Abstract
Progesterone (P4) is unequivocally required to maintain a uterine environment conducive to pregnancy. This study investigated the effects of P4 treatment on expression of selected growth factors (fibroblast growth factor 7 [FGF7], FGF10, hepatocyte growth factor [HGF], and insulin-like growth factors [IGF1 and IGF2]), their receptors (MET, FGFR2(IIIB), and IGF1R), and IGF binding proteins (IGFBPs) in the ovine uterus. Ewes received daily injections of corn oil vehicle (CO) or 25 mg of P4 in vehicle from 36 h after mating (Day 0) to hysterectomy on Day 9 or Day 12. Another group received P4 to Day 8 and 75 mg of mifepristone (RU486, a P4 receptor antagonist) from Day 8 through Day 12. Endometrial FGF10 mRNA levels increased between Day 9 and Day 12 and in response to P4 on Day 9 in CO-treated ewes, which had larger blastocysts, and were substantially reduced in P4+RU486-treated ewes, which had no blastocysts on Day 12. Endometrial FGF7 or HGF mRNA levels were not affected by day or reduced by RU486 treatment, but MET mRNA levels were higher in P4-treated ewes on Day 9 and Day 12. Levels of IGF1, IGF2, and IGF1R mRNA in the endometria were not affected by early P4 treatment. Although stromal IGFBPs were unaffected by P4, levels of IGFBP1 and IGFBP3 mRNA in uterine luminal epithelia were increased substantially between Day 9 and Day 12 of pregnancy in CO-treated ewes and on Day 9 in early P4-treated ewes. Therefore, FGF10, MET, IGFBP1, and IGFBP3 are P4-regulated factors within the endometrium of the ovine uterus that have potential effects on endometrial function and peri-implantation blastocyst growth and development.
Introduction
Blastocyst growth and development in utero require histotroph, which originates from secretions of the uterine luminal epithelium (LE) and glandular epithelium (GE), and selective transport of proteins and nutrients from the maternal circulation [1–4]. Ovarian progesterone (P4) is the steroid hormone responsible for the production and secretion of uterine factors during this critical period [5]. Curiously, P4 receptor (PGR) expression ceases in the uterine LE and then GE during early pregnancy in sheep [6]. This loss of PGR expression is temporally associated with the initiation of a program of epithelial gene expression that is hypothesized to be required for uterine receptivity and for blastocyst survival and growth [5, 7, 8] and occurs in all studied mammals before implantation of the conceptus (embryo/fetus and associated extraembryonic membranes) [6, 9–13]. However, endometrial stromal cells continue to express PGR throughout pregnancy, suggesting that stromal-derived factors regulated by P4 act on the adjacent epithelia as progestamedins to mediate P4 effects on cellular functions [5, 12, 14]. We previously identified fibroblast growth factor 7 (FGF7), FGF10, and hepatocyte growth factor (HGF) as factors produced in the ovine endometrium by PGR-positive uterine stromal cells that have receptors, FGF receptor 2 IIIB (FGFR2(IIIB)), and c-met proto-oncogene (MET) in uterine epithelia and conceptus trophectoderm [15, 16]. Similarly, insulin-like growth factor 1 (IGF1) and IGF2 are expressed predominantly by the stroma, and IGF1 receptor (IGF1R) is expressed in LE, GE, and, to a lesser extent, caruncular stroma and myometrium of the uterus and conceptus trophectoderm [17, 18].
Steroid hormones regulate expression of many growth factors in the endometrium. FGF7 is a paracrine growth factor that regulates epithelial cell proliferation and differentiation [19] and mediates effects of P4 in primate endometria [14]. Like FGF7, FGF10 is a specific mitogen for epithelial cells [20, 21]. HGF is a pleiotropic mesenchymal growth factor that has potent mitogenic, morphogenic, and motogenic activities [22] and regulates human endometrial epithelial cell proliferation and motility [23]. IGF1 and IGF2 possess mitogenic and differentiative properties [24–26]. Available evidence supports the hypothesis that IGF1 is an estromedin with effects on epithelial proliferation in the mouse and human endometrium [27, 28]. The effects of P4 on FGF7, FGF10, HGF, IGF1, and IGF2 expression in the ovine uterus have not been reported to our knowledge, although all of these growth factors are expressed in the stroma and have receptors on the epithelia and conceptus trophectoderm.
The IGF family consists of IGF1, IGF2, and their receptors IGF1R and IGF2R, as well as seven IGF binding proteins (IGFBPs 1–7) that modulate IGF activity and bioavailability [29–32]. IGF1 and IGF2 possess mitogenic and differentiative properties and are implicated in early embryonic and placental development in many species, including humans, rodents, and domestic animals [24–26]. In humans, IGF1R binds IGF1 with high affinity and binds IGF2 with moderate affinity [29]. IGFBPs can enhance and retard IGF actions [33, 34]. IGFBPs 1–6 bind IGFs with high affinity but can be cleaved by proteases to yield free IGF to act on adjacent cells expressing IGF1R. IGFBP proteases include matrix metalloproteinases (MMPs), kallikreins, cathepsins, pregnancy-associated plasma protein A (PAPPA), calpain, and other serine proteases [32]. Collectively, the mechanisms regulating IGF actions involve availability of receptors, abundance of IGFBPs, and activities of available proteases to regulate local concentrations of free IGF. In pigs, the proteolytic cleavage of IGFBPs to yield free IGF occurs in association with elongation of the conceptus [35]. In the cow, IGFBP1 through IGFBP5 are expressed within the endometrium during the peri-implantation period of pregnancy [36]. In fact, blastocyst development in the cow can be stimulated by injections of exogenous growth hormone (GH), which increases IGF1 [37].
We recently reported results from a study [38] of an ovine model of accelerated blastocyst development elicited by advancing the postovulatory rise in circulating levels of P4 during metestrus. This model was based on studies in the cow [39, 40], and recent evidence in dairy cattle indicates that the postovulatory rise in circulating P4 levels modulates pre-implantation blastocyst growth and development [41, 42]. In our sheep studies, P4 treatment was initiated on Day 1.5 after mating, increased blastocyst growth on Day 9, and advanced the transformation from a spherical blastocyst to an elongated filamentous conceptus on Day 12 [38]. As expected, treatment of ewes with RU486, a PGR antagonist, compromised blastocyst survival on Day 12 [38]. The accelerated growth and development of ovine blastocysts by P4 treatment are presumably mediated by changes in endometrial secretions that alter uterine histotroph [8]. In fact, early P4 treatment increased the expression of galectin 15 (LGALS15) and cathepsin L (CTSL) in endometrial LE and superficial GE (sGE) that are secreted into the uterine lumen [38], and it affected paracellular permeability of the endometrial epithelia via alterations in tight and adherens junction components [43]. These studies specifically determined effects of P4 treatment on expression of stromal-derived growth factors in the endometrium, their receptors, and relevant IGFBPs. The results implicate FGF10, MET, IGFBP1, and IGFBP3 in P4 regulation of endometrial epithelial function and pre-implantation blastocyst growth and development.
Materials and Methods
Animals
Mature Suffolk-type ewes (Ovis aries) were observed for estrus (designated Day 0) in the presence of a vasectomized ram and were used in experiments only after exhibiting at least two estrous cycles of normal duration (16–18 days). All experimental and surgical procedures were in compliance with the Guide for the Care and Use of Agriculture Animals in Research and Teaching and were approved by the Institutional Animal Care and Use Committee of Texas A&M University.
Experimental Design
Study 1
Ewes were mated at estrus to intact Suffolk rams and were then assigned randomly to receive daily i.m. injections from Day 1.5 through Day 9 of corn oil vehicle (CO; n = 6) or 25 mg of P4 (n = 6) (Sigma Chemical Co., St. Louis, MO) as described previously [38]. All ewes were hysterectomized on Day 9. Uteri were flushed with 20 ml of sterile 10 mM Tris (pH 7.2) to obtain blastocysts. Sections (∼0.5 cm) from the midportion of each uterine horn ipsilateral to the CL (corpus luteum) were fixed in fresh 4% paraformaldehyde in PBS (pH 7.2). After 24 h, fixed tissues were moved to 70% ethanol for 24 h, dehydrated through a graded series of alcohol to xylene, and then embedded in Paraplast-Plus (Oxford Labware, St. Louis). The remaining endometrium was physically dissected from myometrium, frozen in liquid nitrogen, and stored at −80°C. In monovulatory pregnant ewes, uterine tissue samples were marked as contralateral or ipsilateral to the ovary bearing the CL. No tissues from the contralateral uterine horn were used for further analysis.
Study 2
As described previously [38], ewes were mated at estrus to intact Suffolk rams and were assigned randomly to receive daily i.m. injections of the following: 1) CO from Day 1.5 through Day 12 (n = 8); 2) 25 mg of P4 from Day 1.5 through Day 12 (n = 7); or 3) 25 mg of P4 (Day 1.5 through Day 8) and 75 mg of mifepristone (RU486; Sigma Chemical Co.), a PGR and glucorticoid receptor antagonist [44], from Day 8 through Day 12 (P4+RU486; n = 5). All ewes were hysterectomized on Day 12, and the uteri were processed as described for study 1.
RNA Isolation
Total cellular RNA was isolated from frozen ipsilateral endometrium (studies 1 and 2) using Trizol reagent (Gibco-BRL, Bethesda, MD) according to the manufacturer's instructions. The quantity and the quality of tRNA were determined by spectrometry and by denaturing agarose gel electrophoresis, respectively. Total RNA samples were digested with RNase-free DNase I and were cleaned up using the RNeasy MinElute Cleanup Kit (Qiagen, Valencia, CA).
Real-Time PCR Analysis
Ten-fold serial dilutions (2 μg to 2 ng) of cDNA were synthesized from endometrial tRNA using random primers (Invitrogen, Carlsbad, CA), oligo-dT primers, and SuperScript II Reverse Transcriptase (Invitrogen) as described previously [45]. Newly synthesized cDNA was acid-ethanol precipitated, resuspended in 20 μl of water, and stored at −20°C for real-time PCR analysis. The PCR analysis of FGF7, FGF10, HGF, and 18S rRNA (18S) mRNA was performed using an ABI PRISM 7700 (Applied Biosystems, Foster City, CA) with SYBR Green PCR Master Mix (Applied Biosystems) as the detector according to the manufacturer's recommendations and using methods described previously [46]. To maximize efficiency, primers were designed to amplify cDNA of less than 100 bp (Table 1). The PCR cycle parameters were 50°C for 2 min, 95°C for 10 min, and then 95°C for 15 sec and 60°C for 1 min for 40 cycles. Template input was optimized from serial dilutions of endometrial cDNA for each gene. The final reactions used 20 ng of cDNA for analysis of FGF7, FGF10, and HGF and 2 ng of cDNA for 18S. Data were analyzed using GeneAmp 5700 SDS software (version 1.4; Applied Biosystems). The PCR without template or template substituted with tRNA was used as a negative control to verify experimental results. The threshold line was set in the linear region of the plots above the baseline noise, and threshold cycle (CT) values were determined as the cycle number at which the threshold line crosses the amplification curve.
Primers used for quantitative RT-PCR analysis.
| Amplification target | Forward/reverse primers (5'3')a | Length of amplicon (bp)b | GenBank accession no. |
|---|---|---|---|
| FGF7 | AGTTTGCTCCACAGATCATGCTT TGCTCTGGAGTCATGTCATTGC | 82 | AF239241 |
| FGF10 | GGAAAACGGATACAATACCTATGCA TTTCCATTCAATGCCACATACATT | 77 | AF213396 |
| HGF | TGGTGTTTCACAAGCAATCCA AGGTCATGCATTCAACTTCTGAAC | 78 | AF213397 |
| 18S | CGAACGTCTGCCCTATCAACTT CCGGAATCGAACCCTGATT | 86 | AY753190 |
| Amplification target | Forward/reverse primers (5'3')a | Length of amplicon (bp)b | GenBank accession no. |
|---|---|---|---|
| FGF7 | AGTTTGCTCCACAGATCATGCTT TGCTCTGGAGTCATGTCATTGC | 82 | AF239241 |
| FGF10 | GGAAAACGGATACAATACCTATGCA TTTCCATTCAATGCCACATACATT | 77 | AF213396 |
| HGF | TGGTGTTTCACAAGCAATCCA AGGTCATGCATTCAACTTCTGAAC | 78 | AF213397 |
| 18S | CGAACGTCTGCCCTATCAACTT CCGGAATCGAACCCTGATT | 86 | AY753190 |
Forward and reverse primers do not necessarily indicate the in vivo direction of transcription.
The length of the amplicon created during PCR.
Primers used for quantitative RT-PCR analysis.
| Amplification target | Forward/reverse primers (5'3')a | Length of amplicon (bp)b | GenBank accession no. |
|---|---|---|---|
| FGF7 | AGTTTGCTCCACAGATCATGCTT TGCTCTGGAGTCATGTCATTGC | 82 | AF239241 |
| FGF10 | GGAAAACGGATACAATACCTATGCA TTTCCATTCAATGCCACATACATT | 77 | AF213396 |
| HGF | TGGTGTTTCACAAGCAATCCA AGGTCATGCATTCAACTTCTGAAC | 78 | AF213397 |
| 18S | CGAACGTCTGCCCTATCAACTT CCGGAATCGAACCCTGATT | 86 | AY753190 |
| Amplification target | Forward/reverse primers (5'3')a | Length of amplicon (bp)b | GenBank accession no. |
|---|---|---|---|
| FGF7 | AGTTTGCTCCACAGATCATGCTT TGCTCTGGAGTCATGTCATTGC | 82 | AF239241 |
| FGF10 | GGAAAACGGATACAATACCTATGCA TTTCCATTCAATGCCACATACATT | 77 | AF213396 |
| HGF | TGGTGTTTCACAAGCAATCCA AGGTCATGCATTCAACTTCTGAAC | 78 | AF213397 |
| 18S | CGAACGTCTGCCCTATCAACTT CCGGAATCGAACCCTGATT | 86 | AY753190 |
Forward and reverse primers do not necessarily indicate the in vivo direction of transcription.
The length of the amplicon created during PCR.
Quantification of gene amplification was made following RT-PCR by determining the CT number for reporter fluorescence within the geometric region of the semilog plot generated during the PCR. Within this region of the amplification curve, each difference of one cycle is equivalent to a doubling of the amplified product of the PCR. The relative quantification of gene expression across day and treatments was evaluated using the comparative CT method. The ΔCT value was determined by subtracting the 18S CT value for each sample from the target CT value of that sample. Calculation of ΔΔCT involves using the higher mean ΔΔCT value (day and treatment mean with the lowest gene expression) as an arbitrary calibrator to subtract from all other mean ΔCT values. Fold changes in the relative mRNA levels for each target gene were then determined by assuming an amplification efficiency of two and by applying the equation 2−ΔΔCt for each sample.
In Situ Hybridization Analysis
Location of FGFR2, IGF1, IGF2, IGF1R, IGFBP1, IGFBP2, IGFBP3, IGFBP4, IGFBP5, IGFBP6, IGFBP7, MET, and PAPPA mRNA in the ovine uterus was determined by radioactive in situ hybridization analysis as described previously [47]. Radiolabeled antisense and sense cRNA probes were generated by in vitro transcription using linearized partial plasmid cDNA templates [15, 16, 48], RNA polymerases, and [α-35S]-uridine triphosphate (UTP). Deparaffinized, rehydrated, and deproteinated uterine tissue sections were hybridized with radiolabeled antisense or sense cRNA probes. After hybridization, washing, and ribonuclease A digestion, slides were dipped in NTB-2 liquid photographic emulsion (Kodak, Rochester, NY) and were exposed at 4°C for 5–30 days based on the intensity of radioactive signal of slides placed on MR Kodak film for 16 h. All slides for each respective gene were exposed to photographic emulsion for the same period. Slides were developed in Kodak D-19 developer, counterstained with Gill hematoxylin (Fisher Scientific, Fairlawn, NJ), and dehydrated through a graded series of alcohol to xylene, and coverslips were then affixed with Permount (Fisher Scientific). Images of representative fields were recorded under bright-field or dark-field illumination using a Nikon Eclipse 1000 photomicroscope (Nikon Instruments Inc., Lewisville, TX) fitted with a Nikon DXM1200 digital camera.
Slot-Blot Hybridization Analysis
Steady-state levels of FGFR2, IGF1, IGF2, IGFBP1, IGFBP2, IGFBP3, IGFBP4, PAPPA, IGFBP5, IGFBP6, IGFBP7, and MET mRNA in endometria were assessed by slot-blot hybridization as described previously [47]. Briefly, radiolabeled antisense cRNA probes were generated by in vitro transcription using linearized plasmid templates containing partial cDNA, RNA polymerases, and [α-32P]-UTP. Denatured total endometrial RNA (20 μg) from each ewe in studies 1 and 2 was hybridized with radiolabeled cRNA probes. To correct for variation in tRNA loading, a duplicate RNA slot-blot membrane was hybridized with radiolabeled antisense 18S cRNA (pT718S; Ambion, Austin, TX). Following washing, the blots were digested with ribonuclease A, and radioactivity associated with slots was quantified using a Typhoon 8600 MultiImager (Molecular Dynamics, Piscataway, NJ). Data are expressed as relative units (RU).
Radioimmunoassay
Total IGF1 protein was determined in uterine flushings using an IGF1 RIA kit (Mediagnost, Reutlingen, Germany) according to the manufacturer's instructions. Briefly, uterine flush samples were prepared by acidification with acidification buffer (10:1 uterine flush to buffer). Total counts, standards, nonspecific binding, and quality control samples (duplicate) and unknown samples (triplicate) were then mixed with appropriate reagents in 12 × 75-mm polypropylene tubes. Samples remained at 4°C for 48 h and were centrifuged at 3500 × g for 30 min following addition of appropriate kit components. All tubes except total counts were decanted gently and blotted to remove excess liquid. Tubes were then quick spun to ensure that all precipitates were located at the bottom of the tube and were quantified using a gamma counter. Assay results were calculated using the AssayZap version 3.1 program (Biosoft, Ferguson, CA).
Photomicroscopy
Photomicrographs were taken using a Nikon Eclipse E1000 photomicroscope (Nikon Instruments, Melville, NY). Digital images were captured using a Nikon DXM 1200 digital camera and were assembled using Adobe Photoshop 7.0 (Adobe Systems, Seattle, WA).
Statistical Analysis
Data from RIA, slot-blot hybridization, and real-time PCR analyses were subjected to least-squares analysis of variance using the general linear models procedures of the Statistical Analysis System (SAS Institute Inc., Cary, NC). Slot-blot hybridization data were corrected for differences in sample loading by using the 18S data as a covariate. In all analyses, error terms used in tests of significance were identified according to the expectation of the mean squares for error. Significance (P < 0.05) was determined by probability differences of least-squares means. Data are presented as least-squares means with overall SE.
Results
We previously reported that exogenous injections of P4 beginning on Day 1.5 after mating increased blastocyst diameter 2.2-fold on Day 9 and accelerated the morphological transformation of spherical blastocysts into filamentous conceptuses on Day 12 [38]. In contrast, no blastocysts were found in uteri of ewes treated with P4+RU486 as assessed on Day 12 [38].
FGF7, FGF10, and HGF and Their Receptors
In the ovine uterus, FGF10 and HGF are expressed in the endometrial stroma, and FGF7 is expressed in the tunica media of blood vessels within the endometrium, whereas their receptors (FGFR2(IIIB) and MET) are expressed in endometrial epithelia and conceptus trophectoderm [15, 16]. Semiquantitative real-time PCR analysis was used to measure steady-state levels of FGF7, FGF10, and HGF mRNA in the endometria (Table 2 and Fig. 1). No effects of day or treatment were detected (P > 0.10) on endometrial FGF7 mRNA levels. The abundance of HGF mRNA in the endometria was not affected by day or P4 treatment but was increased slightly (1.8-fold; P < 0.001) in endometria from P4+RU486-treated ewes. In contrast, FGF10 mRNA abundance was 2.5-fold greater (P < 0.01) in the endometria of Day 12 CO-treated ewes compared with Day 9 CO-treated ewes. The levels of FGF10 mRNA were 1.9-fold higher (P < 0.001) in the endometria of P4-treated ewes compared with CO-treated ewes on Day 9 but were not different (P > 0.10) on Day 12. Endometrial FGF10 mRNA levels were reduced 5-fold (P < 0.001) in P4+RU486-treated ewes compared with P4-treated ewes on Day 12.
Fold differences in endometrial abundance of FGF7, FGF10, and HGF mRNA as determined by RT-PCR.
| Treatment | ΔCTa | ΔΔCTb | ||||||
|---|---|---|---|---|---|---|---|---|
| FGF7 | FGF10 | HGF | 18S | FGF7 | FGF10 | HGF | ||
| Day 9 | ||||||||
| CO | 21.84 | 16.80 | 17.98 | 9.12 | −0.22 | −0.93 | 0.00 | |
| P4 | 21.66 | 15.92 | 17.61 | 9.09 | −0.40 | −1.81 | −0.37 | |
| Day 12 | ||||||||
| CO | 21.22 | 15.61 | 17.16 | 9.61 | −0.84 | −2.12 | −0.83 | |
| P4 | 21.75 | 15.48 | 17.83 | 9.59 | −0.31 | −2.25 | −0.16 | |
| P4+RU486 | 22.06 | 17.73 | 17.04 | 9.58 | 0.00 | 0.00 | −0.94 | |
| Treatment | ΔCTa | ΔΔCTb | ||||||
|---|---|---|---|---|---|---|---|---|
| FGF7 | FGF10 | HGF | 18S | FGF7 | FGF10 | HGF | ||
| Day 9 | ||||||||
| CO | 21.84 | 16.80 | 17.98 | 9.12 | −0.22 | −0.93 | 0.00 | |
| P4 | 21.66 | 15.92 | 17.61 | 9.09 | −0.40 | −1.81 | −0.37 | |
| Day 12 | ||||||||
| CO | 21.22 | 15.61 | 17.16 | 9.61 | −0.84 | −2.12 | −0.83 | |
| P4 | 21.75 | 15.48 | 17.83 | 9.59 | −0.31 | −2.25 | −0.16 | |
| P4+RU486 | 22.06 | 17.73 | 17.04 | 9.58 | 0.00 | 0.00 | −0.94 | |
CT, cycle threshold. The cycle number in which amplification crosses the threshold set in the geometric portion of the amplification curve. ΔCT equals target mRNA minus 18S ribosomal CT that is for normalization of PCR cycles for target mRNA with 18S ribosomal RNA.
Mean ΔCT minus highest mean ΔΔT value used to set the baseline for comparing mean differences in ΔΔCT values across all treatment and day combinations.
Fold differences in endometrial abundance of FGF7, FGF10, and HGF mRNA as determined by RT-PCR.
| Treatment | ΔCTa | ΔΔCTb | ||||||
|---|---|---|---|---|---|---|---|---|
| FGF7 | FGF10 | HGF | 18S | FGF7 | FGF10 | HGF | ||
| Day 9 | ||||||||
| CO | 21.84 | 16.80 | 17.98 | 9.12 | −0.22 | −0.93 | 0.00 | |
| P4 | 21.66 | 15.92 | 17.61 | 9.09 | −0.40 | −1.81 | −0.37 | |
| Day 12 | ||||||||
| CO | 21.22 | 15.61 | 17.16 | 9.61 | −0.84 | −2.12 | −0.83 | |
| P4 | 21.75 | 15.48 | 17.83 | 9.59 | −0.31 | −2.25 | −0.16 | |
| P4+RU486 | 22.06 | 17.73 | 17.04 | 9.58 | 0.00 | 0.00 | −0.94 | |
| Treatment | ΔCTa | ΔΔCTb | ||||||
|---|---|---|---|---|---|---|---|---|
| FGF7 | FGF10 | HGF | 18S | FGF7 | FGF10 | HGF | ||
| Day 9 | ||||||||
| CO | 21.84 | 16.80 | 17.98 | 9.12 | −0.22 | −0.93 | 0.00 | |
| P4 | 21.66 | 15.92 | 17.61 | 9.09 | −0.40 | −1.81 | −0.37 | |
| Day 12 | ||||||||
| CO | 21.22 | 15.61 | 17.16 | 9.61 | −0.84 | −2.12 | −0.83 | |
| P4 | 21.75 | 15.48 | 17.83 | 9.59 | −0.31 | −2.25 | −0.16 | |
| P4+RU486 | 22.06 | 17.73 | 17.04 | 9.58 | 0.00 | 0.00 | −0.94 | |
CT, cycle threshold. The cycle number in which amplification crosses the threshold set in the geometric portion of the amplification curve. ΔCT equals target mRNA minus 18S ribosomal CT that is for normalization of PCR cycles for target mRNA with 18S ribosomal RNA.
Mean ΔCT minus highest mean ΔΔT value used to set the baseline for comparing mean differences in ΔΔCT values across all treatment and day combinations.
Effects of treatments with CO, P4, and P4+RU486 on endometrial FGF7, FGF10, and HGF mRNA abundance from Day 9 and Day 12 ewes. The relative mRNA abundance was calculated from the quantitative RT-PCR analysis as described in Materials and Methods. Fold changes in normalized mean CT values for each day and treatment were calculated by assuming an amplification efficiency of two and by applying the equation 2−ΔΔCt for each sample mean ΔΔCT. Comparisons of normalized CT values for each day and treatment were made by orthogonal contrasts. *, Statistical difference (P < 0.05) between indicated day and treatment combinations. Numerical fold increases are depicted. Values with an asterisk for abundance of endometrial mRNA are statistically different (P < 0.05).
MET mRNA levels tended to be higher (P < 0.07) in endometria of P4-treated ewes on Day 9 (Fig. 2B) and were higher (P < 0.05) in P4-treated ewes compared with CO-treated ewes on Day 12. Ewes treated with P4+RU486 had lower (P < 0.04) levels of MET mRNA in their endometria compared with P4-treated ewes. In situ hybridization analysis revealed that MET mRNA was present predominantly in the endometrial LE and was increased in sGE and middle to deep GE of the P4-treated ewes on Day 9 and Day 12. Endometrial FGFR2(IIIB) mRNA levels were not different (P > 0.10) between CO-treated ewes and P4-treated ewes on Day 9 or Day 12, but P4+RU486-treated ewes had higher (P < 0.001) levels of FGFR2(IIIB) mRNA compared with P4-treated ewes on Day 12 (Fig. 2A). FGFR2(IIIB) mRNA was expressed predominantly in LE and GE of the endometrium (Fig. 2B).
Effects of treatments with CO, P4, or P4+RU486 (P4+RU) on endometrial MET and FGFR2 mRNA levels. A) Steady-state levels of MET and FGFR2 mRNA in endometria from Day 9 and Day 12 ewes were determined by slot-blot analysis. MET mRNA tended to be higher (P < 0.07) in P4-treated ewes on Day 9 and was higher (*, P < 0.05) in P4-treated ewes compared with CO-treated ewes on Day 12. P4+RU486-treated ewes had lower (*, P < 0.05) MET mRNA compared with P4-treated ewes on Day 12. FGFR2 mRNA levels were not different (P > 0.10) between CO-treated ewes and P4-treated ewes on Day 9 or Day 12, but P4+RU486-treated ewes had higher (*, P < 0.001) quantities of FGFR2 mRNA compared with P4-treated ewes on Day 12. B) In situ localization of FGFR2 and MET mRNA in endometria of Day 9 and Day 12 ewes. All representative photomicrographs are shown at the same width of field (840 μm).
IGF1, IGF2, and IGF1R
Steady-state levels of IGF1 mRNA were not different (P > 0.10) in endometria of CO-treated and P4-treated ewes on Day 9 or Day 12, although IGF1 mRNA levels were lower (P < 0.001) in endometria of CO-treated ewes on Day 12 compared with Day 9 (Fig. 3A). IGF1 mRNA was present primarily in caruncular and intercaruncular stroma (Fig. 3B). The pigmented melanocytes appear white under dark-field illumination but do not express IGF1. IGF2 mRNA levels were also not different (P > 0.10) in CO-treated and P4-treated ewes on Day 9; however, IGF2 mRNA levels tended (P < 0.06) to be lower in P4+RU486-treated ewes compared with P4-treated ewes on Day 12 (Fig. 3A). IGF2 mRNA was present in the caruncular and intercaruncular stroma of ewes receiving CO and P4 on Day 9 and Day 12 (Fig. 3A and Supplemental Fig. 1 [available online at www.biolreprod.org]). In situ hybridization analyses revealed that IGF2 mRNA abundance was reduced in intercaruncular stroma from Day 9 through Day 12, but IGF2 mRNA did not decline in caruncular stroma. In contrast, IGF2 mRNA was most abundant in LE of uteri from P4+RU486-treated ewes (Fig. 3B). Steady-state levels of IGF1R mRNA were not affected (P > 0.10) by treatment in either study (Fig. 3A). IGF1R mRNA was present predominantly in LE and GE of the endometrium (Fig. 3B).
Effects of treatments with CO, P4, or P4+RU486 on endometrial IGF1, IGF2, and IGF1R mRNA levels. A) Steady-state levels of IGF1, IGF2, and IGF1R mRNA in endometria from Day 9 and Day 12 ewes as determined by slot-blot analysis. IGF1, IGF2, and IGF1R mRNA levels were not different (P > 0.10) between P4-treated ewes and CO-treated ewes on Day 9 or Day 12. Endometrial IGF1 mRNA levels decreased (P = 0.0002) from Day 9 through Day 12. The P4+RU486-treated ewes tended to have less (P < 0.06) IGF2 mRNA than P4-treated ewes. B) In situ localization of IGF1, IGF2, and IGF1R mRNA in endometria of Day 9 and Day 12 ewes. The black melanocytes in the stratum compactum stroma of Day 12 caruncular stroma do not express IGF1 mRNA but appear white in a dark-field photomicrograph. Car, caruncle; S, stroma. All representative photomicrographs are shown at the same width of field (560 μm).
IGF1 Protein Levels Within the Uterine Flush
A radioimmunoassay was used to detect IGF1 protein in uterine flushings following removal of IGFBPs by acidification. Total IGF1 was approximately 2-fold less (P < 0.001) in the uterine lumen of P4-treated ewes on Day 9 (Fig. 4) but was not different (P > 0.10) in the uterine lumen of Day 9 compared with Day 12 CO-treated ewes or between P4-treated ewes and CO-treated ewes on Day 12.
Effects of treatments with CO, P4, or P4+RU486 on total IGF1 protein in uterine flushings determined by radioimmunoassay following acidification of sample to remove IGFBPs. Total IGF1 protein was reduced (*, P = 0.0007) in uteri from P4-treated ewes on Day 9 but was unaffected by treatments on Day 12.
Stromal IGFBPs
Seven IGFBPs have been determined to modulate IGF bioavailability [32]. Steady-state levels of IGFBP mRNA in endometria are shown in Figure 5, and results of in situ hybridization analyses are shown in Figures 6 and 7 and in Supplemental Figure 1. IGFBP2, IGFBP4, IGFBP5, IGFBP6, and IGFBP7 mRNAs were present primarily in stroma of intercaruncular endometria (Figs. 6 and 7) and in the caruncles (Supplemental Fig. 1). IGFBP5 mRNA was also detected in LE on Day 9, and IGFBP4, IGFBP5, and IGFBP7 mRNA was present to some extent in the smooth muscle of blood vessels within the endometrium (Supplemental Fig. 1).
Steady-state levels of endometrial IGFBP2, IGFBP4, IGFBP5, IGFBP6, IGFBP7, and PAPPA mRNA after treatments with CO, P4, or P4+RU486 on Day 9 and Day 12 as determined by slot-blot analysis. IGFBP5 was reduced (*, P < 0.01) in endometria from P4-treated ewes compared with CO-treated ewes on Day 9. IGFBP2, IGFBP5, and IGFBP7 mRNA levels were higher (*, P < 0.02), (*, P < 0.0001), and (*, P < 0.001), respectively, in endometria from P4+RU486-treated ewes compared with P4-treated ewes on Day 12. IGFBP6 mRNA levels were decreased (*, P < 0.03) in endometria from P4-treated ewes compared with CO-treated and P4+RU486-treated ewes on Day 12.
In situ localization of IGFBP2, IGFBP4, and IGFBP5 mRNA in endometria from ewes treated with CO, P4, or P4+RU486 on Day 9 and Day 12. All representative photomicrographs are shown at the same width of field (560 μm). S, stroma.
In situ localization of IGFBP6, IGFBP7, and PAPPA mRNA in endometria from ewes treated with CO, P4, or P4+RU486 on Day 9 and Day 12. The black melanocytes in the stratum compactum stroma of Day 12 endometria do not express IGFBP6 mRNA but appear white in a dark-field photomicrograph. BV, blood vessel; Mel, melanocyte; and S, stroma. All representative photomicrographs are shown at the same width of field (560 μm).
Endometrial IGFBP2 mRNA levels were not different (P > 0.10) between CO-treated ewes and P4-treated ewes on Day 9 or Day 12 or between Day 9 and Day 12 in CO-treated ewes; however, IGFBP2 mRNA levels were 2-fold higher (P < 0.02) in P4+RU486-treated ewes compared with P4-treated ewes on Day 12 (Fig. 5). The levels of IGFBP4 and its known protease, PAPPA, in the endometrium were unaffected (P > 0.10) by P4 on Day 9 or Day 12 and did not differ between Day 9 and Day 12 for CO-treated ewes. IGFBP5 mRNA levels were 1.6-fold lower (P < 0.01) in P4-treated ewes on Day 9 but were not different (P > 0.10) between CO-treated ewes and P4-treated ewes on Day 12 or between Day 9 and Day 12 for CO-treated ewes. However, IGFBP5 mRNA levels were 3-fold higher (P < 0.0001) in P4+RU486-treated ewes compared with P4-treated ewes. IGFBP6 mRNA levels were not different (P > 0.10) between CO-treated ewes and P4-treated ewes on Day 9 but were lower (P < 0.03) in P4-treated ewes compared with CO-treated and P4+RU486-treated ewes on Day 12. IGFBP6 mRNA levels did not differ (P > 0.10) on Day 9 and Day 12 for CO-treated ewes. IGFBP7 mRNA levels did not differ (P > 0.10) between CO-treated ewes and P4-treated ewes on Day 9 or Day 12; however, they were 2-fold higher (P < 0.001) in endometria of P4+RU486-treated ewes compared with P4-treated ewes on Day 12. IGFBP7 mRNA levels tended to be lower (P < 0.07) in endometria of CO-treated ewes on Day 12 compared with Day 9.
In intercaruncular endometria, IGFBP5 mRNA abundance was low in LE on Day 9, was undetectable by Day 12 in CO-treated ewes, but was detectable in caruncular stroma (Fig. 6 and Supplemental Fig. 1). IGFBP5 mRNA increased in stroma and myometrium of P4+RU486-treated ewes on Day 12. IGFBP7 mRNA was also localized to the myometrium in CO-treated ewes on Day 9 and was decreased in P4-treated ewes (data not shown). IGFBP2, IGFBP4, IGFBP6, and PAPPA mRNA levels were low to undetectable in myometria (data not shown).
IGFBP1 and IGFBP3 in the Uterine LE
In situ hybridization analyses revealed that IGFBP1 and IGFBP3 mRNAs were expressed specifically in LE and sGE of the intercaruncular endometria (Fig. 8A) and in LE of the caruncles (Supplemental Fig. 1). Endometrial IGFBP1 mRNA levels increased 28-fold (P < 0.0002) from Day 9 through Day 12 in CO-treated ewes. Although IGFBP1 mRNA levels were 9-fold higher (P < 0.02) in P4-treated ewes on Day 9 (Fig. 8B), there was no difference (P > 0.10) in IGFBP1 mRNA levels between CO-treated ewes and P4-treated ewes on Day 12. Furthermore, IGFBP1 mRNA levels were 10-fold lower (P < 0.0001) in endometrium of P4+RU486-treated ewes compared with P4-treated ewes on Day 12. Similarly, IGFBP3 mRNA levels increased 6.4-fold (P < 0.03) in endometria of CO-treated ewes between Day 9 and Day 12 (Fig. 8A). IGFBP3 mRNA levels were 3-fold higher (P < 0.005) in P4-treated ewes on Day 9 but were not different (P > 0.10) between P4-treated ewes and CO-treated ewes on Day 12. IGFBP3 mRNA was reduced 2-fold (P < 0.03) in P4+RU486-treated ewes compared with P4-treated ewes on Day 12.
Effects of treatments with CO, P4, or P4+RU486 on endometrial IGFBP1 and IGFBP3 mRNA levels. A) Steady-state levels of IGFBP1 and IGFBP3 mRNA in endometria from Day 9 and Day 12 ewes increased (*, P < 0.002) and (*, P < 0.005), respectively, in P4-treated ewes compared with CO-treated ewes on Day 9 but not on Day 12. IGFBP1 and IGFBP3 mRNA levels increased (P < 0.0002) and (P < 0.03), respectively, in endometria of CO-treated ewes on Day 12 compared with Day 9. IGFBP1 and IGFBP3 mRNA levels were lower (*, P < 0.0001) and (*, P < 0.03), respectively, in endometria from P4+RU486-treated ewes compared with P4-treated ewes on Day 12. B) In situ localization of IGFBP1 and IGFBP3 mRNA in endometria from ewes on Day 9 and Day 12. All representative photomicrographs are shown at the same width of field (560 μm).
Discussion
Results of these studies provide evidence that advancing the postovulatory increase in circulating concentrations of P4 on Day 1.5 after mating stimulated expression of FGF10 in endometria of ewes assessed on Day 9 but not on Day 12 after mating; moreover, endometrial FGF10 mRNA was more abundant on Day 12 than on Day 9 of pregnancy. Inhibition of P4 effects with RU486, a PGR antagonist, decreased FGF10 mRNA; however, FGF7, HGF, IGF1, and IGF2 mRNA levels were unaffected by RU486 treatment. To our knowledge, these results provide the first evidence that stromal-derived FGF10 is a bona fide progestamedin in the endometrium of the ovine uterus. Presumably, FGF10 mediates P4 actions on PGR-negative uterine epithelia that express their receptors, and the upregulation of FGF10 by early P4 treatment coincided with a P4-induced decline in PGR protein levels in uterine LE and sGE [38]. Similarly, several other epithelial genes, including CST3, CTSL, LGALS15, and HIF2A [49], as well as IGFBP1 in the present study, are induced in endometrial LE and sGE in concert with loss of detectable PGR expression. In fact, onset of expression of those genes seems to require exposure of the uterus to P4 for 8–10 days and loss of PGR expression from those epithelia [50–53]. It is not known if these genes are regulated directly by FGF10 in uterine LE and sGE. In the human uterus, FGF10 is expressed by decidual cells and by cytotrophoblasts during all three trimesters and is implicated in mesenchymal-trophoblast interactions that are important for regulation of villous development [54]. FGF10 enhances trophoblast invasion and mediates the process of branching morphogenesis of the chorionic villous tree in humans [55]. In cattle, FGFR2(IIIB) was found to be expressed in immature trophoblast giant binucleate cells and was hypothesized to mediate their differentiation in response to FGF7 from the uterus or from the conceptus [56]. The process of synepitheliochorial placentation in sheep involves the removal of the endometrial LE by the trophoblast giant binucleate cells that begin to differentiate on Day 14 and Day 15, and little LE is left in the caruncular or intercaruncular area of the endometrium by Day 25 [7, 57]. Therefore, P4-stimulated stromal-derived FGF10 may regulate functions of endometrial epithelia and trophectoderm growth and differentiation in sheep (Fig. 9).
Summary and working hypothesis. Ovarian P4 acts on PGR-positive endometrial stroma to specifically increase FGF10 expression, which acts via FGFR2(IIIB) on the PGR-negative LE and sGE; P4 also increases epithelial MET receptor for stromal-derived HGF. In addition, IGF1 and IGF2 from the stroma act on epithelial IGF1R. Collectively, the stromal-derived growth factors (FGF10 and HGF, as well as IGF1 and IGF2) are hypothesized to regulate epithelial gene expression and secretory function. During early pregnancy, IGFBP1 and IGFBP3 expression is initiated by P4 within the uterine LE and sGE between Day 9 and Day 12 of pregnancy. Those IGFBPs are then secreted into the uterine lumen, where they regulate IGF1, and perhaps IGF2, bioavailability and are hypothesized to stimulate trophectoderm proliferation. Moreover, IGFBP1 contains an RGD integrin binding and activation domain that likely stimulates trophectoderm migration and, perhaps, differentiation. Collectively, the actions of P4 initiate a cascade of gene expression events in stroma, epithelia, and trophectoderm that are important for uterine receptivity, blastocyst elongation, and formation of a filamentous conceptus during the pre-implantation period of pregnancy.
Although HGF mRNA in the endometrium was unaffected by day of pregnancy and P4 treatment, MET mRNA was increased by P4 treatment primarily in GE present in the upper to middle portions of the endometrium on Day 9 and Day 12. MET is also upregulated in the endometria of cyclic cattle during the luteal phase [58] and on Day 18 of pregnancy [59]. HGF regulates morphology and function of a number of different epithelial cell types [22] and regulates human endometrial cell proliferation and motility [23]. Decreases in epithelial junctional complexes occur in several forms of cancer in response to HGF actions on MET-beta catenin (CTNNB1) complexes [60, 61]. A decrease in adherens junctions increases the invasive properties of cells. We recently reported a transient reduction in CTNNB1 and cadherin (CDH1) in the endometrial LE and sGE from Day 9 early P4-treated ewes [43], which coincides with the MET receptor increase in ewes treated to Day 9 with early P4 administration in the present study. The reductions in CDH1 and CTNNB1 comprising the adherens junctions, along with a decline in tight junction complexes, are hypothesized to increase the permeability of uterine LE and sGE to stromal-derived or serum-derived factors such as glucose, amino acids, ions, and growth factors, resulting in an increase in histotroph nutrients required for peri-implantation blastocyst survival, growth, and development [43]. Moreover, MET is expressed in the trophectoderm of the ovine conceptus [15, 16], suggesting potential actions of uterine stromal-derived HGF on the trophectoderm, particularly as the uterine LE is assimilated and replaced by the trophoblast giant binucleate cells.
The IGF system has a critical role in the development of many organs during prenatal and postnatal life [62]. In the present study, IGF1 was expressed predominantly in endometrial stroma and was not affected by early P4 treatment, although IGF1 mRNA levels decreased in stroma of the intercaruncular and caruncular endometria between Day 9 and Day 12 of pregnancy. In contrast, IGF2 mRNA levels were unaffected by day of pregnancy or by early P4 treatment. The presence of IGF1 and IGF2 mRNA in the uterine stroma during pregnancy suggests a more classic epitheliomesenchymal role for these IGFs within the endometrium via IGF1R in the uterine LE and GE [27]. In mice and humans, available evidence supports the hypothesis that IGF1 regulates the effects of estrogen on epithelial proliferation in the endometrium [27, 28]. The induction of IGF2 mRNA in uterine LE and sGE of P4+RU486-treated ewes suggests that P4 actions suppress IGF2 expression in uterine epithelia. In addition to actions within the endometrium, IGF1 and IGF2 are components of uterine luminal histotroph in sheep and cattle and may regulate blastocyst growth and development [18, 36, 63]. Ovine and bovine pre-implantation embryos [25], as well as Day 15 elongated bovine conceptuses, express IGF1R [64]. Indeed, IGF1 stimulates proliferation and inhibits apoptosis as assessed using in vitro cultured bovine embryos [65]. Although IGF1 mRNA levels did not differ in endometria of early P4-treated ewes on Day 9, total IGF1 protein levels in the uterine lumen were 50% lower in early P4-treated ewes on Day 9 but not on Day 12. It is possible that Day 9 represents a critical period during which the developing blastocyst has unrestricted access to free IGF before upregulation of epithelial IGFBP1 and IGFBP3 between Day 9 and Day 12 and that the reduction in total IGF1 protein results from rapid utilization by the blastocyst. Indeed, blastocysts recovered from early P4-treated ewes were larger than those in CO-treated ewes on Day 9 [38]. Access of the blastocyst to IGF1 in the uterine lumen may be mitigated by the upregulation of IGFBP1 and IGFBP3 in the uterine LE and sGE between Day 9 and Day 12 of pregnancy. In the present study, the procedure used to measure IGF1 in the uterine flush evaluated free and bound IGF1 and may not have accurately determined IGF1 bioavailability. Administration of bovine GH to lactating dairy cattle enhanced pregnancy rates by stimulating conceptus growth and production of interferon tau, the pregnancy recognition signal in ruminants, via alterations in the IGF system [66–68]. In those studies, injections of bovine GH elicited an increase in serum IGF1. Previous research indicated that IGF2 in ovine uterine luminal fluid increased from Day 10 through Day 14 of pregnancy [63]. Recent studies found that IGF2 stimulated ovine trophectoderm cell migration [18], a process hypothesized to be critical for blastocyst elongation and formation of a filamentous conceptus [7]. Therefore, IGF1 and IGF2 in the uterine lumen may be derived from systemic and local sources and likely influence endometrial function and blastocyst growth and development.
IGFBP1 through IGFBP6 have been previously identified in the ovine uterus during early pregnancy [17, 26, 69–72]. In the present study, IGFBP2, IGFBP4, IGFBP5, IGFBP6, and IGFBP7 were predominantly expressed in the stroma. Most of those IGFBPs were increased in ewes receiving the RU486 PGR antagonist, suggesting that P4 decreases expression of those stromal IGFBPs. In contrast, IGFBP1 and IGFBP3 were expressed specifically within the endometrial LE and sGE, were increased substantially between Day 9 and Day 12 of pregnancy in CO-treated ewes, were upregulated in early P4-treated ewes assessed on Day 9, and were decreased substantially in endometria of ewes receiving the RU486 antagonist. The induction of IGFBP1 and IGFBP3 in the uterine LE and sGE between Day 9 and Day 12 of pregnancy is associated with a loss of detectable PGR expression [6]. Similarly, early P4 administration decreases PGR expression specifically in the uterine LE and sGE [38], which was associated with accelerated onset of IGFBP1 and IGFBP3 expression in the present study, as well as of LGALS15, another P4-induced gene in the uterine LE and sGE of sheep [38, 50, 73]. In our study, IGFBP1 and IGFBP3 expression was substantially decreased in Day 12 ewes receiving P4+RU486 treatment. PGR protein levels were higher in endometrial stroma and GE but were not different from those in LE and sGE of uteri from P4+RU486-treated ewes [38]. Therefore, progestamedins such as FGF10 [15] may be required for P4 to induce or maintain expression of selected genes such as IGFBP1, IGFBP3, CTSL, CST3, and LGALS15 in the uterine LE and sGE [49]. In addition to being an antiprogestin, RU486 is a high-affinity antagonist of the glucocorticoid receptor (GR) [44], suggesting that GR may also regulate gene expression in the uterine LE and sGE. However, little is known about GR expression and glucorticoid effects within the ovine uterus during early pregnancy.
In sheep, early P4 treatment beginning on Day 1.5 after mating increased blastocyst growth on Day 9 and advanced the transformation from a spherical blastocyst to an elongated filamentous conceptus on Day 12; furthermore, treatment of ewes with RU486 compromised blastocyst survival on Day 12 [38]. Results presented herein and elsewhere [72] suggest that endometrial IGFBP1 and IGFBP3 mediate effects of P4 on blastocyst growth and development (Fig. 9). Limited information exists about the presence of these binding proteins in the uterine lumen; however, IGFBP3 is the predominant IGFBP in the uterine lumen during early pregnancy in sheep and cattle [36, 74]. Treatment of ovariectomized ewes with P4 for 10 days resulted in the proteolysis of IGFBP3 in the uterine lumen, which would theoretically increase bioactive IGF available to the blastocyst [74]; however, treatment of ovariectomized ewes with P4 for 15 days decreased protease activity via apparent upregulation of an unidentified protease inhibitor. Of particular note, CTSL is a P4-stimulated and interferon tau-stimulated protease expressed in the endometrial LE and GE of the ovine uterus that may act as an IGFBP protease [51]. Furthermore, MMP2 and MMP9 and their inhibitors, tissue inhibitors of MMPs, are secretory products of the ovine endometrium that increase from Day 12 through Day 20 and may regulate IGFBP cleavage [75, 76]. Other IGFBPs have been detected in the uterine lumen of sheep and cattle [36, 74]; however, those studies did not identify IGFBP1 in uterine flushings. In contrast, expression of IGFBP1 in the uterine LE and sGE was regulated by early P4 treatment in the present study. The lack of IGFBP1 in uterine flushings may be attributed to an inability to discriminate specific bands on a ligand blot or to misinterpretation of results due to the presence of a number of proteolytic fragments of other IGFBPs, coupled with a lack of available IGFBP-specific antibodies for ruminant species.
Despite markedly different implantation schemes among primates, rodents, and ruminants, IGFBP1 is upregulated in the endometrium during early pregnancy and is implicated as a regulator of blastocyst implantation and placental growth and development in all of those different species [77]. In humans, IGFBP1 is a highly upregulated gene in the human secretory endometrium during the period of receptivity to implantation [78] and is localized to the endometrial LE, a subpopulation of stromal cells, and the decidua [79, 80]. Similarly, IGFBP1 is the primary secretory product of baboon decidua and is stimulated by chorionic gonadotropin, the pregnancy recognition signal [81]. In addition to IGF ligand binding, IGFBP1 contains a conserved Arg-Gly-Asp (RGD) sequence that can act as a ligand for the integrin heterodimer α5β1 [82, 83]. Blocking antibodies against the α5β1 integrin subunits inhibited trophoblast cell migration [84], and IGFBP1-stimulated migration of trophoblast cells is attenuated by mutation of the RGD integrin binding sequence to Trp-Gly-Asp or by pretreatment with an inhibitory peptide [83]. In sheep, the α5 and β1 integrin subunits are constitutively expressed on the surface of uterine LE and sGE and conceptus trophectoderm [85], which supports the hypothesis that IGFBP1 from the uterine LE can stimulate migration and adhesion of trophectoderm cells to the uterine LE during the attachment phase of implantation. Indeed, the induction and stimulation of IGFBP1 in the uterine LE by day of pregnancy and by early P4 treatment correlate with the onset of blastocyst growth and developmental elongation to form a filamentous conceptus [7, 8, 38]. Therefore, IGFBP1 may have a central role in mediating conceptus-endometrial interactions required for blastocyst elongation and implantation in sheep and cattle [86] (Fig. 9). Collectively, the results presented herein provide a foundation to begin determining the biological roles of endometrial-derived growth factors (FGF10, HGF, IGF1, and IGF2) and IGFBPs (particularly IGFBP1 and IGFBP3) in endometrial function and blastocyst growth and development, using the sheep as a model system.
Acknowledgments
We thank the members of the Laboratory for Uterine Biology and Pregnancy for assistance and for management of animals. We also are grateful to Drs. Robert C. Burghardt and Greg A. Johnson for helpful discussions.
References
Author notes
Supported by National Research Initiative Competitive Grant 2005-35203-16252 from the United States Department of Agriculture Cooperative State Research, Education, and Extension Service.
Current address: Department of Physiology, Southern Illinois University School of Medicine, Carbondale, Illinois 62901.
