Abstract

Recent studies demonstrate that age-related dysfunction of NF-E2–related factor-2 (Nrf2)–driven pathways impairs cellular redox homeostasis, exacerbating age-related cellular oxidative stress and increasing sensitivity of aged vessels to oxidative stress–induced cellular damage. Circulating levels of insulin-like growth factor (IGF)-1 decline during aging, which significantly increases the risk for cardiovascular diseases in humans. To test the hypothesis that adult-onset IGF-1 deficiency impairs Nrf2-driven pathways in the vasculature, we utilized a novel mouse model with a liver-specific adeno-associated viral knockdown of the Igf1 gene using Cre-lox technology (Igf1f/f + MUP-iCre-AAV8), which exhibits a significant decrease in circulating IGF-1 levels (∼50%). In the aortas of IGF-1–deficient mice, there was a trend for decreased expression of Nrf2 and the Nrf2 target genes GCLC, NQO1 and HMOX1. In cultured aorta segments of IGF-1–deficient mice treated with oxidative stressors (high glucose, oxidized low-density lipoprotein, and H2O2), induction of Nrf2-driven genes was significantly attenuated as compared with control vessels, which was associated with an exacerbation of endothelial dysfunction, increased oxidative stress, and apoptosis, mimicking the aging phenotype. In conclusion, endocrine IGF-1 deficiency is associated with dysregulation of Nrf2-dependent antioxidant responses in the vasculature, which likely promotes an adverse vascular phenotype under pathophysiological conditions associated with oxidative stress (eg, diabetes mellitus, hypertension) and results in accelerated vascular impairments in aging.

Over three quarters of deaths from cardiovascular diseases occur among people older than the age of 65 years (1). The mechanisms by which aging promotes the development of atherosclerotic vascular diseases (including myocardial infarction, stroke, vascular dementia; for a recent review, see (1)) are likely multifaceted. Previous studies in laboratory rodents and nonhuman primates provide ample evidence that oxidative stress develops with age in the arterial system, which impairs endothelial function and promotes vascular inflammation (2). In addition, there is emerging evidence that increasing age renders the vasculature more prone to oxidative insult elicited by diabetes mellitus, hypertension, and other risk factors related to lifestyle (eg, obesity, hypercholesterolemia, smoking (1)) likely by impairing cellular oxidative stress resistance.

Several lines of evidence suggest that the evolutionarily highly conserved stress-activated cap’n’collar transcription factor Nrf2 (nuclear factor [erythroid-derived 2]-like 2) has an important role in regulating the aging process by orchestrating the transcriptional response of cells to oxidative stress (3). Recent studies provide strong evidence that in young animals, activation of the Nrf2 pathway has a critical role in vasoprotection under pathophysiological conditions associated with increased production of reactive oxygen species (ROS; ie, metabolic diseases (4,5)). Under nonoxidative stress conditions, Nrf2 interacts with Keap1, a cytosolic repressor protein that limits Nrf2-mediated gene expression. The Keap1-Nrf2 complex constitutes a sensor of oxidative stress, which, when dissociated, triggers expression of genes mediated by the antioxidant response element (ARE) to restore the cellular redox status. In endothelial and smooth muscle cells of young animals in which the system is functional, Nrf2 is released from Keap1 in response to oxidative stress and translocates to the nucleus, where it activates ARE-dependent transcription of phase II and antioxidant defense enzymes, including NAD(P)H:quinone oxidoreductase 1 (NQO1, a key component of the plasma membrane redox system) and γ-glutamylcysteine ligase (GCLC, the rate-limiting enzyme for GSH synthesis), heme oxygenase-1 (HMOX-1), catalase, glutathione peroxidase, and that of peroxiredoxins, all of which participate in attenuating cellular oxidative stress. Previous studies demonstrated that although there is a significant age-dependent increase in cellular ROS production in aged animals (6,7), an adaptive Nrf2/ARE-driven antioxidant response fails to manifest in the aged vasculature (8,9). Recent studies by our laboratories (9) and others (10) demonstrate that aging in blood vessels of laboratory rodents and nonhuman primates is associated with Nrf2 dysfunction, which likely exacerbates age-related cellular oxidative stress and ROS-induced cellular injury in aging. Moreover, age-accelerated atherosclerosis correlates with failure to upregulate Nrf2-driven antioxidant genes (10). Despite their high relevance to cardiovascular pathophysiology in the elderly human, the mechanisms responsible for Nrf2 dysfunction in aging are currently unknown.

In recent years, an increasing body of evidence became available, suggesting that in addition to cell autonomous changes in the gene expression signature, noncell autonomous endocrine mechanisms also have an important role in age-related cardiovascular alterations. In particular, whether reduced insulin-like growth factor (IGF)-1 levels are directly associated with an age-related decline in cardiovascular physiological function remains a seminal question (11,12,13). In aging, hepatic production of IGF-1 significantly declines both in humans and in laboratory animals (14,15,16). There is ample clinical and experimental evidence that IGF-1 exerts positive effects on cardiovascular function and cardiovascular mortality (12,17,18,19,20,21,22,23,24,25) and is atheroprotective (26,27). Importantly, our recent studies in IGF-1–deficient Ames dwarf mice (28) and Lewis dwarf rats (29) demonstrate that low circulating IGF-1 levels are associated with impaired expression/activity of antioxidant enzymes in the vasculature, leading to increased vascular oxidative stress and endothelial dysfunction (28). Yet, the association between IGF-1 deficiency, Nrf2 dysfunction, and impaired vascular oxidative stress resistance is not well understood.

We postulate that if circulating IGF-1 is a key regulator of vascular oxidative stress resistance, then isolated endocrine IGF-1 deficiency should mimic the aging phenotype, impairing Nrf2 activity and rendering the vasculature sensitive to oxidative stressors. However, until now, this hypothesis was difficult to test as currently used animal models of IGF-1 deficiency have several disadvantages. First, the available models often exhibit other complex endocrine defects (ie, chronic growth hormone [GH], thyroid-stimulating hormone, and/or prolactin deficiency). Second, IGF-1 deficiency generally is present during development in these animal models, which results in dwarfism and/or altered metabolism. Third, there is increasing evidence that circulating (liver-derived, endocrine) and locally derived (paracrine) IGF-1 has unique physiological roles (26,27,30,31,32,33,34,35,36,37). Importantly, alterations in the paracrine IGF-1 system in animals with complex endocrine defects and/or with developmental IGF-1 deficiency are not well understood. Because aging is primarily characterized by a decline in circulating IGF-1, animal models of isolated endocrine IGF-1 deficiency should be used to mimic the aging phenotype.

The present study was designed to elucidate the effects of low circulating IGF-1 levels on vascular function and phenotype using a novel mouse model of adult-onset isolated endocrine IGF-1 deficiency induced by adeno-associated viral knockdown of IGF-1 specifically in the liver of post-pubertal mice using Cre-lox technology. Using this model, we tested the hypothesis that adult-onset endocrine IGF-1 deficiency decreases vascular expression of Nrf2 and Nrf2 target genes and impairs vascular resistance to oxidative stress challenges, mimicking the aging phenotype.

METHODS

Postdevelopmental Liver-Specific Knockdown of Igf1 in Mice

Adeno-associated viral knockdown of Igf1 specifically in the liver of postpubertal mice was achieved using Cre-lox technology. In brief, male mice homozygous for a floxed exon 4 of the Igf1 gene (Igf1f/f) were developed in a mixed 129Sv and C57BL/6 background (38). Briefly, these mice have the entirety of exon 4 of the Igf1 gene flanked by loxP sites, which allows for genomic excision of this exon when exposed to Cre recombinase. Transcripts of the altered Igf1 gene yield a protein upon translation that fails to bind the IGF receptor. The line was generated in embryonic stem cells from 129Sv mice, correctly targeted clones were injected into C57BL/6 blastocysts, and chimeric males were bred to C57BL/6 females. The line at the University of Oklahoma Health Sciences Center (OUHSC) was rederived at Charles River Laboratories in a C57BL/6 background for maintenance of the colony in a specific pathogen–free rodent barrier facility. Animals were bred to homozygosity and housed in the Rodent Barrier Facility at OUHSC on a 12-hour light/12-hour dark cycle and given access to standard rodent chow (Purina Mills, Richmond, IN) and water ad libitum. All procedures were approved by the Institutional Animal Care and Use Committee of OUHSC.

To specifically target hepatocytes, pseudotyped AAV2/8 viruses were packaged with a major urinary protein (MUP)-iCRE transgene cassette consisting of the MUP promoter and iCre, a codon-optimized Cre recombinase gene (39). Although AAV8 is effective at transducing multiple tissues after intravenous delivery, including liver, the MUP promoter restricts expression solely to hepatocytes. Control viruses encoding enhanced green fluorescent protein (eGFP) were also generated (MUP-eGFP-AAV8). Viruses were packaged according to a triple transfection protocol described previously (39). Briefly, the viruses were produced using AAV2 plasmids containing AAV2 inverted terminal repeats flanking a transgene cassette consisting of the MUP promoter, the gene of interest (iCre or eGFP), and an intron polyadenylation sequence derived from SV40. Triple transfection of AAV-293 cells with these plasmids, an AAV2/8 rep/cap plasmid (producing AAV2 replicase and AAV8 capsid), and pHelper plasmid (Stratagene, La Jolla, CA) were used to package the virus. Cells were harvested 72 hours after transfection, and clarified viral lysates were obtained. Lysates were titred by real-time polymerase chain reaction (PCR) and stored at −80°C. At 4 months of age, mice were anesthetized with ketamine and xylazine (100 mg/kg/15 mg/kg, respectively) and given retro-orbital injections of 1.5 × 1010 particles of either MUP-iCre-AAV8 or MUP-eGFP-AAV8 diluted in saline for a total injection volume of 100 μL per animal. Dosages were determined empirically in preliminary studies. Hepatocyte specificity of intravenously administered MUP-AAV8 vectors has been previously demonstrated (39).

Measurement of Circulating IGF-1 Levels

Submandibular venous blood was collected into microcentrifuge tubes using a sterile lancet (Medipoint, Mineola, NY) according to the manufacturer’s instructions. Whole blood was centrifuged at 2500g for 20 minutes at 4°C to collect serum, which was then stored at −80°C. Serum was processed for enzyme-linked immunosorbent assay of IGF-1 (R&D Systems, Minneapolis, MN) according to the manufacturer’s protocol. Serum IGF-1 levels are reported in nanograms per milliliter. An IGF-1 control sample, with aliquots stored at −80°C, was included on each plate.

Vessel Isolation and Functional Studies

Mice with liver-specific knockout of Igf1 and the respective controls (termed “Igf1f/f + MUP-iCre-AAV8” and “control,” respectively) were sacrificed (after overnight fasting, between 8 and 10 AM) by decapitation 7 months after the viral transfection. The aortas were isolated, and endothelial function was assessed by measuring relaxation of aortic ring preparations in response to acetylcholine as previously described (40). In brief, an aorta ring segment 2 mm in length was isolated from each animal and mounted on 40 μm stainless steel wires in myograph chambers (Danish Myo Technology A/S, Inc., Denmark) for measurement of isometric tension. The vessels were superfused with Krebs buffer solution (118 mM NaCl, 4.7 mM KCl, 1.5 mM CaCl2, 25 mM NaHCO3, 1.1 mM MgSO4, 1.2 mM KH2PO4, and 5.6 mM glucose; at 37°C; gassed with 95% air and 5% CO2). After an equilibration period of 1 hour during which an optimal passive tension was applied to the rings (as determined from the vascular length–tension relationship), relaxation of precontracted (by 10−6 mol/L phenylephrine) vessels to acetylcholine (ACh; from 10−9 to 10−6 mol/L) was obtained.

Measurement of Vascular ROS Production

H2O2 production in aorta segments was measured fluorometrically using the Amplex Red/horseradish peroxidase assay as described (41). The rate of H2O2 generation was assessed by measuring resorufin fluorescence for 60 minutes by a Tecan Infinite M200 plate reader. A calibration curve was constructed using H2O2, and the production of H2O2 in the samples was expressed as picomoles of H2O2 released per minute, normalized to tissue wet weight.

Determination of Endogenous Glutathione and Ascorbate Using High-Performance Liquid Chromatography Electrochemical Detection

Concentrations of redox-active GSH and ascorbate were measured in aorta homogenates using a Perkin-Elmer high-performance liquid chromatography equipped with an eight-channel amperometric array detector as described (29,42). In brief, 10 mg aliquots of tissue samples were washed with ice-cold phosphate-buffered saline and homogenized in 5% (w/v) metaphosphoric acid. Samples were centrifuged at 10,000g for 10 minutes to sediment protein, and the supernatant fraction was stored for analysis of redox-sensitive compounds. Precipitated proteins were dissolved in 0.1 N NaOH and stored for protein determination by a spectrophotometric quantitation method using BCA reagent (Pierce Chemical Co., Rockford, IL). Concentrations of GSH and ascorbic acid in supernatant fractions were determined by injecting 5 μL aliquots onto an Ultrasphere 5 u, 4.6 × 250 mm C18 column and eluting with mobile phase of 50 mM NaH2PO4, 0.05 mM octane sulfonic acid, and 1.5% acetonitrile (pH 2.62) at a flow rate of 1 mL/min. The detectors were set at 200, 350, 400, 450, 500, 550, 600, and 700 mV, respectively. Peak areas were analyzed using ESA, Inc. software, and concentrations of GSH and ascorbate are reported as nanomoles per milligram of protein.

Quantitative Real-Time Reverse Transcription–PCR

A quantitative real-time reverse transcription (RT)–PCR technique was used to analyze messenger RNA (mRNA) expression of Gpx1, Cat, Nrf2 and the Nrf2/ARE target genes Nqo1, Hmox1, and Gclc, as well as components of the paracrine IGF-1 system (Igf1, Igf1r, Igfbp1, Igfbp3, Igfbp4, Igfbp5) in the aorta as previously reported (6,7,43,44). In brief, total RNA was isolated with a Mini RNA Isolation Kit (Zymo Research, Orange, CA) and was reverse transcribed using Superscript III RT (Invitrogen, Carlsbad, CA) as described previously (7,45). A real-time RT-PCR technique was used to analyze mRNA expression using a Strategen MX3000 as reported (45). Amplification efficiencies were determined using a dilution series of a standard vascular sample. Quantification was performed using the efficiency-corrected ΔΔCq method. The relative quantities of the reference genes Ywhaz, B2m, Hprt, and Actb were determined, and a normalization factor was calculated based on the geometric mean for internal normalization. Oligonucleotides used for quantitative real-time RT-PCR are listed in Table 1. Fidelity of the PCR reaction was determined by melting temperature analysis and visualization of the product on a 2% agarose gel.

Table 1.

Oligonucleotides for Real-Time Reverse Transcription–Polymerase Chain Reaction

Messenger RNA Targets Description Sense Antisense 
Nrf2 NF-E2-related factor 2 (Nfe2l2) GTGCTCCTATGCGTGAATC CGACAGGGAATGGAATATGG 
Cat catalase CGCAATTCACACCTACAC CATCCAGCGTTGATTACAG 
Nqo1 NAD(P)H:quinone oxidoreductase 1 ATGAAGGAGGCTGCTGTAG AGATGACTCGGAAGGATACTG 
Gclc glutamate–cysteine ligase, catalytic subunit1 AGCATCTGGAGAACTAATGACTG CAAGTAACTCTGGACATTCACAC 
Igf1 insulin-like growth factor 1 (somatomedin C) CCTATCGGTGTCTCTGTA AATGTGCGTTGTAATCCA 
Igf1r insulin-like growth factor 1 receptor AGAACAAACTGGTAACAAA TTCAACAACGGTATCTTG 
Igfbp1 insulin-like growth factor binding protein 1 GCCAACGAGAACTCTATA CACTGTTTGCTGTGATAA 
Igfbp2 insulin-like growth factor binding protein 3 TGTATTTATATTTGGAAAGAGA CCTAACATCTCTAACACTTCATCT 
Igfbp4 insulin-like growth factor binding protein 4 CTTCCAAGAGTGAGACCT CTACAACCCCAGAGCATA 
Igfbp5 insulin-like growth factor binding protein 5 GCCTCTCTTCCCTGTTAG GAGTCTGTGAAGTGGTGAA 
Hmox1 heme oxygenase 1 CTGTGAACTCTGTCCAATG AACTGTGTCAGGTATCTCC 
Hprt hypoxanthine phosphoribosyltransferase 1 TGCTGCGTCCCCAGACTTTTG AGATAAGCGACAATCTACCAGAGG 
B2m Beta-2-microglobin CGGTCGCTTCAGTCGTCAG CAGTTCAGTATGTTCGGCTTCC 
Ywhaz tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide1 ACTGTCTTGTCACCAACCATTC GGGCTGTAGAGAGGATGAGG 
Actb beta actin CCGTAAAGACCTCTATGCCAACAC GGGGCCGGACTCATCG 
Messenger RNA Targets Description Sense Antisense 
Nrf2 NF-E2-related factor 2 (Nfe2l2) GTGCTCCTATGCGTGAATC CGACAGGGAATGGAATATGG 
Cat catalase CGCAATTCACACCTACAC CATCCAGCGTTGATTACAG 
Nqo1 NAD(P)H:quinone oxidoreductase 1 ATGAAGGAGGCTGCTGTAG AGATGACTCGGAAGGATACTG 
Gclc glutamate–cysteine ligase, catalytic subunit1 AGCATCTGGAGAACTAATGACTG CAAGTAACTCTGGACATTCACAC 
Igf1 insulin-like growth factor 1 (somatomedin C) CCTATCGGTGTCTCTGTA AATGTGCGTTGTAATCCA 
Igf1r insulin-like growth factor 1 receptor AGAACAAACTGGTAACAAA TTCAACAACGGTATCTTG 
Igfbp1 insulin-like growth factor binding protein 1 GCCAACGAGAACTCTATA CACTGTTTGCTGTGATAA 
Igfbp2 insulin-like growth factor binding protein 3 TGTATTTATATTTGGAAAGAGA CCTAACATCTCTAACACTTCATCT 
Igfbp4 insulin-like growth factor binding protein 4 CTTCCAAGAGTGAGACCT CTACAACCCCAGAGCATA 
Igfbp5 insulin-like growth factor binding protein 5 GCCTCTCTTCCCTGTTAG GAGTCTGTGAAGTGGTGAA 
Hmox1 heme oxygenase 1 CTGTGAACTCTGTCCAATG AACTGTGTCAGGTATCTCC 
Hprt hypoxanthine phosphoribosyltransferase 1 TGCTGCGTCCCCAGACTTTTG AGATAAGCGACAATCTACCAGAGG 
B2m Beta-2-microglobin CGGTCGCTTCAGTCGTCAG CAGTTCAGTATGTTCGGCTTCC 
Ywhaz tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide1 ACTGTCTTGTCACCAACCATTC GGGCTGTAGAGAGGATGAGG 
Actb beta actin CCGTAAAGACCTCTATGCCAACAC GGGGCCGGACTCATCG 

Western Blotting

To analyze protein expression of Nrf2 and the Nrf2 targets NQO1 and GCLC, Western blotting was performed as described (41) using the following primary antibodies: rabbit anti-Nrf2 (Abcam, Cambridge, MA, ab31163, 1:1000 5% milk), rabbit anti-GCLC (Abcam, ab41463, 1 μg/mL in 5% milk), and rabbit anti-NQO1 (Abcam, ab34173, 1:2000 in 5% milk). All polyvinylidene difluoride membranes were incubated in primary antibodies overnight at 4°C. A donkey anti-rabbit secondary antibody was used (Abcam, ab16284; 1:2000 in 5% milk). Mouse anti-β-actin (Abcam, ab6276, 1:10,000 in 5% milk) and Coomassie staining were used for normalization purposes.

Organoid Culture

Aorta segments isolated from mice with hepatic IGF-1 deficiency and control mice were maintained in organoid culture (for 24 hours) as previously described (44). Vessels were treated with H2O2 (from 10−6 to 10−4 mol/L), high glucose (30 mmol/L, which effectively increases mitochondrial H2O2 generation (46)), or oxidized low-density lipoprotein (LDL; 40 μg/mL, which elicits endothelial oxidative stress). At the end of the culture period, nuclear Nrf2-binding activity, mRNA expression of Nrf2 target genes, cellular antioxidant capacity, acetylcholine-induced vasorelaxation, and relative increases in apoptosis were assessed.

Nuclear Extraction and Nrf2-Binding Activity Assay

Nuclei were isolated from cultured aorta segments using the Nuclear Extraction kit from Active Motif (Carlsbad, CA). In brief, the vessels were homogenized with a dounce tissue homogenizer in 500 μL ice-cold hypotonic lysis buffer followed by two centrifugation steps (500g, for 30 seconds, 4°C) to exclude tissue debris. Then, nuclear proteins (∼10 μg per vessel segment) were extracted according to the manufacturer's protocol. Protein concentrations in samples were equalized using a Bradford protein assay (Bio-Rad). Using the nuclear extract obtained, Nrf2-binding activity was assayed using the TransAM Nrf2 ELISA kit (Active Motif) according to the manufacturer's guidelines.

Cellular Antioxidant Capacity

To compare the capacity of cellular antioxidant systems to counterbalance the deleterious effects of oxidative stress in cultured aorta segments, we assessed the hydroxyl radical antioxidant capacity (HORAC) and oxygen radical absorbance capacity (ORAC) using the OxiSelect HORAC Activity Assay (Cell Biolabs) and the OxiSelect ORAC Activity Assay (Cell Biolabs Inc., San Diego, CA) as reported (47). The HORAC Activity Assay is based on the oxidation-mediated quenching of a fluorescent probe by hydroxyl radicals produced by a hydroxyl radical initiator and Fenton reagent. The ORAC Activity Assay is based on the oxidation of a fluorescent probe by peroxyl radicals produced by a free radical initiator. Antioxidants present in cells delay the quenching of the fluorescent probe until the antioxidant activity in the sample is depleted. The antioxidant capacity of the cells was calculated on the basis of the area under the fluorescence decay curve compared with an antioxidant standard curve obtained with gallic acid (for HORAC) or the water-soluble vitamin E analog Trolox (for ORAC), respectively. Sample protein concentration was used for normalization purposes.

Assessment of O2· production

Production of O2· in the wall of cultured aorta segments exposed to high glucose and oxLDL was determined using dihydroethidium (DHE), an oxidative fluorescent dye, as previously reported (29). In brief, vessels were incubated with DHE (3 × 10−6 mol/L; at 37°C for 30 minutes). The vessels were then washed three times, embedded in OCT medium and cryosectioned. Red fluorescent images were captured at 10× magnification and analyzed using the Metamorph imaging software as reported (28). Three entire fields per vessel were analyzed with one image per field. The mean fluorescence intensities of DHE-stained nuclei in the endothelium and medial layer were calculated for each vessel. Thereafter, the intensity values for each animal in the group were averaged.

Apoptotic Cell Death

To compare cellular resistance with oxidative stress in cultured aorta segments of hepatic IGF-1–deficient mice and vessels of control mice, increases in the rate of apoptosis in response to treatment with high glucose or H2O2 (10−4 mol/L, for 24 hours) were assessed. The vessels were homogenized in lysis buffer, and cytoplasmic histone-associated DNA fragments, which indicate apoptotic cell death, were quantified by the Cell Death Detection ELISAPlus kit (Roche Diagnostics Corporation, Indianapolis, IN) as described (40,48). To visualize apoptotic cells in the vascular wall, terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay was performed on frozen aorta sections as reported (48). Propidium iodide was used for nuclear counterstaining. As an additional measure, caspase 3 activity, which is also a useful measure of apoptosis, was measured as reported (40) using the Caspase-Glo 3/7 assay system (Promega, Madison, WI). Luminescent intensity was measured using an Infinite M200 plate reader and were normalized to the sample protein concentration.

Assessment of the Effects of IGF-1 on the Transcriptional Activity of Nrf2 in Cultured Human Coronary Artery Endothelial Cells

In order to assess the direct effects of IGF-1 on endothelial Nrf2 signaling, human coronary artery endothelial cells (CAEC; Cell Applications, Inc., San Diego, CA; after Passage 4; age of the donors is unknown) were cultured in 96-well plates as described (28). The control medium contained 5% heat-inactivated serum. The cells were treated with IGF-1.

The effect of recombinant IGF-1 (200 ng/mL, for 24 hours) on Nrf2 activity in CAECs was assessed using a reporter gene assay as described (4,5,9). We used an ARE reporter comprised of tandem repeats of the ARE transcriptional response element upstream of firefly luciferase (SA Biosciences, Frederick, MD) and a renilla luciferase plasmid under the control of the CMV promoter (as an internal control). Transfections in CAECs were performed using the Amaxa Nucleofector technology (Amaxa, Gaithersburg, MD) as we have previously reported (4,5,9). Firefly and renilla luciferase activities were assessed after 24 hours using the Dual Luciferase Reporter Assay Kit (Promega) and a Tecan Infinite M200 plate reader. The effect of recombinant IGF-1 (200 ng/mL, for 24 hours) on mRNA expression of Nqo1, Hmox1, and Gclc was assessed by quantitative real-time PCR.

In separate experiments, CAECs were triple transfected with a Nrf2-lucifierase reporter plasmid, a pRL Renilla Luciferase control vector (Promega), and one of the following plasmids expressing the wild-type human Akt1 or a dominant negative mutant form of Akt1 (Biomyx Human AKT1 ProteGene set; Biomyx, San Diego, CA): (a) pMEV2HA-AKT1-WT (A1010a; wild type), (b) pMEV2HA-AKT1-K179A (A1010b; K179A: AAG→GCG, no kinase activity), (c) pMEV2HA-AKT1-AA (A1010d; T308A: ACC→GCC; S473A: TCC→GCC, no kinase activity). Twenty hours after transfection, the cells were treated with or without IGF-1 (500ng/mL) for 4 hours. Firefly and renilla luciferase activities were assessed as described earlier.

Assessment of the Effects of IGF-1–Deficient Sera on oxLDL-Induced Changes in Nrf2 Activation, Expression of Nrf2 Target Genes, and O2· Production in Cultured Human Coronary Artery Endothelial Cells

CAECs were grown in 96-well plates in the presence of sera derived from Igf1f/f + MUP-iCre-AAV8 and control mice. Then, the cells were treated with oxLDL (40 μg/mL, for 24 hours). The effects of oxLDL on Nrf2 activity and mRNA expression of Nqo1 and Hmox1 were assessed using a reporter gene assay and by quantitative real-time PCR, respectively (see above). oxLDL-induced changes in cellular O2· production in cultured CAECs were assessed by flow cytometry using the redox-sensitive fluorescent dye dihydroethidium (DHE, 3x10−6 mol/L, for 30 minutes) as previously reported (5,42,49). The data are presented as relative oxLDL-induced changes in geometric mean intensity of DHE fluorescence, normalized to the respective mean fluorescence intensities obtained in cells grown in the absence of oxLDL in the presence of the same serum.

Data Analysis

Gene expression data were normalized to the respective control mean values. Statistical analyses of data were performed by one-way analysis of variance or by two-way analysis of variance followed by the Tukey post hoc test, as appropriate. p < .05 was considered statistically significant. Data are expressed as means ± SEM, unless otherwise indicated.

Results

Serum IGF1 Levels and Body Weight

IGF1 levels were measured in serum before and after the experimental period. Figure 1A shows that at the end of the experimental period, mice receiving MUP-iCre-AAV8 had significantly lower serum IGF1 levels compared with those receiving MUP-eGFP-AAV8. Both groups had similar serum IGF-1 levels prior to administration of liver-targeted viruses. The body mass of the control and experimental groups was similar throughout the experimental period (Table 2).

Table 2.

Body Mass, Body Composition, and Fed Glucose Levels in Hepatic IGF-1–Deficient and Control Mice at the End of the Experimental Period*

 Body Mass (g) Fat % Lean % Glucose (mg/dL) 
Igf1f/f + MUP-iCre-AAV8 30.4 ± 0.92. 12.7 ± 0.81. 56.6 ± 0.89. 172.6 ± 6.84. 
Control (Igf1f/f + MUP-eGFP-AAV8) 32.0 ± 0.69. 13.3 ± 0.75. 56.3 ± 0.79. 182.5 ± 7.57. 
 Body Mass (g) Fat % Lean % Glucose (mg/dL) 
Igf1f/f + MUP-iCre-AAV8 30.4 ± 0.92. 12.7 ± 0.81. 56.6 ± 0.89. 172.6 ± 6.84. 
Control (Igf1f/f + MUP-eGFP-AAV8) 32.0 ± 0.69. 13.3 ± 0.75. 56.3 ± 0.79. 182.5 ± 7.57. 

Notes: IGF = insulin-like growth factor.

*

Data are mean ± SEM. No statistically significant differences were observed.

Figure 1.

A: Serum insulin-like growth factor (IGF)-1 protein levels in mice with hepatic IGF-1 knockdown (Igf1f/f + MUP-iCre-AAV8, initiated at 5 months of age and assessed at 11 months of age) and control (Igf-1f/f + MUP-eGFP-AAV8) mice. Data are mean ± SEM. *p < .05 versus control (n = 20 in each group). B: Acetylcholine induced relaxation of aorta rings isolated from IGF-1–deficient and control mice. Data are mean ± SEM (n = 4 in each group). C: Production of H2O2 in the aortas of IGF-1–deficient and control mice as assessed by Amplex Red/horseradish peroxidase assay. Data are mean ± SEM (n = 6 in each group). GSH (D) and ascorbate (E) content, determined using high-performance liquid chromatography electrochemical detection, in the aorta of IGF-1–deficient and control mice. Data are mean ± SEM (n = 10 in each group).

Figure 1.

A: Serum insulin-like growth factor (IGF)-1 protein levels in mice with hepatic IGF-1 knockdown (Igf1f/f + MUP-iCre-AAV8, initiated at 5 months of age and assessed at 11 months of age) and control (Igf-1f/f + MUP-eGFP-AAV8) mice. Data are mean ± SEM. *p < .05 versus control (n = 20 in each group). B: Acetylcholine induced relaxation of aorta rings isolated from IGF-1–deficient and control mice. Data are mean ± SEM (n = 4 in each group). C: Production of H2O2 in the aortas of IGF-1–deficient and control mice as assessed by Amplex Red/horseradish peroxidase assay. Data are mean ± SEM (n = 6 in each group). GSH (D) and ascorbate (E) content, determined using high-performance liquid chromatography electrochemical detection, in the aorta of IGF-1–deficient and control mice. Data are mean ± SEM (n = 10 in each group).

Vascular Expression of Components of the Local IGF-1 System

We found that mRNA expression of Igf1, Igf1r, Igfbp1, Igfbp4, and Igfbp5 was unchanged in arteries of Igf1f/f + MUP-iCre-AAV8 mice (data not shown). Expression of Igfbp3 tended to decrease in arteries of Igf1f/f + MUP-iCre-AAV8 mice as compared with controls, yet the difference did not reach statistical significance (data not shown).

Endothelial Function and Vascular Redox Status in Mice With Circulating IGF-1 Deficiency

Acetylcholine-induced vasorelaxation (Figure 1B) and vascular GSH content (Figure 1D) tended to be lower in the aortas of Igf1f/f + MUP-iCre-AAV8 mice as compared with control Igf-1f/f + MUP-eGFP-AAV8 mice, yet these differences did not reach statistical significance. IGF-1 deficiency did not affect significantly basal H2O2 production (Figure 1C) or cellular ascorbate content (Figure 1E) in unstressed aortic segments of Igf1f/f + MUP-iCre-AAV8 mice.

Effects of Circulating IGF-1 Deficiency on Expression of Nrf2 and Nrf2 Target Genes in Mouse Aortas

Expression of Nrf2 mRNA (Figure 2A) was significantly decreased in aortas of Igf1f/f + MUP-iCre-AAV8 mice as compared with controls. Protein expression of Nrf2 protein also tended to decrease in aortas of Igf1f/f + MUP-iCre-AAV8 mice, yet the difference did not reach statistical significance. Although mRNA expression of the Nrf2 target genes Gclc (Figure 3A), Nqo1 (Figure 3B), and Hmox1 (Figure 3C) and catalase (Figure 3D) as well as protein levels of GCLC (Figure 3E) and NQO1 (Figure 3F) also tended to decrease in aortas of Igf-1f/f + MUP-eGFP-AAV8 mice, these differences also did not reach statistical significance.

Figure 2.

Expression of Nrf2 mRNA (A) and protein (B; upper panel: representative Western blots, lower panel: bar graphs are normalized densitometric data) in the aortas of insulin-like growth factor (IGF)-1–deficient (Igf1f/f + MUP-iCre-AAV8) and control (Igf-1f/f + MUP-eGFP-AAV8) mice, assessed by quantitative real-time reverse transcription–polymerase chain reaction and Western blotting, respectively. Data are mean ± SEM. *p < .05 versus control (n = 5–9 in each group).

Figure 2.

Expression of Nrf2 mRNA (A) and protein (B; upper panel: representative Western blots, lower panel: bar graphs are normalized densitometric data) in the aortas of insulin-like growth factor (IGF)-1–deficient (Igf1f/f + MUP-iCre-AAV8) and control (Igf-1f/f + MUP-eGFP-AAV8) mice, assessed by quantitative real-time reverse transcription–polymerase chain reaction and Western blotting, respectively. Data are mean ± SEM. *p < .05 versus control (n = 5–9 in each group).

Figure 3.

Quantitative real-time reverse transcription–polymerase chain reaction data showing messenger RNA expression of Gclc (A), Nqo1 (B), Hmox1 (C), and catalase (D) in the aortas of insulin-like growth factor (IGF)-1 deficient (Igf1f/f + MUP-iCre-AAV8) and control (Igf-1f/f + MUP-eGFP-AAV8) mice. EF: Protein expression of GCLC (E) and NQO1 (F) in the aortas of IGF-1–deficient and control mice. Upper panels: representative Western blots, lower panel: bar graphs are normalized densitometric data. Data are mean ± SEM. *p < .05 versus control (n = 9 in each group).

Figure 3.

Quantitative real-time reverse transcription–polymerase chain reaction data showing messenger RNA expression of Gclc (A), Nqo1 (B), Hmox1 (C), and catalase (D) in the aortas of insulin-like growth factor (IGF)-1 deficient (Igf1f/f + MUP-iCre-AAV8) and control (Igf-1f/f + MUP-eGFP-AAV8) mice. EF: Protein expression of GCLC (E) and NQO1 (F) in the aortas of IGF-1–deficient and control mice. Upper panels: representative Western blots, lower panel: bar graphs are normalized densitometric data. Data are mean ± SEM. *p < .05 versus control (n = 9 in each group).

Effects of IGF-1 on Transcriptional Activity of Nrf2 in CAECs

To determine the effect of IGF-1 on Nrf2 activation, we transiently transfected CAECs with an Nrf2/ARE-driven reporter gene construct and then treated the cells with recombinant IGF-1. A significant increase in luciferase activity compared with the vector control was noted upon stimulation with IGF-1 (Figure 4A). IGF-1 also significantly increased mRNA expression of the known Nrf2 targets Nqo1, Hmox1, and Gclc (Figure 4B and C).

Figure 4.

A: Reporter gene assay showing the effects of recombinant insulin-like growth factor (IGF)-1 (200 ng/mL) on Nrf2/ARE reporter activity in cultured primary human coronary arterial endothelial cells (CAECs). Cells were transiently cotransfected with ARE-driven firefly luciferase and CMV-driven renilla luciferase constructs followed by IGF-1 treatment. Cells were then lysed and subjected to luciferase activity assay. After normalization relative luciferase activity was obtained from four to six independent transfections. Data are mean ± SEM. *p < .05. BD: Effect of IGF-1 on messenger RNA expression of Nqo1, Hmox1, and Gclc in cultured primary CAECs. Data are mean ± SEM (n = 5 in each group). The effects of IGF-1 were significant (p < .05) for each target. E: Effect of IGF-1 on Nrf2/ARE reporter activity in CAECs transfected with plasmids expressing the wild-type human Akt1 (pMEV2HA-AKT1-WT) or a dominant negative mutant form of Akt1 (pMEV2HA-AKT1-K179A, pMEV2HA-AKT1-AA). Data are mean ± SEM (n = 6–8 in each group). *p < .05 versus untreated control, #p < .05 versus respective wild type.

Figure 4.

A: Reporter gene assay showing the effects of recombinant insulin-like growth factor (IGF)-1 (200 ng/mL) on Nrf2/ARE reporter activity in cultured primary human coronary arterial endothelial cells (CAECs). Cells were transiently cotransfected with ARE-driven firefly luciferase and CMV-driven renilla luciferase constructs followed by IGF-1 treatment. Cells were then lysed and subjected to luciferase activity assay. After normalization relative luciferase activity was obtained from four to six independent transfections. Data are mean ± SEM. *p < .05. BD: Effect of IGF-1 on messenger RNA expression of Nqo1, Hmox1, and Gclc in cultured primary CAECs. Data are mean ± SEM (n = 5 in each group). The effects of IGF-1 were significant (p < .05) for each target. E: Effect of IGF-1 on Nrf2/ARE reporter activity in CAECs transfected with plasmids expressing the wild-type human Akt1 (pMEV2HA-AKT1-WT) or a dominant negative mutant form of Akt1 (pMEV2HA-AKT1-K179A, pMEV2HA-AKT1-AA). Data are mean ± SEM (n = 6–8 in each group). *p < .05 versus untreated control, #p < .05 versus respective wild type.

We also examined the role of the protein kinase Akt1 in the effect of IGF-1 in CAECs. Transfection of CAECS with a plasmid expressing a dominant negative form of Akt1 inhibited IGF-1–induced Nrf2 activation (Figure 4D).

Oxidative Stressors Elicit a Blunted Nrf2-Driven Antioxidant Response in Aortas of IGF-1–Deficient Mice

To determine whether reduced IGF-1 leads to Nrf2 dysfunction under cellular stress, we treated cultured aorta segments isolated from Igf-1f/f + MUP-iCre-AAV8 and control Igf-1f/f + MUP-eGFP-AAV8 mice with H2O2 (10−6 mol/L) and high glucose (30 mmol/L). In aortas of control mice, both H2O2 and hyperglycemia elicited substantial upregulation of the Nrf2 target genes Gclc, Nqo1, Hmox1, and catalase, whereas these responses were significantly attenuated in aortas of IGF-1–deficient mice (Figure 5A–D). In accordance with these results, we found that H2O2 significantly increased Nrf2-binding activity in nuclear extracts from aortas of control mice, whereas H2O2-induced Nrf2 translocation to the nuclei was significantly less in aortas of IGF-1–deficient mice (Figure 5E).

Figure 5.

Quantitative real-time reverse transcription–polymerase chain reaction data showing H2O2 (1 μmol/L) and high glucose (30 mmol/L)–induced changes in messenger RNA expression of Gclc (A), Nqo1 (B), Hmox1 (C), and catalase (D) in cultured aorta segments isolated from insulin-like growth factor (IGF)-1–deficient (Igf1f/f + MUP-iCre-AAV8) and control (Igf-1f/f + MUP-eGFP-AAV8) mice. E: H2O2-induced increases in Nrf2-binding activity in nuclear extracts from aorta segments of Igf1f/f + MUP-iCre-AAV8 and control mice. Data are mean ± SEM (n = 9 in each group). *p < .05 versus untreated, #p < .05 versus Igf-1f/f + MUP-eGFP-AAV8.

Figure 5.

Quantitative real-time reverse transcription–polymerase chain reaction data showing H2O2 (1 μmol/L) and high glucose (30 mmol/L)–induced changes in messenger RNA expression of Gclc (A), Nqo1 (B), Hmox1 (C), and catalase (D) in cultured aorta segments isolated from insulin-like growth factor (IGF)-1–deficient (Igf1f/f + MUP-iCre-AAV8) and control (Igf-1f/f + MUP-eGFP-AAV8) mice. E: H2O2-induced increases in Nrf2-binding activity in nuclear extracts from aorta segments of Igf1f/f + MUP-iCre-AAV8 and control mice. Data are mean ± SEM (n = 9 in each group). *p < .05 versus untreated, #p < .05 versus Igf-1f/f + MUP-eGFP-AAV8.

Effects of Treatment With IGF-1–Deficient Serum on oxLDL-Induced Activation of the Nrf2-Driven Antioxidant Response in CAECs

To determine the acute effect of IGF-1 deficiency on the Nrf2-driven antioxidant response, we treated CAECs with sera derived from Igf1f/f + MUP-iCre-AAV8 and control mice. Using a reporter gene assay, a significant decrease in oxLDL-induced Nrf2 activation was noted in CAECs treated with IGF-1–deficient sera (Figure 6A). In CAECs treated with IGF-1–deficient sera, as compared with cells treated with sera from control mice, oxLDL-induced upregulation of Nqo1 and Hmox1 expression (Figure 6B and C, respectively) tended to be decreased, whereas oxLDL-induced ROS production tended to increase (Figure 6D); however, these differences did not reach statistical significance.

Figure 6.

A: Reporter gene assay showing the effects of oxLDL (40 μg/mL) on Nrf2/ARE reporter activity in primary human coronary arterial endothelial cells (CAECs) cultured in the presence of sera derived from Igf1f/f + MUP-iCre-AAV8 or control mice (n = 18–20 in each group). Data are mean ± SEM. *p < .05. BC: Effect of oxLDL on messenger RNA expression of Nqo1 (B) and Hmox1 (C) in primary CAECs cultured in the presence of sera derived from Igf1f/f + MUP-iCre-AAV8 or control mice. Data are mean ± SEM. The differences between the groups are statistically not significant. D: Relative oxLDL-induced increases in O2· production in primary CAECs cultured in the presence of sera derived from Igf1f/f + MUP-iCre-AAV8 or control mice. Cellular O2· levels were assessed by flow cytometry using the redox-sensitive fluorescent dyes dihydroethidium. Data are mean ± SD. The difference between the groups is statistically not significant.

Figure 6.

A: Reporter gene assay showing the effects of oxLDL (40 μg/mL) on Nrf2/ARE reporter activity in primary human coronary arterial endothelial cells (CAECs) cultured in the presence of sera derived from Igf1f/f + MUP-iCre-AAV8 or control mice (n = 18–20 in each group). Data are mean ± SEM. *p < .05. BC: Effect of oxLDL on messenger RNA expression of Nqo1 (B) and Hmox1 (C) in primary CAECs cultured in the presence of sera derived from Igf1f/f + MUP-iCre-AAV8 or control mice. Data are mean ± SEM. The differences between the groups are statistically not significant. D: Relative oxLDL-induced increases in O2· production in primary CAECs cultured in the presence of sera derived from Igf1f/f + MUP-iCre-AAV8 or control mice. Cellular O2· levels were assessed by flow cytometry using the redox-sensitive fluorescent dyes dihydroethidium. Data are mean ± SD. The difference between the groups is statistically not significant.

Circulating IGF-1 Deficiency Impairs the Ability of Vascular Cells to Increase Cellular Antioxidant Capacity in Response to Oxidative Stress Challenge

Endocrine IGF-1 deficiency did not affect significantly ORAC (Figure 7A) or HORAC (Figure 7B) in mouse aortas under baseline conditions. In mice with normal IGF-1 levels, there was a significant adaptive increase in HORAC in response to exposure to H2O2 (10−4 mol/L, for 24 hours), whereas this response was significantly impaired in vessels of the Igf1f/f + MUP-iCre-AAV8 mice (Figure 7A). H2O2 treatment also tended to increase ORAC selectively in mice with normal IGF-1 levels, but this response did not reach statistical significance (Figure 7B).

Figure 7.

Hydroxyl radical antioxidant capacity (HORAC, A) and oxygen radical absorbance capacity (ORAC, B) in aortas from control (Igf-1f/f + MUP-eGFP-AAV8) and Igf1f/f + MUP-iCre-AAV8 mice cultured under control conditions (untreated) or exposed to H2O2 (10−4 mol/L, for 24 hours). Data are mean ± SEM. *p < .05 versus untreated control (Igf-1f/f + MUP-eGFP-AAV8; n = 6 in each group).

Figure 7.

Hydroxyl radical antioxidant capacity (HORAC, A) and oxygen radical absorbance capacity (ORAC, B) in aortas from control (Igf-1f/f + MUP-eGFP-AAV8) and Igf1f/f + MUP-iCre-AAV8 mice cultured under control conditions (untreated) or exposed to H2O2 (10−4 mol/L, for 24 hours). Data are mean ± SEM. *p < .05 versus untreated control (Igf-1f/f + MUP-eGFP-AAV8; n = 6 in each group).

Circulating IGF-1 Deficiency Exacerbates Vascular Oxidative Stress and Endothelial Dysfunction Elicited by High Glucose and oxLDL

Figure 8A depicts representative fluorescent images of cross-sections of DHE-stained aortas isolated from Igf1f/f + MUP-iCre-AAV8 mice and control mice with or without exposure to oxidative stressors. Analysis of nuclear DHE fluorescent intensities indicated that IGF-1 deficiency did not significantly alter O2· production in unstressed aortic segments (Figure 8B). In contrast, when exposed to oxLDL or high glucose, aortas from Igf1f/f + MUP-iCre-AAV8 mice exhibited significantly more O2· production than control vessels (Figure 8B). After treatment with high glucose or oxidized LDL, acetylcholine-induced relaxation in aortas from Igf1f/f + MUP-iCre-AAV8 mice was also significantly impaired compared with vessels from control mice (Figure 8C and D, respectively).

Figure 8.

A: Representative micrographs showing red nuclear dihydroethidium (DHE) fluorescence, representing cellular O2· production, in sections of cultured aortas isolated from control mice (Igf-1f/f + MUP-eGFP-AAV8; left column) and insulin-like growth factor (IGF)-1–deficient mice (Igf1f/f + MUP-iCre-AAV8, right column). Note that both treatment with high glucose (30 mmol/L, for 24 hours) or oxLDL (40 μg/mL, for 24 hours) results in more pronounced increases in nuclear DHE fluorescence in the aortas isolated from IGF-1–deficient mice as compared with control vessels. For orientation purposes, overlay of DHE signal and green autofluorescence of elastic laminae is also shown (original magnification: 20×). Summary data for nuclear DHE fluorescence intensities are shown in B. Data are mean ± SEM. *p < .05 versus untreated, #p < .05 versus Igf-1f/f + MUP-eGFP-AAV8. CD: Effects of treatment with high glucose (30 mmol/L, for 24 hours, C) and oxLDL (40 μg/mL, for 24 hours, D) on acetylcholine-induced relaxation of aorta rings isolated from IGF-1–deficient and control mice. Data are mean ± SEM (n = 4 in each group). *p <0.05 versus Igf-1f/f + MUP-eGFP-AAV8.

Figure 8.

A: Representative micrographs showing red nuclear dihydroethidium (DHE) fluorescence, representing cellular O2· production, in sections of cultured aortas isolated from control mice (Igf-1f/f + MUP-eGFP-AAV8; left column) and insulin-like growth factor (IGF)-1–deficient mice (Igf1f/f + MUP-iCre-AAV8, right column). Note that both treatment with high glucose (30 mmol/L, for 24 hours) or oxLDL (40 μg/mL, for 24 hours) results in more pronounced increases in nuclear DHE fluorescence in the aortas isolated from IGF-1–deficient mice as compared with control vessels. For orientation purposes, overlay of DHE signal and green autofluorescence of elastic laminae is also shown (original magnification: 20×). Summary data for nuclear DHE fluorescence intensities are shown in B. Data are mean ± SEM. *p < .05 versus untreated, #p < .05 versus Igf-1f/f + MUP-eGFP-AAV8. CD: Effects of treatment with high glucose (30 mmol/L, for 24 hours, C) and oxLDL (40 μg/mL, for 24 hours, D) on acetylcholine-induced relaxation of aorta rings isolated from IGF-1–deficient and control mice. Data are mean ± SEM (n = 4 in each group). *p <0.05 versus Igf-1f/f + MUP-eGFP-AAV8.

Circulating IGF-1 Deficiency Exacerbates Oxidative Stress–Mediated Cellular Injury in Mouse Aortas

To further characterize hepatic IGF-1 deficiency–induced alterations in vascular oxidative stress resistance, we assessed sensitivity to apoptosis induced by oxLDL (40μg/mL, for 24 hours) and H2O2 (10−4 mol/L, for 24 hours). We found that in aortas from Igf1f/f + MUP-iCre-AAV8 mice, both oxLDL and H2O2 elicited significantly more apoptosis (as indicated by the greater increases in caspase 3/7 activity) than in control mice (Figure 9A). Analysis of oxLDL and H2O2-induced increases in cytoplasmic histone-associated DNA fragments, which also indicate apoptotic cell death, yielded similar results (Figure 9B). To localize apoptotic cells, we performed TUNEL assay. As shown in Figure 9C under unstressed conditions, the number of apoptotic cells in aortas control and Igf1f/f + MUP-iCre-AAV8 mice were very low. In contrast, oxLDL significantly increased the number of TUNEL positive cells in each layer of the wall of aortas from Igf1f/f + MUP-iCre-AAV8 mice. Analysis of the ratio of TUNEL positive nuclei in the aorta wall (Figure 9D) confirmed that hepatic IGF-1 deficiency sensitized vascular cells to oxLDL-induced cellular injury.

Figure 9.

AB: H2O2- (10−4 mol/L, for 24 hours) and oxLDL (40 μg/mL, for 24 hours)-induced increases in caspase 3/7 activity (A) and cytoplasmic histone-associated DNA fragments (B) in aorta segments isolated from Igf1f/f + MUP-iCre-AAV8 and control (Igf-1f/f + MUP-eGFP-AAV8) mice, indicating an increased rate of oxidative stress–induced apoptosis in insulin-like growth factor (IGF)-1 deficiency. Data are mean ± SEM (n = 8–10 in each group). *p < .05 versus Igf-1f/f + MUP-eGFP-AAV8. C: Representative TUNEL staining of aortas from IGF-1–deficient and control mice, treated with or without oxLDL. Nuclei from apoptotic endothelial and smooth muscle cells exhibit intense green fluorescence. Autofluorescence of elastic laminae (faint green) and nuclear counterstaining (propidium iodide, red) are shown for orientation purposes (original magnification: 20×). D: Apoptotic index (% of TUNEL positive cell nuclei) was significantly increased in the aortas of IGF-1–deficient mice after oxLDL treatment. *p < .05 versus Igf-1f/f + MUP-eGFP-AAV8. Data are mean ± SEM. Ten images per aorta were analyzed.

Figure 9.

AB: H2O2- (10−4 mol/L, for 24 hours) and oxLDL (40 μg/mL, for 24 hours)-induced increases in caspase 3/7 activity (A) and cytoplasmic histone-associated DNA fragments (B) in aorta segments isolated from Igf1f/f + MUP-iCre-AAV8 and control (Igf-1f/f + MUP-eGFP-AAV8) mice, indicating an increased rate of oxidative stress–induced apoptosis in insulin-like growth factor (IGF)-1 deficiency. Data are mean ± SEM (n = 8–10 in each group). *p < .05 versus Igf-1f/f + MUP-eGFP-AAV8. C: Representative TUNEL staining of aortas from IGF-1–deficient and control mice, treated with or without oxLDL. Nuclei from apoptotic endothelial and smooth muscle cells exhibit intense green fluorescence. Autofluorescence of elastic laminae (faint green) and nuclear counterstaining (propidium iodide, red) are shown for orientation purposes (original magnification: 20×). D: Apoptotic index (% of TUNEL positive cell nuclei) was significantly increased in the aortas of IGF-1–deficient mice after oxLDL treatment. *p < .05 versus Igf-1f/f + MUP-eGFP-AAV8. Data are mean ± SEM. Ten images per aorta were analyzed.

Discussion

In this study, we used adult-onset liver-specific knockout of Igf1 to elucidate the effects of isolated endocrine IGF-1 deficiency on vascular function and phenotype. This model is unique as early-life knockouts or null mutations of Igf1 can cause developmental abnormalities and/or lead to compensatory effects not seen in control animals. Moreover, recent studies (50,51) have provided strong evidence that in rodents, levels of IGF-1 during a critical developmental time window influence development of age-related diseases later in life. In contrast, our method generates normally developed animals with adult-onset isolated endocrine IGF-1 deficiency as we knockdown IGF-1 long after puberty. The degree of serum IGF-1 deficiency achieved in Igf1f/f + MUP-iCre-AAV8 mice (Figure 1A) is translationally relevant as it closely mimics the aging phenotype in elderly humans (52). It is known that a paracrine IGF-1 system is present in the vascular wall, which includes locally produced IGF-1, IGF-1R, and multiple binding proteins (53). Because in our model expression of the aforementioned components of the local IGF-1 system was unaltered, we conclude that the vascular paracrine IGF-1 system cannot compensate for deficiency of circulating IGF-1. This conclusion is also supported by the lack of upregulation of local IGF-1 system in aortas of IGF-1–deficient Lewis dwarf rats (29) and in vessels of aged rodents despite the age-related decline in circulating IGF-1 (Csiszar, Sonntag, and Ungvari, unpublished observations, 2010).

Previous studies focused on the deleterious effects of low GH and IGF-1 on systemic cardiovascular risk factors but provided little information on vascular effects directly affected by endocrine IGF-1 deficiency. Here we demonstrate that although there is a trend for decreased endothelium-dependent vasorelaxation (Figure 1B) and lower GSH levels in the aorta of IGF-1–deficient mice, the degree of vascular impairment under unstressed conditions was less than what is usually found in aged animals. Previous studies have demonstrated that biological aging is characterized by significant oxidative stress in vascular cells and marked endothelial dysfunction under baseline conditions in laboratory rodents, nonhuman primates, and elderly human patients (1), suggesting that mechanisms other than endocrine IGF-1 deficiency (eg, cell-autonomous, age-related changes in mitochondrial phenotype) have a predominant role in age-related increases in vascular ROS production.

In contrast, here we demonstrate for the first time that adult-onset endocrine IGF-1 deficiency in mice results in significant impairment of the Nrf2-driven antioxidant response pathway, which is a key regulator of vascular redox homeostasis under stressed conditions. In IGF-1–deficient mice, there was a trend for decreased expression of Nrf2 (Figure 2) and Nrf2 target genes (Figure 3), which mimics the vascular aging phenotype. Indeed, aging is associated with a downregulation of Nrf2 expression in blood vessels of both laboratory rodents and nonhuman primates (9,54). Recently, we also demonstrated downregulation of Nrf2 in the blood vessels of IGF-1–deficient Lewis dwarf rats (29) and decreased expression of Nrf2 target genes in the aorta of Ames dwarf mice (28). It is significant that in the mouse hippocampus, IGF-1 deficiency also results in a ∼40% decline in the mRNA expression of Nrf2 (in the present model, Sonntag et al., unpublished observation, 2011) and Nrf2 target genes (55). Because Nrf2 expression and activity also decrease in the brain of aged mice (56), further studies are warranted to compare the gene expression signatures induced by IGF-1 deficiency and aging in mice in multiple organs. Our results suggest that IGF-1, in addition to regulating Nrf2 signaling at the level of Nrf2 expression, can also directly modulate the transcriptional activity of Nrf2, likely by activating Akt1 (Figure 4).

Importantly, we found that low circulating IGF-1 levels impair the ability of vascular cells to mount an effective Nrf2-driven antioxidant defense upregulating ROS-detoxifying enzymes (Figure 5) and increasing cellular antioxidant capacity (Figure 7) in response to oxidative stress challenges. Our ex-vivo findings on cells treated with IGF-1–deficient sera give further support for this concept (Figure 6). The Nrf2 dysfunction induced by endocrine IGF-1 deficiency directly mimics the vascular aging phenotype in that isolated arteries, and cultured endothelial and smooth muscle cells derived from aged animals also exhibit a dysfunctional Nrf2-driven response under oxidative stress conditions (9,54). Dysregulation of Nrf2 in IGF-1–deficient mice is associated with an impaired ability of vascular cells to withstand diverse oxidative stress challenges, showing the functional relevance of our findings. Specifically, endocrine IGF-1 deficiency exacerbates vascular oxidative stress (Figure 8B) and endothelial dysfunction (Figure 8C and D, respectively) elicited by both hyperglycemia and the proatherogenic stressor oxLDL. Previously, we demonstrated that genetic lack of functional Nrf2/ARE pathway also results in significant increases in vascular ROS levels and exacerbation of endothelial dysfunction in arteries of type 2 diabetic Nrf2−/− mice (5). The finding that IGF-1 deficiency increases vascular sensitivity to multiple stressors, which elicit overproduction of ROS and cellular dysfunction by activating different pro-oxidant mechanisms, supports the concept that IGF-1 deficiency predominantly impairs the cellular oxidative defense pathway(s) that lie downstream from increased ROS production. Overall, our results are in line with the available clinical and experimental evidence, suggesting that IGF-1 deficiency renders the cardiovascular system more vulnerable to the deleterious effects of oxidative stress conditions. For example, even a 20% decline in circulating IGF-1 was reported to significantly increase atherosclerosis progression in ApoE knockout mice fed a Western diet (57). In contrast, infusion of IGF-1 to ApoE-null mice significantly decreases high-fat diet-induced vascular oxidative stress, atherosclerotic plaque progression, and vascular inflammation (27). Overexpression of IGF-1 in vascular smooth muscle cells was also reported to improve atherosclerotic plaque stability (32), likely by preventing cellular oxidative damage.

Recent findings demonstrate that Nrf2-driven free radical detoxification pathways confer significant antiapoptotic effects in vascular endothelial and smooth muscle cells (58). As expected, Nrf2 dysfunction in IGF-1–deficient mice was associated with exacerbation of the proapoptotic effects of oxidative stressors (Figure 9), further substantiating the concept that isolated adult-onset endocrine IGF-1 deficiency impairs vascular oxidative stress resistance. Recent studies investigating resistance to oxidative stress-induced cellular damage in nonvascular cells from rodent models of mixed GH/IGF-1 deficiency yielded controversial results. Even though the Ames dwarf mice show increased resistance to diquat-induced mortality, their livers sustain significantly greater diquat-induced damage than those of normal littermates (59). Similarly, male GH receptor knockout mice are also more susceptible to paraquat toxicity as compared with controls (60). The liver of Ames dwarf mice also appears to be more sensitive to acetaminophen-induced oxidative damage (61). In culture, H2O2-treated primary hepatocytes from Ames dwarf mice show lower viability and a higher rate of apoptosis when compared with peroxide-treated wild-type cells (62). In contrast, fibroblasts derived from Ames and Snell dwarf mice exhibit increased cellular resistance to oxidative stressors (63,64). Contrary to our expectation, we recently found that fibroblasts derived from Lewis dwarf rats exhibit stress response signatures that are markedly different from those in GH/IGF-1–deficient mouse models (49). The available human evidence also strongly support an important role for circulating factors in regulation of cellular oxidative stress resistance. Recent studies by the Longo laboratory clearly show that treatment of cells with sera from IGF-1–deficient patients with GH receptor deficiency significantly increases cellular sensitivity to H2O2-induced apoptosis (65). Interestingly, in cultured aortic segments from wild-type mice, in-vitro treatment with serum from IGF-1–deficient Ames dwarf mice also results in a marked downregulation of antioxidant genes (28). Importantly, unlike model organisms with similar mutations, IGF-1–deficient human patients with GH receptor deficiency appear to live shorter lives and have an elevated cardiac disease mortality (65). Thus, the aforementioned data are consistent with the hypothesis that the effects of endocrine IGF-1 deficiency are unique to specific cell types, species, the age at which the hormonal changes occur, and the concomitant presence of other endocrine deficiencies. We propose that by comparing multiple organs in mouse models of adult-onset endocrine IGF-1 deficiency at different ages, many of the controversies that exist in the field could be resolved.

The mechanisms by which IGF-1 deficiency regulates Nrf2 activity are not fully understood. On ligand binding, the IGF-1 receptor tyrosine kinase initiates multiple signaling cascades, including activation of the phosphatidylinositol 3-kinase (PI3K) pathway and its downstream effectors (ie, Akt1). Our studies provide evidence that in endothelial cells, IGF-1 activates Nrf2 via an Akt1-dependent pathway (Figure 4D). Previous studies also demonstrated that IGF-1 receptor activation inhibits oxLDL-induced apoptosis in vascular smooth muscle cells through the PI3K/Akt signaling pathway (66). Furthermore, antioxidative effects of IGF-1 in a mouse model of atherosclerosis are accompanied by an increased activation of Akt1 in the aorta (27). Because recent evidence links PI3K phosphoryation to activation of Nrf2 (58,67,68), our current working hypothesis is that IGF-1 deficiency impairs PI3K/Akt1-mediated Nrf2 activation, thereby promoting oxidative stress and ROS-mediated cellular injury in vascular endothelial and smooth muscle cells. Further studies are evidently needed to test this hypothesis and dissect the signaling pathways affected by hepatic IGF-1 deficiency in our mouse model. Nrf2 is thought to autoregulate its own expression through an ARE-like element located in the proximal region of its promoter (69); thus, it is possible that downregulation of Nrf2 in IGF-1–deficient mice is secondary to the impaired transcriptional activity of Nrf2.

In conclusion, our studies provide evidence that adult-onset endocrine IGF-1 deficiency impairs the ability of vascular cells to mount an effective Nrf2-dependent antioxidant defense in response to increased levels of ROS, which likely renders the vasculature vulnerable to oxidative stress associated with aging and pathophysiological conditions associated with accelerated vascular aging (eg, metabolic diseases). Further studies are warranted to compare the effects of IGF-1 deficiency initiated at different ages (importantly, in the pre- and postpubertal period) and to dissect the signaling pathways underlying the regulation of Nrf2 pathway by IGF-1 in the vasculature.

FUNDING

This work was supported by grants from the American Diabetes Association (to Z.U.), American Federation for Aging Research (to A.C.), the Oklahoma Center for the Advancement of Science and Technology (to A.C. and Z.U.), the University of Oklahoma College of Medicine Alumni Association (to A.C.), the American Heart Association (A.C.), and the National Institutes of Health (AG031085 to A.C.; AT006526 to Z.U.; AG038747, NS056218, and P01 AG11370 to W.E.S.).

The authors would like to thank Dr. S. Yakar for the Igf-1f/f animals and express their gratitude for the support of the Donald W. Reynolds Foundation, which funds aging research at the University of Oklahoma Health Sciences Center under its Aging and Quality of Life Program.

References

1.
Ungvari
Z
Kaley
G
de Cabo
R
Sonntag
WE
Csiszar
A
Mechanisms of vascular aging: new perspectives
J Gerontol A Biol Sci Med Sci
 , 
2010
, vol. 
65
 (pg. 
1028
-
1041
)
2.
Csiszar
A
Wang
M
Lakatta
EG
Ungvari
ZI
Inflammation and endothelial dysfunction during aging: role of NF-{kappa}B
J Appl Physiol
 , 
2008
, vol. 
105
 (pg. 
1333
-
1341
)
3.
Pearson
KJ
Lewis
KN
Price
NL
, et al.  . 
Nrf2 mediates cancer protection but not prolongevity induced by caloric restriction
Proc Natl Acad Sci U S A
 , 
2008
, vol. 
105
 (pg. 
2325
-
2330
)
4.
Ungvari
ZI
Bailey-Downs
L
Gautam
T
, et al.  . 
Adaptive induction of NF-E2-related factor-2-driven antioxidant genes in endothelial cells in response to hyperglycemia
Am J Physiol Heart Circ Physiol
 , 
2011
, vol. 
300
 (pg. 
H1133
-
H1140
)
5.
Ungvari
Z
Bagi
Z
Feher
A
, et al.  . 
Resveratrol confers endothelial protection via activation of the antioxidant transcription factor Nrf2
Am J Physiol Heart Circ Physiol
 , 
2010
, vol. 
299
 (pg. 
H18
-
H24
)
6.
Csiszar
A
Labinskyy
N
Smith
K
Rivera
A
Orosz
Z
Ungvari
Z
Vasculoprotective effects of anti-TNFalfa treatment in aging
Am J Pathol
 , 
2007
, vol. 
170
 (pg. 
388
-
698
)
7.
Csiszar
A
Ungvari
Z
Edwards
JG
, et al.  . 
Aging-induced phenotypic changes and oxidative stress impair coronary arteriolar function
Circ Res
 , 
2002
, vol. 
90
 (pg. 
1159
-
1166
)
8.
Ungvari
Z
Parrado-Fernandez
C
Csiszar
A
de Cabo
R
Mechanisms underlying caloric restriction and lifespan regulation: implications for vascular aging
Circ Res
 , 
2008
, vol. 
102
 (pg. 
519
-
528
)
9.
Ungvari
Z
Bailey-Downs
L
Gautam
T
, et al.  . 
Age-associated vascular oxidative stress, Nrf2 dysfunction and NF-kB activation in the non-human primate Macaca mulatta
J Gerontol A Biol Sci Med Sci
 , 
2011
, vol. 
66
 
8
(pg. 
866
-
875
)
10.
Collins
AR
Lyon
CJ
Xia
X
, et al.  . 
Age-accelerated atherosclerosis correlates with failure to upregulate antioxidant genes
Circ Res
 , 
2009
, vol. 
104
 (pg. 
e42
-
e54
)
11.
Evans
LM
Davies
JS
Goodfellow
J
Rees
JA
Scanlon
MF
Endothelial dysfunction in hypopituitary adults with growth hormone deficiency
Clin Endocrinol
 , 
1999
, vol. 
50
 (pg. 
457
-
464
)
12.
Denti
L
Annoni
V
Cattadori
E
, et al.  . 
Insulin-like growth factor 1 as a predictor of ischemic stroke outcome in the elderly
Am J Med
 , 
2004
, vol. 
117
 (pg. 
312
-
317
)
13.
Oflaz
H
Sen
F
Elitok
A
, et al.  . 
Coronary flow reserve is impaired in patients with adult growth hormone (GH) deficiency
Clin Endocrinol
 , 
2007
, vol. 
66
 (pg. 
524
-
529
)
14.
Breese
CR
Ingram
RL
Sonntag
WE
Influence of age and long-term dietary restriction on plasma insulin-like growth factor-1 (IGF-1), IGF-1 gene expression, and IGF-1 binding proteins
J Gerontol
 , 
1991
, vol. 
46
 (pg. 
B180
-
B187
)
15.
D’Costa
AP
Ingram
RL
Lenham
JE
Sonntag
WE
The regulation and mechanisms of action of growth hormone and insulin-like growth factor 1 during normal ageing
J Reprod Fertil Suppl
 , 
1993
, vol. 
46
 (pg. 
87
-
98
)
16.
Khan
AS
Sane
DC
Wannenburg
T
Sonntag
WE
Growth hormone, insulin-like growth factor-1 and the aging cardiovascular system
Cardiovasc Res
 , 
2002
, vol. 
54
 (pg. 
25
-
35
)
17.
Vasan
RS
Sullivan
LM
D’Agostino
RB
, et al.  . 
Serum insulin-like growth factor I and risk for heart failure in elderly individuals without a previous myocardial infarction: the Framingham Heart Study
Ann Intern Med
 , 
2003
, vol. 
139
 (pg. 
642
-
648
)
18.
Roubenoff
R
Parise
H
Payette
HA
, et al.  . 
Cytokines, insulin-like growth factor 1, sarcopenia, and mortality in very old community-dwelling men and women: the Framingham Heart Study
Am J Med
 , 
2003
, vol. 
115
 (pg. 
429
-
435
)
19.
Laughlin
GA
Barrett-Connor
E
Criqui
MH
Kritz-Silverstein
D
The prospective association of serum insulin-like growth factor I (IGF-I) and IGF-binding protein-1 levels with all cause and cardiovascular disease mortality in older adults: the Rancho Bernardo Study
J Clin Endocrinol Metab
 , 
2004
, vol. 
89
 (pg. 
114
-
120
)
20.
Kaplan
RC
McGinn
AP
Pollak
MN
, et al.  . 
High insulinlike growth factor binding protein 1 level predicts incident congestive heart failure in the elderly
Am Heart J
 , 
2008
, vol. 
155
 (pg. 
1006
-
1012
)
21.
Rosen
T
Bengtsson
BA
Premature mortality due to cardiovascular disease in hypopituitarism
Lancet
 , 
1990
, vol. 
336
 (pg. 
285
-
288
)
22.
Bates
AS
Van’t Hoff
W
Jones
PJ
Clayton
RN
The effect of hypopituitarism on life expectancy
J Clin Endocrinol Metab
 , 
1996
, vol. 
81
 (pg. 
1169
-
1172
)
23.
Bulow
B
Hagmar
L
Mikoczy
Z
Nordstrom
CH
Erfurth
EM
Increased cerebrovascular mortality in patients with hypopituitarism
Clin Endocrinol (Oxf)
 , 
1997
, vol. 
46
 (pg. 
75
-
81
)
24.
Tomlinson
JW
Holden
N
Hills
RK
, et al.  . 
Association between premature mortality and hypopituitarism. West Midlands Prospective Hypopituitary Study Group
Lancet
 , 
2001
, vol. 
357
 (pg. 
425
-
431
)
25.
Forman
K
Vara
E
Garcia
C
, et al.  . 
Effect of a combined treatment with growth hormone and melatonin in the cardiological aging on male SAMP8 mice
J Gerontol A Biol Sci Med Sci
 , 
2011
, vol. 
66
 
8
(pg. 
823
-
834
)
26.
Higashi
Y
Sukhanov
S
Anwar
A
Shai
SY
Delafontaine
P
IGF-1, oxidative stress and atheroprotection
Trends Endocrinol Metab
 , 
2010
, vol. 
21
 (pg. 
245
-
254
)
27.
Sukhanov
S
Higashi
Y
Shai
SY
, et al.  . 
IGF-1 reduces inflammatory responses, suppresses oxidative stress, and decreases atherosclerosis progression in ApoE-deficient mice
Arterioscler Thromb Vasc Biol
 , 
2007
, vol. 
27
 (pg. 
2684
-
2690
)
28.
Csiszar
A
Labinskyy
N
Perez
V
, et al.  . 
Endothelial function and vascular oxidative stress in long-lived GH/IGF-deficient Ames dwarf mice
Am J Physiol Heart Circ Physiol
 , 
2008
, vol. 
295
 (pg. 
H1882
-
H1894
)
29.
Ungvari
Z
Gautam
T
Koncz
P
, et al.  . 
Vasoprotective effects of life span-extending peripubertal GH replacement in Lewis dwarf rats
J Gerontol A Biol Sci Med Sci
 , 
2010
, vol. 
65
 (pg. 
1145
-
1156
)
30.
Sun
LY
Al-Regaiey
K
Masternak
MM
Wang
J
Bartke
A
Local expression of GH and IGF-1 in the hippocampus of GH-deficient long-lived mice
Neurobiol Aging
 , 
2005
, vol. 
26
 (pg. 
929
-
937
)
31.
Wang
J
Niu
W
Nikiforov
Y
, et al.  . 
Targeted overexpression of IGF-I evokes distinct patterns of organ remodeling in smooth muscle cell tissue beds of transgenic mice
J Clin Invest
 , 
1997
, vol. 
100
 (pg. 
1425
-
1439
)
32.
Shai
SY
Sukhanov
S
Higashi
Y
Vaughn
C
Kelly
J
Delafontaine
P
Smooth muscle cell-specific insulin-like growth factor-1 overexpression in Apoe-/- mice does not alter atherosclerotic plaque burden but increases features of plaque stability
Arterioscler Thromb Vasc Biol
 , 
2010
, vol. 
30
 (pg. 
1916
-
1924
)
33.
Conover
CA
Bale
LK
Mader
JR
Mason
MA
Keenan
KP
Marler
RJ
Longevity and age-related pathology of mice deficient in pregnancy-associated plasma protein-A
J Gerontol A Biol Sci Med Sci
 , 
2010
, vol. 
65
 (pg. 
590
-
599
)
34.
Louis
A
Bartke
A
Masternak
MM
Effects of growth hormone and thyroxine replacement therapy on insulin signaling in Ames dwarf mice
J Gerontol A Biol Sci Med Sci
 , 
2010
, vol. 
65
 (pg. 
344
-
352
)
35.
Masternak
MM
Panici
JA
Wang
F
Wang
Z
Spong
A
The effects of growth hormone (GH) treatment on GH and insulin/IGF-1 signaling in long-lived Ames dwarf mice
J Gerontol A Biol Sci Med Sci
 , 
2010
, vol. 
65
 (pg. 
24
-
30
)
36.
Panici
JA
Wang
F
Bonkowski
MS
, et al.  . 
Is altered expression of hepatic insulin-related genes in growth hormone receptor knockout mice due to GH resistance or a difference in biological life spans?
J Gerontol A Biol Sci Med Sci
 , 
2009
, vol. 
64
 (pg. 
1126
-
1133
)
37.
Mitschelen
M
Yan
H
Farley
JA
, et al.  . 
Long-term deficiency of circulating and hippocampal insulin-like growth factor I induces depressive behavior in adult mice: a potential model of geriatric depression
Neuroscience
 , 
2011
, vol. 
185
 (pg. 
50
-
60
)
38.
Liu
JL
Grinberg
A
Westphal
H
, et al.  . 
Insulin-like growth factor-I affects perinatal lethality and postnatal development in a gene dosage-dependent manner: manipulation using the Cre/loxP system in transgenic mice
Mol Endocrinol
 , 
1998
, vol. 
12
 (pg. 
1452
-
1462
)
39.
Ho
KJ
Bass
CE
Kroemer
AH
Ma
C
Terwilliger
E
Karp
SJ
Optimized adeno-associated virus 8 produces hepatocyte-specific Cre-mediated recombination without toxicity or affecting liver regeneration
Am J Physiol Gastrointest Liver Physiol
 , 
2008
, vol. 
295
 (pg. 
G412
-
G419
)
40.
Pearson
KJ
Baur
JA
Lewis
KN
, et al.  . 
Resveratrol delays age-related deterioration and mimics transcriptional aspects of dietary restriction without extending life span
Cell Metab
 , 
2008
, vol. 
8
 (pg. 
157
-
168
)
41.
Csiszar
A
Labinskyy
N
Zhao
X
, et al.  . 
Vascular superoxide and hydrogen peroxide production and oxidative stress resistance in two closely related rodent species with disparate longevity
Aging Cell
 , 
2007
, vol. 
6
 (pg. 
783
-
797
)
42.
Csiszar
A
Labinskyy
N
Jimenez
R
, et al.  . 
Anti-oxidative and anti-inflammatory vasoprotective effects of caloric restriction in aging: role of circulating factors and SIRT1
Mech Ageing Dev
 , 
2009
, vol. 
130
 (pg. 
518
-
527
)
43.
Ungvari
ZI
Labinskyy
N
Gupte
SA
Chander
PN
Edwards
JG
Csiszar
A
Dysregulation of mitochondrial biogenesis in vascular endothelial and smooth muscle cells of aged rats
Am J Physiol Heart Circ Physiol
 , 
2008
, vol. 
294
 (pg. 
H2121
-
H2128
)
44.
Ungvari
ZI
Orosz
Z
Labinskyy
N
, et al.  . 
Increased mitochondrial H2O2 production promotes endothelial NF-kB activation in aged rat arteries
Am J Physiol Heart Circ Physiol
 , 
2007
, vol. 
293
 (pg. 
H37
-
H47
)
45.
Csiszar
A
Smith
K
Labinskyy
N
Orosz
Z
Rivera
A
Ungvari
Z
Resveratrol attenuates TNF-{alpha}-induced activation of coronary arterial endothelial cells: role of NF-{kappa}B inhibition
Am J Physiol
 , 
2006
, vol. 
291
 (pg. 
H1694
-
H1699
)
46.
Labinskyy
N
Mukhopadhyay
P
Toth
J
, et al.  . 
Longevity is associated with increased vascular resistance to high glucose-induced oxidative stress and inflammatory gene expression in Peromyscus leucopus
Am J Physiol Heart Circ Physiol
 , 
2009
, vol. 
296
 (pg. 
H946
-
H956
)
47.
Ungvari
Z
Ridgway
I
Philipp
EE
, et al.  . 
Extreme longevity is associated with increased resistance to oxidative stress in Arctica islandica, the longest-living non-colonial animal
J Gerontol A Biol Sci Med Sci
 , 
2011
, vol. 
66
 
7
(pg. 
741
-
750
)
48.
Csiszar
A
Ungvari
Z
Koller
A
Edwards
JG
Kaley
G
Proinflammatory phenotype of coronary arteries promotes endothelial apoptosis in aging
Physiol Genomics
 , 
2004
, vol. 
17
 (pg. 
21
-
30
)
49.
Ungvari
Z
Sosnowska
D
Podlutsky
A
Koncz
P
Sonntag
WE
Csiszar
A
Free radical production, antioxidant capacity, and oxidative stress response signatures in fibroblasts from Lewis dwarf rats: effects of life span-extending peripubertal GH treatment
J Gerontol A Biol Sci Med Sci
 , 
2011
, vol. 
66
 
5
(pg. 
501
-
510
)
50.
Panici
JA
Harper
JM
Miller
RA
Bartke
A
Spong
A
Masternak
MM
Early life growth hormone treatment shortens longevity and decreases cellular stress resistance in long-lived mutant mice
FASEB J
 , 
2010
, vol. 
24
 (pg. 
1
-
7
)
51.
Sonntag
WE
Carter
CS
Ikeno
Y
, et al.  . 
Adult-onset growth hormone and insulin-like growth factor I deficiency reduces neoplastic disease, modifies age-related pathology, and increases life span
Endocrinology
 , 
2005
, vol. 
146
 (pg. 
2920
-
2932
)
52.
Rudman
D
Kutner
MH
Rogers
CM
Lubin
MF
Fleming
GA
Bain
RP
Impaired growth hormone secretion in the adult population: relation to age and adiposity
J Clin Invest
 , 
1981
, vol. 
67
 (pg. 
1361
-
1369
)
53.
Delafontaine
P
Song
YH
Li
Y
Expression, regulation, and function of IGF-1, IGF-1R, and IGF-1 binding proteins in blood vessels
Arterioscler Thromb Vasc Biol
 , 
2004
, vol. 
24
 (pg. 
435
-
444
)
54.
Ungvari
Z
Bailey-Downs
L
Sosnowska
D
, et al.  . 
Vascular oxidative stress in aging: a homeostatic failure due to dysregulation of Nrf2-mediated antioxidant response
Am J Physiol
 , 
2011
, vol. 
301
 
2
(pg. 
H363
-
H372
)
55.
Sharma
S
Rakoczy
S
Dahlheimer
K
Brown-Borg
H
The hippocampus of Ames dwarf mice exhibits enhanced antioxidative defenses following kainic acid-induced oxidative stress
Exp Gerontol
 , 
2010
, vol. 
45
 (pg. 
936
-
949
)
56.
Morrison
CD
Pistell
PJ
Ingram
DK
, et al.  . 
High fat diet increases hippocampal oxidative stress and cognitive impairment in aged mice: implications for decreased Nrf2 signaling
J Neurochem
 , 
2010
, vol. 
114
 (pg. 
1581
-
1589
)
57.
Shai
SY
Sukhanov
S
Higashi
Y
Vaughn
C
Rosen
CJ
Delafontaine
P
Low circulating insulin-like growth factor I increases atherosclerosis in ApoE-deficient mice
Am J Physiol Heart Circ Physiol
 , 
2011
, vol. 
300
 
5
(pg. 
H1898
-
H1906
)
58.
Okouchi
M
Okayama
N
Alexander
JS
Aw
TY
NRF2-dependent glutamate-L-cysteine ligase catalytic subunit expression mediates insulin protection against hyperglycemia-induced brain endothelial cell apoptosis
Curr Neurovasc Res
 , 
2006
, vol. 
3
 (pg. 
249
-
261
)
59.
Bokov
AF
Lindsey
ML
Khodr
C
Sabia
MR
Richardson
A
Long-lived ames dwarf mice are resistant to chemical stressors
J Gerontol A Biol Sci Med Sci
 , 
2009
, vol. 
64
 (pg. 
819
-
827
)
60.
Hauck
SJ
Aaron
JM
Wright
C
Kopchick
JJ
Bartke
A
Antioxidant enzymes, free-radical damage, and response to paraquat in liver and kidney of long-living growth hormone receptor/binding protein gene-disrupted mice
Horm Metab Res
 , 
2002
, vol. 
34
 (pg. 
481
-
486
)
61.
Harper
JM
Salmon
AB
Chang
Y
Bonkowski
M
Bartke
A
Miller
RA
Stress resistance and aging: influence of genes and nutrition
Mech Ageing Dev
 , 
2006
, vol. 
127
 (pg. 
687
-
694
)
62.
Kennedy
MA
Rakoczy
SG
Brown-Borg
HM
Long-living Ames dwarf mouse hepatocytes readily undergo apoptosis
Exp Gerontol
 , 
2003
, vol. 
38
 (pg. 
997
-
1008
)
63.
Harper
JM
Salmon
AB
Leiser
SF
Galecki
AT
Miller
RA
Skin-derived fibroblasts from long-lived species are resistant to some, but not all, lethal stresses and to the mitochondrial inhibitor rotenone
Aging Cell
 , 
2007
, vol. 
6
 (pg. 
1
-
13
)
64.
Hsieh
CC
Papaconstantinou
J
Dermal fibroblasts from long-lived Ames dwarf mice maintain their in vivo resistance to mitochondrial generated reactive oxygen species (ROS)
Aging (Albany, NY)
 , 
2009
, vol. 
1
 (pg. 
784
-
802
)
65.
Guevara-Aguirre
J
Balasubramanian
P
Guevara-Aguirre
M
, et al.  . 
Growth hormone receptor deficiency is associated with a major reduction in pro-aging signaling, cancer, and diabetes in humans
Sci Transl Med
 , 
2011
, vol. 
3
 pg. 
70ra13
 
66.
Li
Y
Higashi
Y
Itabe
H
Song
YH
Du
J
Delafontaine
P
Insulin-like growth factor-1 receptor activation inhibits oxidized LDL-induced cytochrome C release and apoptosis via the phosphatidylinositol 3 kinase/Akt signaling pathway
Arterioscler Thromb Vasc Biol
 , 
2003
, vol. 
23
 (pg. 
2178
-
2184
)
67.
Martin
D
Rojo
AI
Salinas
M
, et al.  . 
Regulation of heme oxygenase-1 expression through the phosphatidylinositol 3-kinase/Akt pathway and the Nrf2 transcription factor in response to the antioxidant phytochemical carnosol
J Biol Chem
 , 
2004
, vol. 
279
 (pg. 
8919
-
8929
)
68.
Feng
J
Zhang
P
Chen
X
He
G
PIK3 and ERK/Nrf2 pathways are involved in oleanolic acid-induced heme oxygenase-1 expression in rat vascular smooth muscle cells
J Cell Biochem
 , 
2011
, vol. 
112
 (pg. 
1524
-
1531
)
69.
Kwak
MK
Itoh
K
Yamamoto
M
Kensler
TW
Enhanced expression of the transcription factor Nrf2 by cancer chemopreventive agents: role of antioxidant response element-like sequences in the nrf2 promoter
Mol Cell Biol
 , 
2002
, vol. 
22
 (pg. 
2883
-
2892
)

Author notes

Decision Editor: Rafael de Cabo, PhD