular steroidogenesis throughout life and to explore possible mechanisms underlying these effects. It should be noted that the DEHP exposures were indirect, through maternal gavage from GD14 to parturition, and that neither the pups nor the dams were treated with DEHP after parturition. Endocrine disruptor effects may occur only early in development, or the effects may be long-lasting. Indeed, the effects of some agents may become apparent only later in life. The issue of whether the effects of a given agent are reversible or permanent clearly is an important one.

The present study showed that in utero DEHP exposure up to a dose of 750 mg/kg/day did not have an adverse effect on litter sizes or on adult body and testis weights, whereas at higher doses, cases of cryptorchidism and testicular atrophy were seen in a small proportion of rats. In agreement with the results of earlier studies [14, 44], in utero exposure to a high dose of DEHP (1250 mg/kg/day) resulted in reduced anogenital distance. In rodents, reduced anogenital distance is considered to be a reliable marker of exposure to antiandrogens [1, 44], which suggests that in utero, DEHP may be functioning as such. This may be significant, because a recent epidemiological study suggested that changes in anogenital distance also might occur in humans in response to exposure to phthalates [25].

Previous studies have reported that DEHP does not accumulate in body tissues but, rather, is eliminated from the body between 3 and 4 days after its last administration [14]. Akingbemi et al. [45] reported that in utero exposure of Long-Evans rats to 100 mg/kg/day of DEHP resulted in reduced testosterone during the neonatal and peripubertal periods, but also that the serum testosterone concentration in PND90 males that had been exposed in utero did not differ from that in controls. Their observations therefore suggested that the early inhibitory effects of DEHP were reversible. In the present study, treatment with higher doses of DEHP (938 or 1250 mg/kg/day) resulted in focal areas of apparent Leydig cell hyperplasia in descended testes of PND60 Sprague-Dawley rats, suggesting the persistence of deleterious effects of DEHP on Leydig cells until PND60. Additionally, morphometric analysis clearly showed a dose-dependent, significant increase in the absolute volume of Leydig cells per testis in DEHP-exposed adult testes starting at 234 mg/kg/day of DEHP. Despite the increased Leydig cell absolute volumes, however, significant reductions, not increases, were found in serum testosterone concentrations in the adult in response to in utero DEHP concentrations of 234 mg/kg/day and higher. No significant change was found at DEHP doses of 117 mg/kg/day and below, similar to the results reported by Akingbemi et al. [45]. Taken together, these results suggest that a threshold DEHP level might exist beyond which the deleterious effects on Leydig cell function become permanent, but the present results do not rule out the possibility that the effects of in utero DEHP ultimately are reversible, but not as early as PND60. The importance of this observation is that reductions in testosterone from early development through early adulthood could lead to highly significant physiological deficits, including the behavioral and other deficits that might occur during early development if the brain is not exposed to adequate androgen levels [46, 47].

To gain insight regarding the mechanism by which in utero DEHP exposure might affect serum testosterone concentrations in the adult, we also examined DEHP dose effects on testosterone production by testes of the fetus and the neonate. Exposure to DEHP inhibited basal testosterone production by the testes of fetal (GD20) rats maintained in organ culture. This inhibition was dose dependent, starting at 117 mg/kg/day. Surprisingly, however, no effect of DEHP was found on hCG-stimulated testosterone production by the GD20 testes except at the highest DEHP dose (938 mg/kg). These results highlight a striking difference between the effects of DEHP exposure on basal and hormone-induced steroid production by GD20, fetal Leydig cells. Gestational Day 20 is a pivotal age in Leydig cell development, because in contrast to Leydig cells in earlier stages of development, the GD20 cells express LH receptor and become LH sensitive [48, 49]. Because both basal and hormone-dependent testosterone production require the same active enzymatic cascade to convert cholesterol to testosterone, the inhibition of basal steroid production by DEHP seems likely to affect the regulation of cholesterol uptake by the cells or the hormone-independent transfer of cholesterol to the mitochondria. Alternatively, it is possible that two different Leydig cell types are present in the fetal testis, one that is LH independent and DEHP sensitive and one that is LH responsive and less sensitive to DEHP. To our knowledge, these possibilities have not yet been examined.

The seemingly anomalous observation of reduced adult testosterone levels, but increased Leydig cell volumes, in response to in utero DEHP exposures is intriguing. Reduced testosterone could have resulted from changes in testosterone metabolism. This, however, does not seem to be the case in the adult, because no significant change was found in circulating estradiol levels of DEHP-exposed rats, indicating that DEHP exposure did not affect the aromatization of testosterone to estradiol. Similarly, DHT production by fetal and neonatal testes decreased with exposure to DEHP, indicating that testosterone metabolism to DHT was unlikely to be the explanation for reduced testosterone at these ages. Despite the finding that occupational exposure to high levels of DEHP resulted in significantly decreased serum-free testosterone without a significant reduction in circulating LH levels [50], one possible, as-yet-untested explanation might be that in utero DEHP in some way affected the ability of adult Leydig cells to respond appropriately to LH, perhaps resulting in reduced testosterone production and, thus, reduced negative feedback and elevated LH levels. This phenomenon, which would result in a low testosterone:LH ratio, has been referred to as “compensated Leydig cell failure” [51, 52]. The increased LH, in turn, might result in Leydig cell hypertrophy.

In view of our results showing DEHP-induced reductions of testosterone production by fetal, neonatal, and adult testes, a decrease in some of the genes involved in steroid synthesis was anticipated. Indeed, previous studies reported that several steroidogenesis-related genes were reduced in fetal testes exposed in utero to 500 mg/kg/day of DBP or DEHP [30, 53, 54]. In the present study, we observed similar effects in fetal testes but strikingly different results in postnatal testes. In fetal testes, significant and dose-dependent decreases in Cyp11a1 and Cyp17a1 mRNA expression were found in response to in utero DEHP exposures. The expressions of Star and Tspo mRNAs in fetal testes did not show significant decreases at any DEHP dose. Substantial variability, however, was found in the effects observed on Star mRNA from dam to dam, indicating that some dams were more sensitive than others to DEHP. Moreover, analysis of GD20 testes fragments exposed in vivo to DEHP showed significant decreases in both STAR and TSPO protein levels in comparison with those in rats exposed to vehicle, indicating overall decreases in STAR and TSPO protein levels in the fetus that were not evident from transcript measurements (data not shown). Both TSPO and STAR have been shown to act in a coordinated manner in steroidogenic cells to support the transport of cholesterol to the mitochondria [55]. Therefore, decreases in STAR and TSPO proteins in DEHP-exposed fetuses, together with decreases in steroidogenic enzymes, might have contributed to the decreased basal testosterone production by DEHP-exposed fetal Leydig cells. These changes, however, did not compromise hormone-induced steroid production by these cells, suggesting that the amounts of STAR and TSPO proteins remaining in the DEHP-exposed fetal testes were sufficient to sustain the increase in cholesterol transport required during hormone-induced steroidogenesis.

Our results concerning reduced Cyp11a1 mRNA expression in the fetus in response to DEHP exposure are in agreement with those of a previous study by Borch et al. [54], which used a longer time of exposure (from GD7 to GD21) than that in the present work to between 10 and 300 mg/kg/day of DEHP. They differ, however, for Cyp17a1 mRNA expression, which was significantly decreased in the present study following exposure to higher DEHP doses but was unchanged in the study by Borch et al. [54], suggesting that higher doses of DEHP might be required to significantly affect Cyp17a1 compared with Cyp11a1.

In contrast to the mRNA decreases seen in DEHP-exposed fetuses, the expression of most steroidogenesis-related genes was significantly increased, not decreased, in adult testes in response to in utero DEHP exposures. This was the case despite decreases in testosterone levels. For example, in the testes of PND60 rats exposed in utero to DEHP, the expressions of Cyp11a1, Cyp17a1, Star, and Tspo were higher than expressions in control rats. This also was true of Cyp11a1, Cyp17a1, and Star at PND3 and of Cyp11a1 and Cyp17a1 at PND21. The only steroidogenesis-related gene that did not follow this pattern was Hsd17b3, which was significantly decreased in DEHP-exposed adult testes, suggesting that Hsd17b3 was regulated differently than the other steroidogenic genes or, alternatively, that it was not exclusively expressed in adult Leydig cells. Importantly, in contrast to the Leydig cells, the absolute volumes of germ and Sertoli cells in the testes of DEHP-exposed adult rats were similar to those in control rats; therefore, the relative contributions of these cells to the RNA extracts were comparable in control and DEHP-exposed rats. This implies that the differences seen in the expression of particular Leydig cells genes between control and DEHP-exposed testes likely were a function of changes in Leydig cell expression. Thus, the unexpected increases in steroidogenic gene expression may reflect increases in the number of Leydig cells or increases in gene expression in individual Leydig cells. The latter is consistent with our results showing increases in the absolute volume of Leydig cells per testis and the appearance of foci of hyperplasia in the testes of in utero DEHP-exposed rats. Previous reports have described similar foci of Leydig cell hyperplasia in fetuses and neonates exposed in utero to DEHP and DBP [24, 27]. Moreover, chronic DEHP exposure from prepuberty to adulthood was shown to result in adult Leydig cell hyperplasia in rats [29]. Insulin-like growth factor-I (IGF1) plays multiple roles in fetal and adult Leydig cell differentiation and proliferation. It has been shown to have a mitogenic effect and to stimulate differentiation and steroidogenesis of LH-independent fetal Leydig cells in rats at GD16.5 [40]. The IGF1 is expressed in progenitor and immature Leydig cells and in Sertoli and germ cells of neonatal and immature rats, and it has been shown to be required for the proliferation and differentiation of the precursor cells of adult Leydig cells [56, 57]. We found that Igf1 mRNA expression was decreased in the testes of GD19 and PND3 rats exposed to 469 and 938 mg/kg/day of DEHP but not in the testes of older rats. Moreover, dose-dependent decreases in IGF1 protein levels were seen in GD20 testes that had been exposed in utero to DEHP (data not shown). We do not know which of the multiple roles played by IGF1 in fetal Leydig cells was affected by the decreases in IGF1 expression following DEHP exposure. That no change in IGF1 expression was found in prepubertal and adult rats suggests that IGF1 represents a short-term rather than a long-lasting molecular target of DEHP exposure.

Two other genes of interest in the evaluation of DEHP effects on Leydig cell functions are Ace2, which codes for a metallopeptidase known to increase at puberty and to be specifically expressed in mature, adult-type rat Leydig cells [41], and Insl3, which codes for a peptide hormone also considered to be a marker of mature Leydig cells [43]. The present work showed that in utero DEHP exposure did not induce increases in testicular Ace2 transcripts in the adult testis but that such exposure did at GD19 and PND3. The Insl3 mRNA expression was increased at postnatal ages but decreased in the fetus by exposure to high doses of DEHP. At present, the role of ACE2 as well as the potential consequences of its premature or excessive expression in fetal Leydig cells remain unknown. By contrast, Insl3 expression has been shown to be essential for testicular descent, and the decreases observed in DEHP-exposed fetuses may be related to the higher occurrence of cryptorchidism in rats exposed to high doses of DEHP. The lack of effect of DEHP on Ace2 and Insl3 expression in the adult contrasted with the increases found in other genes and with the higher proportion of Leydig cells observed in response to DEHP, further suggesting that DEHP might have altered or delayed the maturation process of Leydig cells by affecting certain genes more than others. The identification of such genes might help to explain the reduced testosterone production observed at PND60.

Our findings that genes directly related to Leydig cell steroidogenesis were not decreased in adult testis, but were decreased in the fetal testis, following in utero DEHP exposure indicate that the reduction in adult testosterone production has causes other than a deficiency in the expression of those genes. Thus, the question of identifying the mechanism by which in utero DEHP exposures can result in testicular toxicity that is manifested in the adult remains. In this regard, it remains unclear to what extent the effects of DEHP on Leydig cell steroidogenesis result from direct actions on Leydig cells, indirect actions via the neuroendocrine system, disruption of paracrine signaling (e.g., by testicular growth factors), or combinations of these possibilities. At least two populations of Leydig cells may be affected in utero, whether directly or indirectly, by DEHP: the fetal Leydig cells, which differentiate in rat testes by GD12.5 and produce high levels of testosterone, and the stem cells of adult Leydig cells, which have been shown to be present in the testes shortly after birth [58] and most likely are present in the fetal testes. Further complicating the interpretation of the data is that few, if any, of the fetal Leydig cells are retained in the adult testis and that the stem cells of adult Leydig cells give rise to three separate transitions of cells that have been shown to be involved in the development and differentiation of testosterone-producing adult Leydig cells [54]. The observation that DEHP exposure during gestation results in reduced levels of circulating testosterone in the adult suggests that fetal precursors of adult Leydig cells may be affected by DEHP exposure. Indeed, DEHP exposure might result in the reprogramming of the developmental process of the fetal precursors of adult Leydig cells, leading to a phenotype distinct from the normal adult Leydig cell.

In conclusion, our data suggest that DEHP, when administered during gestation and depending on its dose, can have effects that persist from the neonatal period to adulthood. At this point, it remains unclear whether DEHP might have significant acute or long-term pathophysiological effects with relevance to humans or wildlife at the doses to which humans are exposed. The findings that several phthalates present in the environment and detected in human fluids, such as DEHP and DBP, appear to share target genes and pathways, however, suggest that these compounds could act additively or synergistically on specific organs or cell types to produce deleterious effects.

Acknowledgment

We thank the National Hormone and Pituitary Program (National Institute of Child Health and Human Development, National Institutes of Health) for providing hCG.