Molecular phylogenetic relationships of Melanthiaceae (Liliales) based on plastid DNA sequences

Abstract

Melanthiaceae (Liliales) comprise 17 genera of rhizomatous or bulbous perennials and are distributed across the Northern Hemisphere. The relationships among the five tribes in this family have been evaluated in many molecular and morphological studies. In this study, we performed a phylogenetic analysis of the 17 genera, including 106 species of Melanthiaceae sensu APG III and nine related species as outgroups, based on sequences of five plastid regions (atpB, rbcL, matK, ndhF and trnL-F). Support values for the monophyly of the family (BS_MP = 96%, BS_ML = 100%, PP_BI = 1.00) and each tribe were improved in comparison with previous studies. Among the tribes, Melanthieae were sister to the remainder of the family and sister relationships between Xerophylleae and Parideae (BS_MP = 96%, BS_ML = 100%, PP_BI = 1.00) and Chionographideae and Heloniadeae (BS_MP = 96%, BS_ML = 100%, PP_BI = 1.00) were confirmed. Notably, the generic concept of Veratrum s.l. including Melanthium was not supported in the present study and these genera should be treated as distinct. In the case of Parideae, the relationship of Trillium govanianum to the other species remains uncertain and requires further studies. Finally, we mapped seven representative morphological characters onto the molecular phylogenetic tree for Melanthiaceae.

chloroplast DNA, Melanthieae, molecular phylogeny, monocots, Parideae

Introduction

Melanthiaceae are one of the largest families of Liliales, consisting of perennial herbs mostly distributed in the temperate regions of the Northern Hemisphere, except for Schoenocaulon officinale (Schltdl. & Cham.) A.Gray from Latin America (Zomlefer et al., 2006). The family is thought to have originated just after the Cretaceous (c. 59 Mya, Mennes et al., 2015).

The circumscription of the family has been debated since Batsch (1802) defined Melanthia (= Melanthiaceae), including the genera Melanthium J.Clayton ex L., Veratrum L., Helonias L. and Narthecium Huds., based on the presence of apically divergent carpels and Melanoja (= Trilliaceae), including the genera Trillium L. and Paris L. Melanoja were subsequently treated as part of Trilliaceae by several taxonomists (Kato et al., 1995; Osaloo et al., 1999; Osaloo & Kawano, 1999; Farmer & Schilling, 2002; Farmer, 2006; Tamura, 1998a; Table 1).

Table 1.

Comparison of classification systems for Melanthiaceae

Batsch (1802)	Engler (1964)	Dahlgren et al. (1985)	Zomlefer (1996, 1997a), Zomlefer (1997b)	Tamura (1998a)	APG (1998), APG II (2003), APG III (2009)
	Liliales*	Melanthiales*	Tofieldiales*		Alismatales*
	Liliaceae†
Melanthia†	Melanthioideae‡	Melanthiaceae†
	Tofieldieae§	Tofieldieae§	Tofieldiaceae†		Tofieldiaceae†
			Nartheciales*		Dioscorales*
			Nartheciaceae†		Nartheciaceae†
Narthecium		Narthecieae§
	Uvularieae§				Liliales*
	Colchiceae*				Colchicaceae†
	Anguillarieae§
			Liliales*	Liliales*
			Melanthiaceae†	Melanthiaceae†	Melanthiaceae†
	Heloniadeae§		Heloniadeae§	Heloniadeae§	Heloniadeae§
Helonias	Helonias	Helonias	Helonias	Helonias	Helonias
	Heloniopsis	Heloniopsis	Heloniopsis	Heloniopsis	Heloniopsis
			Ypsilandra	Ypsilandra	Ypsilandra
		Chionographideae§	Chionographideae§		Chionographideae§
	Chamaelirium	Chamaelirium	Chamaelirium	Chamaelirium	Chamaelirium
	Chionographis	Chiongraphis	Chionographis	Chionographis	Chionographis
		Xerophylleae§	Xerophylleae§	Xerophylleae§	Xerophylleae§
	Xerophyllum	Xerophyllum	Xerophyllum	Xerophyllum	Xerophyllum
	Veratreae§ (or Melanthieae§)	Melanthieae§	Melanthieae§	Melanthieae§	Melanthieae§
Veratrum	Veratrum
Melanthium	Melanthium	Veratrum	Veratrum (Melanthium)	Veratrum	Veratrum
	Schoenocaulon	Melanthium	Schoenocaulon	Melanthium	Melanthium
	Stenanthium	Schoenocaulon	Stenanthium	Schoenocaulon	Schoenocaulon
	Zigadenus	Stenanthium	Zigadenus	Stenanthium	Stenanthium
	Amianthium	Zigadenus	Amianthium	Zigadenus	Zigadenus
		Amianthium	Anticlea	Amianthium	Amianthium
			Toxicoscordion		Anticlea
					Toxicoscordion
	Asparagoideae‡	Dioscoreales*
Melanoja†	Parideae§	Trilliaceae†	Trilliaceae†	Trilliaceae†	Parideae§
Trillium	Trillium	Trillium	Trillium	Trillium	Trillium
Paris	Paris	Paris	Paris	Paris	Paris
		Daiswa	Daiswa	Daiswa	Pseudotrillium
		Kinugasa	Kinugasa	Kinugasa
					Liliaceae†
	Medeola	Medeola			Medeola
	Scoliopus	Scoliopus			Scoliopus

*Order, †family, ‡subfamily, §tribe. Due to the complexity of the differences in classification, position on the same line does not necessarily imply equivalence.

Engler (1964) recognized a broadly defined Liliaceae and divided it into several subfamilies. Among these, Melanthiaceae sensu Batsch were defined as subfamily Melanthioideae, consisting of six tribes. Trillium and Paris were placed in tribe Parideae of subfamily Asparagoideae with Medeola Gronov. ex L. and Scoliopus Torr.

Dahlgren, Clifford & Yeo (1985) recognized the order Melanthiales, with members of this order having perigonal nectaries, uniformly coloured tepals, extrorse (or valvular) anther dehiscence, helobial endosperm formation and frequently free stigmas as synapomorphic characters. They distinguished the families Melanthiaceae and Campynemataceae based on the ovary position (superior or semi-inferior in Melanthiaceae and inferior in Campynemataceae. Tribe Parideae of Asparagoideae sensu Engler formed an independent family Trilliaceae (including Daiswa Raf. and Kinugasa Tatew. & Suto), comprising erect herbs and non-climbers with trimerous flowers and leaves and superior ovaries, in Dioscoreales.

Zomlefer (1997a) proposed a narrow Melanthiaceae, composed of the four tribes Heloniadeae, Chinographideae, Melanthieae and Xerophylleae, and Trilliaceae (excluding Medeola and Scoliopus).

Tamura (1998a) recognized Melanthiaceae and Trilliaceae in Liliales based on the characters of lacking bracteoles and having extrorse or subextrorse anthers, perigonal nectaries and relatively large chromosomes; he subdivided Melanthiaceae into Heloniadeae (including Chinographideae), Xerophylleae and Melanthieae.

The APG system (APG 1998; APG II, 2003; APG III, 2009), which was established on the basis of molecular phylogenetic studies, defined Melanthiaceae s.l. as an expanded family belonging to Liliales including Trilliaceae of previous classifications. Melanthiaceae sensuAPG III (2009), composed of 16 genera and five tribes (Heloniadeae, Chionographideae, Xerophylleae, Melanthieae and Parideae; Table 1), are characterized by morphological features including extrorse anthers and ovaries often with three styles (Rudall et al., 2000).

Although the monophyly of Melanthiaceae was supported by molecular phylogenetic studies, the phylogenetic position of the family in Liliales remains unclear. It has been placed as sister to Colchicaceae + Alstroemeriaceae (including Luzuriagaceae) (Chase et al., 2000; Janssen & Bremer, 2004) or Campynemataceae + Smilacaceae s.l. + Liliaceae (Rudall et al., 2000; Vinnersten & Bremer, 2001). Fay et al. (2006) recovered Melanthiaceae s.l. as sister to all other families of Liliales except the early-diverging Corsiaceae and Campynemataceae. In contrast, a sister relationship with Petermanniaceae was proposed based on a recent molecular phylogenetic study with broad sampling, but only with weak suppport (Kim et al., 2013).

Before the expanded concept of the family and the present tribal circumscriptions were established, most phylogenetic studies were at the tribal or generic level. In particular, the phylogenetics of Parideae (=Trillieae), with solitary flowers, berries, membranous nectaries, large chromosomes and basic chromosome number = 5, has been debated by several researchers using molecular and morphological data (Kato et al., 1995; Li, 1998; Osaloo & Kawano, 1999; Osaloo et al., 1999; Farmer & Schilling, 2002; Farmer, 2006; Ji et al., 2006). Ji et al. (2006) focused on Paris, and suggested a united concept of Paris, divided into two subgenera, Paris and Daiswa, based on molecular sequence data for internal transcribed spacer (ITS), psbA-trnH and trnL-F. Freeman (1969, 1975) proposed a subgeneric classification of Trillium into subgenus Trillium (with a pedicel) and Phyllantherum Raf. (without a pedicel). The monophyly of subgenus Phyllantherum has received strong support in molecular studies (Osaloo & Kawano, 1999; Osaloo et al., 1999; Farmer & Schilling, 2002; Farmer, 2006), whereas subgenus Trillium appears to be paraphyletic. Farmer & Schilling (2002) and Farmer (2006) separated species of Trillium s.l. into three different genera (Pseudotrillium S.B.Farmer, Trillidium Kunth and Trillium) based on morphological and molecular data.

Zomlefer et al. (2001) focused on the molecular phylogenetic relationships in Melanthieae and divided Zigadenus s.l. into four separate genera [Anticlea Kunth, Stenanthium (A.Gray) Kunth, Toxicoscordion Rydb. and Zigadenus Michx.] and recognized Veratrum s.l. including Melanthium J.Clayton ex L. Veratrum s.l. is currently divided into two sections, section Veratrum and section Fuscoveratrum O.Loes (Zomlefer et al., 2003; Liao, Yuan & Zhang, 2007).

Recently, Pellicer et al. (2014) traced genome size and chromosome number evolution in Melanthiaceae sensu APG III on a phylogenetic tree based on plastid trnL-F sequences, demonstrating that genome evolution in Melanthiaceae has been characterized by a trend towards genome size reduction, with a single episode of dramatic DNA accumulation in Parideae.

In this study, we sampled more species of Melanthiaceae than in previous studies and collected addtional data. Expanding the number of taxa and data produced a better supported phylogenetic tree of the family than in previous studies, clarifying relationships among and within tribes. We additionally traced representative morphological characters on the tree obtained here and discussed generic relationships.

Material and methods

Plant materials

Sources of plant material and vouchers used in this study are listed in Table 2. Twenty-six genera representing 106 species of Melanthiaceae were sampled, including at least one representative of all five tribes in Melanthiaceae sensuAPG III (2009). Nine species were selected as outgroups from Liliaceae, Colchicaceae, Petermanniaceae and Smilacaceae.

Table 2.

List of species, voucher information and GenBank numbers

Family/Tribe	Species	Voucher	Institute	atpB	rbcL	matK	ndhF	trnL-F
Melanthiaceae Chionographideae	Chamaelirium luteum (L.) A.Gray	H. Koyama 6257		AF209561(1)	AJ276347(2)	AB040196(3)	AY225006(4)	AF303664(5)
Chionographis chinensis K.Krause	Tsang. W. T. 24930	KUN	–	KM242926	KM242768	KM242838	–
Chionographis japonica (Willd.) Maxim.	D. K. Kim, 04-115	GCU	JX903932(6)	JN417464(7)	JN417374(7)	JX903513(6)	HG475352(8)
Chionographis koidzumiana Ohwi	H. I. Keda, T. Yahara s.n.	KUN	–	KM242927	KM242769	KM242839	–
Heloniadeae	Helonias bullata L.	Chase 41431	K	KM242696	KM242928	KM242770	KM242842	AF303663(5)
	Heloniopsis kawanoi (Koidz.) Honda	Chase 38707	K	KM242697	KM242929	KM242771	KM242843	HG475355(8)
	Heloniopsis koreana Fuse, N.S.Lee & M.N.Tamura	J. K. Hong, 056	GCU	KM242698	JN417465(7)	JN417375(7)	KM242844	HG475359(8)
	Heloniopsis leucantha (Koidz.) Honda	H. Setoguchi JP2701	TI	–	KM242930	KM242772	KM242845	HG475354(8)
	Heloniopsis orientalis (Thunb.) Tanaka	Chase 445	K	KM242699	KM242931	KM242773	KM242846	HG475358(8)
	Heloniopsis orientalis var. breviscapa (Maxim.) Ohwi	S. Mitsuta 12558	TI	–	KM242932	KM242774	KM242847	HG475356(8)
	Heloniopsis orientalis var. flavida (Nakai) Ohwi	Kim S. C. 2012-001	*	KM242700	KM242933	KM242775	KM242848	HG475357(8)
	Heloniopsis tubiflora Fuse, N.S.Lee & M.N.Tamura	J. K. Hong, 046	GCU	KM242701	JN417466(7)	JN417376(7)	KM242849	HG475360(8)
	Heloniopsis umbellata Baker	Chase 38708	K	KM242702	KM242934	KM242776	KM242850	HG475353(8)
	Ypsilandra alpina F.T.Wang & Tang	KUN 0773902	KUN	KM242765	KM242999	–	–	–
	Ypsilandra thibetica Franch.	Wilson E. H. 4676	K	KM242766	KM243000	KR233275	–	HG475363(8)
	Ypsilandra yunnanensis W.W.Sm. & Jeffrey	T. T. Yu, 19036	KUN	KM242767	KM243001	–	–	–
Melanthieae	Amianthium muscitoxicum (Walter) A.Gray			AJ417582(9)	AJ417895(9)	FR832722(10)	–	AF303670(5)
	Anticlea elegans (Pursh) Rydb.	Chase & Fay 14583	K	KM242692	JN417468(7)	JN417378(7)	KM242835	AF303694(5)
	Anticlea occidentalis (A.Gray) Zomlefer & Judd	Chase 522	K	KM242693	JN417484(7)	JN417393(7)	KM242836	AF303697(5)
	Anticlea sibirica (L.) Kunth	KH801023	GCU	KM242694	JN417481(7)	JN417390(7)	KM242837	DQ517462
	Melanthium latifolium Desr.			–	JN417482(7)	JN417391(7)	–	AF303680(5)
	Melanthium virginicum L.	Chase 1024	K	KM242703	KM242935	KM242777	KM242851	AF303679(5)
	Schoenocaulon caricifolium (Schltdl.) A.Gray	Chase 1852	K	KM242725	JN417483(7)	JN417392(7)	KM242872	KR233280
	Schoenocaulon intermedium Baker	C. G. Pringle 8356	NY	–	KM242953	KM242794	KM242873	KR233288
	Schoenocaulon officinale (Schltdl. & Cham.) A.Gray	Dorr, Barntt & Diaz 7247	K	–	KM242954	KM242795	KM242874	–
	Schoenocaulon pringlei Greenm.	C. G. Pringle 6415	NY	–	KM242955	KM242796	KM242875	–
	Schoenocaulon tenuifolium (M.Martens & Galeotti) B.L.Rob. & Greenm.	C. G. Pringle 6653	NY	–	KM242956	KM242797	KM242876	KR233285
	Stenanthium densum (Desr.) Zomlefer & Judd 1	Mary C. Reynolds S.N.	FLAS	–	–	–	–	AF303690(5)
	Stenanthium densum (Desr.) Zomlefer & Judd 2	James F. Smith, G. Bharathan & B. M. Bowditch 2262	US	KR233267	KR233277	KR233270	–	KR233289
	Stenanthium gramineum (Ker Gawl.) Morong 1	A. E. Skjot-Pedersen S.N.	FLAS	–	–	–	–	AF303692(5)
	Stenanthium gramineum (Ker Gawl.) Morong 2	M.T.Strong 3919	US	KR233268	KR233278	KR233271	–	KR233290
	Toxicoscordion fremontii (Torr.) Rydb.	Chase 16319	K	KM242726	KM242959	KM242798	KM242877	AF303688(5)
	Toxicoscordion paniculatum (Nutt.) Rydb.	V. D. Depaepe 7	NSW	KM242727	JN417480(7)	JN417389(7)	KM242878	AF303689(5)
	Toxicoscordion venenosum (S.Watson) Rydb.	Van der Werff 12922	K	KM242728	KM242960	–	KM242879	AF303683(5)
	Veratrum alpestre Nakai	Kyoto 6931	KYO	–	KM242984	KM242821	KM242906	–
	Veratrum dahuricum (Turcz.) O.Loes.	PE 315978	PE	–	KM242985	KM242822	KM242907	DQ517450(11)
	Veratrum formosanum O.Loes.	Y. Ando et al. 142	HAST	–	KM242986	KM242823	KM242908	–
	Veratrum grandiflorum (Maxim. ex Miq.) O.Loes.	KUN 0303565	KUN	KM242755	KM242987	KM242824	KM242909	DQ517452(11)
	Veratrum lobelianum Bernh.	Chase 19618	K	KM242756	KM242988	KM242825	KM242910	DQ517454(11)
	Veratrum maackii var. japonicum (Baker) T.Shimizu	J. K. Hong, 043	GCU	KM242757	JN417476(7)	JN417386(7)	KM242911	DQ517453(11)
	Veratrum maackii Regel	S. T. Lee, s.n.	GCU	KM242758	KM242989	KM242826	KM242912	AF303678(5)
	Veratrum maackii var. parviflorum (Maxim. ex Miq.) H.Hara	S. H. Hwang 2009	GCU	KM242759	KM242990	KM242827	KM242913	KR233281
	Veratrum mengtzeanum O.Loes.	KUN 0303607	KUN	–	KM242991	KM242828	KM242914	DQ517456(11)
	Veratrum micranthum F.T.Wang & Tang	KUN 0303613	KUN	–	KM242992	KM242829	KM242915	–
	Veratrum nigrum L.	KUN 0303642	KUN	KM242760	KM242993	KM242830	KM242916	DQ517461(11)
	Veratrum oblongum O.Loes.	T. P. Wang S.N.	PE	–	KM242994	KM242831	KM242917	DQ517457(11)
	Veratrum oxysepalum Turcz.	J. K. Hong, 015	GCU	KM242761	JN417478(7)	JN417387(7)	KM242918	DQ517458(11)
	Veratrum schindleri O.Loes.	KUN 0303650	KUN	–	KM242995	KM242832	KM242919	DQ517459(11)
	Veratrum stamineum Maxim.	Norita s.n.	TI	–	KM242996	KR233274	KM242920	AB514904
	Veratrum versicolor Nakai	D. H. Lee & M. S. Kim, s.n.	GCU	KM242762	JN417479(7)	JN417388(7)	KM242921	KR233282
	Veratrum viride Aiton	Chase 551	K	KM242763	KM242997	KM242833	KM242922	KR233291
	Zigadenus glaberrimus Michx. 1	Chase 153	K	–	–	–	–	AF303698(5)
	Zigadenus glaberrimus Michx. 2	M.T.Strong 3925	US	KR233266	KR233276	KR233269	–	KR233287
Parideae	Paris axialis H.Li	S. W. Lee, s.n.	KUN	KM242704	JN417469(7)	JN417379(7)	KM242852	DQ404278(24)
	Paris delavayi Franch.	KUN 0302034	KUN	KM242705	KM242936	KM242778	KM242853	DQ404283(24)
	Paris dulongensis H.Li & Kurita	KUN 0301542	KUN	KM242706	KM242937	KM242779	KM242854	DQ404275(24)
	Paris dunniana H.Lév.	S. W. Lee, s.n.	KUN	KM242707	KM242938	KM242780	KM242855	DQ404293(24)
	Paris fargesii Franch.	S. C. Kim, 001	*	KM242708	KM242939	KR233272	KM242856	DQ404285(24)
	Paris forrestii (Takht.) H.Li	KUN 0302514	KUN	KM242709	KM242940	KM242781	KM242857	DQ404276(24)
	Paris incompleta M.Bieb.	Nikoloz Manana Khutsishvil	NY	KM242710	JF942774(12)	AB018832(13)	–	DQ404271(24)
	Paris japonica (Franch. & Sav.) Franch.	Chase 29052	K	KM242711	KM242941	KM242782	KM242858	DQ404270(24)
	Paris luquanensis H.Li	S. C. Kim, 007	*	KM242712	KM242942	KM242783	KM242859	DQ404287(24)
	Paris mairei H.Lév.	Chase 17511	K	KM242713	KM242943	KM242784	KM242860	DQ404282(24)
	Paris marmorata Stearn			–	JF942785(12)	JF954904(12)	–	DQ404290(24)
	Paris polyphylla var. chinensis (Franch.) H.Hara	S. C. Kim, 006	*	KM242714	KM242944	KM242785	KM242861	DQ404286(24)
	Paris polyphylla Sm.	KUN 0301753	KUN	KM242715	KM242945	KM242786	KM242862	DQ404292(24)
	Paris polyphylla var. stenophylla Franch.	S. C. Kim, 005	*	KM242716	KM242946	KM242787	KM242863	KR233279
	Paris polyphylla var. yunnanensis (Franch.) Hand.-Mazz.	KUN 0301962	KUN	KM242717	KM242947	KM242788	KM242864	DQ404291(24)
	Paris quadrifolia L.	J. H. Kim et al. 20090905-025	GCU	KM242718	JN417472(7)	JN417382(7)	KM242865	DQ404272(24)
	Paris rugosa H.Li & Kurita	KUN 0302215	KUN	KM242719	KM242948	KM242789	KM242866	DQ404279(24)
	Paris thibetica Franch.	Chase 487	K	KM242720	KM242949	KM242790	KM242867	DQ404284(24)
	Paris vaniotii H.Lév.	KUN 0302439	KUN	KM242721	KM242950	KM242791	KM242868	DQ404277(24)
	Paris verticillata M.Bieb.	J. K. Hong, 011	GCU	KM242722	JN417471(7)	JN417381(7)	KM242869	DQ404274(24)
	Paris vietnamensis (Takht.) H.Li	S. C. Kim, 004	*	KM242723	KM242951	KM242792	KM242870	DQ404280(24)
	Pseudotrillium rivale (S.Watson) S.B.Farmer	Chase 18990	K	KM242724	KM242952	KM242793	KM242871	HG475380(8)
	Trillium albidum J.D.Freeman	F. H. Utech 84019	TI	KM242730	KM242961	KM242799	KM242881	DQ404266(24)
	Trillium amabile Miyabe & Tatew.	Hidehiko Kamizono 3	TI	KM242731	KM242962	KM242800	KM242882	–
	Trillium angustipetalum (Torr.) J. D. Freeman	F. H. Utech 84-008	TI	KM242732	KM242963	KM242801	KM242883	–
	Trillium camschatcense Ker Gawl.	J. K. Hong, 042	GCU	KM242733	JN417473(7)	JN417383(7)	KM242884	DQ404265(24)
	Trillium catesbaei Elliott	H. Koyama et al. 6549	TI	–	KM242964	KM242802	KM242885	KR233286
	Trillium cernuum L.			–	KF613056(14)	AB017380(15)	–	DQ404261(24)
	Trillium chloropetalum (Torr.) Howell	Chase 29048	K	KM242734	KM242965	KM242803	–	HG475376(8)
	Trillium discolor Hook.	D. E. Boufford 22828	TI	KM242735	KM242966	KM242804	KM242886	HG475375(8)
	Trillium erectum L.	Kim S. C. 2012-003	*	KM242736	KM242967	KM242805	KM242887	AF303667(5)
	Trillium erectum var. album (Michx.) Pursh	Chase 444	K	KM242737	KM242968	KM242806	KM242888	KR233283
	Trillium flexipes Raf.	D. E. Boufford 18077	TI	KM242738	KM242969	KM242807	KM242889	HG475392(8)
	Trillium govanianum Wall. ex D.Don	Chase 16955	K	KM242739	KM242970	KM242808	KM242890	HG475382(8)
	Trillium grandiflorum (Michx.) Salisb.	Kim S. C. 2012-002	*	KM242740	KM242971	KM242809	KM242891	AF303666(5)
	Trillium kurabayashii J.D.Freeman	F. H. Utech 84-382	TI	KM242741	KM242972	KM242810	KM242892	HG475377(8)
	Trillium lancifolium Raf.	Susan Farmer 20000117	*	KM242742	–	AB017394(15)	–	–
	Trillium luteum (Muhl.) Harb.	F. H. Utech 90-133	TI	KM242743	KM242973	KM242811	KM242893	DQ404268(24)
	Trillium maculatum Raf.	Susan Farmer 19990006	*	KM242744	KM242974	KM242812	KM242894	AF303665(5)
	Trillium ovatum Pursh	Chase 18989	K	KM242745	KM242975	KM242813	KM242895	DQ404262(24)
	Trillium petiolatum Pursh	F. H. Utech 84-243	TI	KM242746	KM242976	KM242814	KM242896	–
	Trillium recurvatum L.C.Beck	F. H. Utech 87-034	TI	KM242747	KM242977	KM242815	KM242897	HG475390(8)
	Trillium reliquum J.D.Freeman	F. H. Utech 83-135	TI	KM242748	KM242978	KM242816	KM242898	–
	Trillium sessile L.	Chase 29047	K	KM242749	KM242979	KM242817	KM242899	HG475379(8)
	Trillium simile Gleason	Susan Farmer 20050171	*	KM242750	–	AB017407(15)	–	–
	Trillium smallii Maxim.	Tomiki kobayashi 44149	TI	KM242751	KM242980	KM242818	KM242900	KR233284
	Trillium sulcatum T.S.Patrick	Susan Farmer 19920109	*	KM242752	–	AB017407(15)	–	HG475385(8)
	Trillium tschonoskii Maxim.	J. K. Hong, 037	GCU	KM242753	JN417474(7)	JN417384(7)	KM242901	DQ404269(24)
	Trillium undulatum Willd.	W. G. Dore 14157	NY	KR233264	KM242981	KR233273	KM242902	HG475383(8)
	Trillium vaseyi Harb.	D. E. Boufford 23596	TI	KR233265	KM242982	KM242819	KM242903	–
	Trillium × miyabeanum Tatew. ex J.Samej.	Hidetoshi Kato S.N.	TI	KM242754	KM242983	KM242820	KM242904	–
Xerophylleae	Xerophyllum asphodeloides (L.) Nutt.	R. L. Wilbur 7008	NY	–	KM242998	KM242834	KM242924	AF303668(5)
	Xerophyllum tenax (Pursh) Nutt.	Chase 527	K	KM242764	JN417485(7)	JN417394(7)	KM242925	AF303669(5)
Liliaceae	Clintonia udensis Trautv. & C.A.Mey.	J.K.Hong 053	GCU	KM242695	JN417446(7)	JN417357(7)	KM242840	–
	Lilium hansonii Leichtlin ex D.D.T.Moore	D.K.Kim 05-026	GCU	JX903929(9)	JX903239(9)	JX903655(9)	JX903510(9)	–
	Tricyrtis macropoda Miq.	J.K.Hong 048	GCU	KM242729	JN417449(7)	JN417360(7)	KM242880	–
Colchicaceae	Colchicum speciosum Steven	LHMS 266	*	KC796810(16)	KC796866(16)	KC796916(16)	KM242841	JX012306(17)
	Disporum smilacinum A.Gray	J.K.Hong 022	GCU	KC796814(16)	JX903236(9)	JN417396(7)	–	AJ551358(18)
	Uvularia perfoliata L.	Atha, Adamsons 6154	*	KC796829(16)	KC796881(16)	KC796932(16)	KM242905	AB858304(19)
	Wurmbea dioica subsp. brevifolia R.J.Bates	MEL 2301322	*	KC796834(16)	KC796887(16)	KC796834(16)	KM242923	–
Petermanniaceae	Petermannia cirrosa F.Muell.			AY465558(20)	AY465714(20)	JQ435572(21)	AY465662(20)	–
Smilacaceae	Smilax rotundifolia L.			AY465554(20)	AY465710(20)	JQ711017(22)	AY465659(20)	JQ711095yyyy(22)

*

Same DNA accession used in (1) Soltis, Soltis & Chase (1999), (2) Vinnersten & Bremer (2001), (3) Fuse & Tamura (2000), (4) Petersen et al. (2013), (5) Zomlefer et al. (2001), (6) Chen et al. (2013), (7) Kim et al. (2013), (8) Pellicer et al. (2014), (9) Chase et al. (2000), (10) A. Jones, D.S. Del Vecchio, V. Savolainen, unpubl. data, (11) Liao et al. (2007), (12) Li et al. (2011), (13) Osaloo & Kawano (1999), (14) Newmaster et al. (2013), (15) Osaloo et al. (1999), (16) Nguyen, Kim & Kim (2013), (17) Karakas Metin et al. (2014) , (18) Vinnersten & Reeves (2003), (19) Tamura et al. (2013), (20) Graham et al. (2006), (21) Seberg et al. (2012), (23) Zhao et al. (2013), (24) Ji et al. (2006).

*

Living material.

Some samples were collected as a fresh leaf material from South Korea and China for DNA extraction; others were mainly obtained from the DNA Bank of the Royal Botanic Gardens, Kew (http://apps.kew.org/dnabank/homepage.html).

DNA extraction and PCR amplification

Total genomic DNA was extracted from 0.5–1.0 g of fresh or silica gel-dried leaves using a modified 2 × CTAB extraction method (Doyle & Doyle, 1987). Extracted DNA was confirmed on a 1.0% agarose gel and the concentration was measured with a UV-Vis spectrophometer (BioSpec-nano/0.7 mm; Shimadzu). For the molecular phylogenetic analysis, four genes [atpB (Hoot, Culham & Crane, 1995), rbcL (Hayashi & Kawano, 2000), matK (Osaloo et al., 1999; Hayashi & Kawano, 2000; Molvray, Kores & Chase, 2000) and ndhF (Olmstead & Sweere, 1994; Terry, Brown & Olmstead, 1997)] were amplified. Additionally, trnL-F sequences available from GenBank were added to the data matrix and some were directly sequenced for this study (Table 2). Details of primer sequences and the thermocycler programme for each marker are presented in Table 3.

Table 3.

Primer references and PCR conditions

Region	Primer name	Primer sequence (5′–3′)	Reference	Cycler programme
atpB	atpB 2F	TATGAGAATCAATCCTACTACTTCT	Hoot et al. (1995)	94 °C for 3 min, 30 cycles of [94 °C for 1 min, 55 °C for 1 min, 72 °C for 2 min], 72 °C for 7 min
	atpB 1494R	TCAGTACACAAAGATTTAAGGTCAT	Hoot et al. (1995)
	atpB 611F	AACGTACTCGTGAAGGAAATGATCT	Hoot et al. (1995)
	atpB 766R	TAACATCTCGGAAATATTCCGCCAT	Hoot et al. (1995)
rbcL	rbcL N'	ATGTCACCACAAACAGAAACT	Hayashi & Kawano (2000)	94 °C for 2 min, 35 cycles of [94 °C for 1 min, 50 °C for 1 min, 72 °C for 1 min], 72 °C for 7 min
	rbcL DBRBAS2	GCTTGAATTCGAATTTGATC	Hayashi & Kawano (2000)
	rbcL S3(630F)	TTTATGCGTTGGAGAGACCG	Hayashi & Kawano (2000)
	rbcL 840R	TTGTCGCGGCAATAATGAGCC	Hayashi & Kawano (2000)
matK	trnK 3914FM	ATCTGGGTTGCTAACTCAATGG	Hayashi & Kawano (2000)	94 °C for 2 min, 35 cycles of [94 °C for 30 s, 55 °C for 1 min, 72 °C for 3 min], 72 °C for 7 min
	trnK 2R	AACTAGTCGGATGGAGTAG	Hayashi & Kawano (2000)
	matK -19F	CGTTCTGACCATATTGCACTATG	Molvray et al. (2000)
	matK TF2	TGTACTAATAAATCCTTCGGCGG	Osaloo et al. (1999)
	matK 8R	AAAGTTCTAGCACAAGAAAGTCGA	Hayashi & Kawano (2000)
ndhF	ndhF 1F	ATGGAACAKACATATSAATATGC	Olmstead & Sweere (1994)	94 °C for 3 min, 35 cycles of [94 °C for 1 min, 55 °C for 2 min, 72 °C for 1 min], 72 °C for 7 min
	ndhF 2110R	CCCCCTATATTTGATACCTTCTCC	Olmstead & Sweere (1994)
	ndhF 1101F	GGAACCTATTGTGTGGATATTCACC	Terry et al. (1997)
	ndhF 1318R	CGAAACATATAAAATGCRGTTAATCC	Olmstead & Sweere (1994)
trnL-F	c	CGAAATCGGTAGACGCTACG	Taberlet et al. (1991)	95 °C for 3 min, 30 cycles of [95 °C for 1 min, 50 °C for 1 min, 72 °C for 2 min], 72 °C for 7 min
	d	GGGGATAGAGGGACTTGAAC	Taberlet et al. (1991)
	e	GGTTCAAGTCCCTCTATCCC	Taberlet et al. (1991)
	f	ATTTGAACTGGTGACACGAG	Taberlet et al. (1991)

The PCR amplifications were performed in 25-μL reactions containing 1 unit of Taq DNA polymerase (SolGent), 2.5 µL 10× reaction buffer (100 mm Tris-HCl, pH 8.0, 500 mm KCl, 15 mm MgCl₂; SolGent), 1 µL 2.5 mm dNTPs (SolGent), 1 µL forward and reverse primers (0.1 pmol μL^–1) and 80–100 ng template DNA using a GeneAmp PCR System 9700 (Applied Biosystems). PCR products were confirmed on a 1.0% agarose gel.

Sequencing and alignment

PCR products were purified using the PCRquick-spin Kit (INTRON Biotechnology) according to the manufacturer's protocols. Cycle sequencing reactions were performed using the GeneAmp PCR System 9700 (Applied Biosystems) with the ABI Prism Big Dye reaction kit (ver. 3.1) according to the manufacturer's protocols. Sequence editing and assembly were performed using Sequencher (ver. 5.2.4, Gene Codes Corp.). For all alignments, BioEdit (ver. 7.0.5.3), Clustal W (ver. 7.1.3, Hall, 2005) and MacClade (ver. 4.0, Maddison & Maddison, 2000) were used, after which the sequences were manually adjusted following the guidelines of Kelchner (2000).

Phylogenetic analyses

For the phylogenetic analysis, three different methods, maximum parsimony (MP), maximum likelihood (ML) and Bayesian inference (BI) were used. MP analyses were conducted using PAUP* (ver. 4.0b10, Swofford, 2007), and we followed widely used protocols for bootstrapping (Fay et al., 2000; Clarkson et al., 2004). For the heuristic analyses, we used ‘subtree-pruning-regrafting (SPR)’ branch swapping with ‘MULPARS’ in operation, permitting ten trees to be held at each step to reduce time for searching suboptimal ‘islands’ of trees. Support values for the relationships discovered by analysis of each matrix were calculated by performing bootstrap analyses of 1000 heuristic search replicates using the SPR branching swapping algorithm with ten random additions per replicate. We used the following categories of bootstrap percentages (BS_MP): weak, 50–74%; moderate, 75–84%; strong, 85–100% (Chase et al., 2000). ML tree searches and ML bootstrap searches were performed using a RAxML Blackbox web-server (http://phylobench.vital-it.ch/raxml-bb/, Stamatakis, Hoover & Rougemont, 2008). Using the ML estimate of the site-specific evolutionary rates for GTR+I+G. The RAxML analyses were run with a rapid bootstrap analysis using a random starting tree and 1000 ML bootstrap replicates. The ML tree was visualized in FigTree (ver. 1.4).

Bayesian analysis was performed using MrBayes (ver 3.1.2, Ronquist & Huelsenbeck, 2003). The substitution model for the individual and combined analyses was determined with jmodeltest (ver. 2.1.3, Darriba et al., 2012) under the Bayesian information criterion (BIC). The chosen models were GTR+G (nst = 6, rates = gamma) for matK and the trnL intron, and GTR+I+G (nst = 6, rates = Invgamma) for atpB, rbcL, ndhF, trnL-F spacer and combined data. For the analysis, two independent runs of Markov chains, each starting with a random tree, were processed in ten threads simultaneously for 50 million generations, sampling trees every 1000 generations. Approximately 25% of the trees were discarded as burn-in samples. The Bayesian majority rule consensus tree was visualized in FigTree (ver. 1.4). MP and ML bootstrap (BS_MP, BS_ML) and Bayesian posterior probability (PP_BI) values were summarized on the Bayesian tree node. PP ≥ 0.95 was considered as strong support.

Morphological character comparison in Melanthiaceae

To compare morphological character evolution in genera of Melanthiaceae, we selected seven characters (calcium oxalate crystals, rootstock, inflorescences, ovary, absence or presence of a tepal adnate to ovary, absence or presence of a recurved stigma and absence or presence of a beaklike style) that were considered as putatively diagnostic characters in previous studies (Rydberg, 1903; Dahlgren et al., 1985; Goldblatt, 1995; Zomlefer, 1997a; Tamura, 1998b; Osaloo & Kawano, 1999; Chen et al., 2000; Rudall et al., 2000; Flora of North America Editorial Committee, 2002); they were scored as discrete binary or multistate characters.

These morphological characters were reconstructed with likelihood and parsimony methods implemented in Mesquite (ver.2.7.5, Maddison & Maddison, 2001). All characters were treated as unordered and equally weighted and missing data were coded as unknown. An ML approach using Markov k-state 1 parameter model (Mk1; Lewis, 2001) was used to reconstruct the character evolution. To account for phylogenetic uncertainty, the ‘trace-characters-over-trees’ command was used to calculate ancestral states at each node including likelihood probabilities. A data matrix was constructed for the seven characters and a character diagnostics analysis was performed after combining with the molecular data matrix by using a heuristic search in PAUP*. We confirmed the log file of the result and mapped the morphological characters onto a molecular phylogenetic tree to compare patterns.

Results

There was no length variation in rbcL, but the other loci showed variable length between taxa. The aligned sequence lengths of the genes were 1494 (atpB), 1384 (rbcL), 1843 (matK including partial trnK) and 2088 positions (ndhF). Of these, matK had the most variable and greatest number of potentially parsimony-informative sites. The number of potentially parsimony-informative sites was 200 (13.4%), 209 (15.1%), 575 (31.1%) and 578 (27.6%) for atpB, rbcL, matK and ndhF, respectively. The trnL-F matrix contained 842 and 521 aligned characters for the trnL intron and trnL-F spacer, respectively, of which 225 (26.7%) and 156 (29.9%) were potentially parsimony-informative. We also found specific indels at the tribe, genus and subgenus level in matK and ndhF (data not shown).

Phylogenetic relationships based on the combined data set

The topologies of the MP strict consensus tree, ML majority rule consensus tree and Bayesian majority rule consensus tree generated from the combined data set were congruent with each other. These demonstrated the monophyly of the family and the relationships of the five tribes. All tribes were monophyletic (Fig. 1A, B) and in the same relative positions as in previous studies, despite the more restricted taxon sampling in those studies (Rudall et al., 2000; Zomlefer et al., 2001, 2006; Fay et al., 2006; Kim et al., 2013). Melanthieae were sister to the rest of the family and the remaining taxa were divided to two major clades: Parideae + Xerophylleae (BS_MP = 96%, BS_ML = 100%, PP_BI = 1.00) and Chionographideae + Heloniadeae (BS_MP = 96%, BS_ML = 100%, PP_BI = 1.00).

Figure 1.

A, Bayesian tree based on the combined data of five plastid genes (atpB, rbcL, matK, ndhF and trnL-F). Bootstrap values (%) of the maximum parsimony (MP) and maximum likelihood (ML) analyses, and PP values from the Bayesian analysis are shown (BS_MP/BS_ML/PP_BI). Dashes indicate that branches are supported by < 60% BS_MP, BS_ML and PP_BI. Grey box, genera; black box, subgenera. Tribal abbreviations: Helo = Heloniadeae, Chio = Chionographideae, Mela = Melanthieae. Generic abbreviations; Yps = Ypsilandra, Hel = Helonias, Chi = Chionographis, Cha = Chamaelirium, Ami = Amianthium, Ant = Anticlea, Mel = Melanthium, Sch = Schoenocaulon, Tox = Toxicoscordion, Ste = Stenanthium, Zig = Zigadenus. B, Bayesian tree based on the combined data of five plastid regions (atpB, rbcL, matK, ndhF and trnL-F). Bootstrap values (%) for the maximum parsimony (MP) and maximum likelihood (ML) analyses, and PP values from the Bayesian analysis are shown (BS_MP/BS_ML/PP_BI). Dashes indicate that branches are supported by less than 60% BS_MP, BS_ML and PP_BI. Grey box, genera; black box, subgenera. Tribal abbreviations; Pari = Parideae, Xero = Xerophylleae. Generic abbreviations; Ps = Pseudotrillium, Xer = Xerophyllum. B, Bayesian tree based on the combined data of five plastid regions (atpB, rbcL, matK, ndhF, and trnL-F). Bootstrap values (%) for the maximum parsimony (MP) and maximum likelihood (ML) analyses, and PP values from the Bayesian analysis are shown (BS_MP/BS_ML/PP_BI). Dashes indicate that branches are supported by less than 60% BS_MP, BS_ML and PP_BI. Grey boxes indicate genera, black boxes indicate subgenera. Tribal abbreviations; Pari = Parideae, Xero = Xerophylleae. Generic abbreviations; Pse= Pseudotrillium, Xer = Xerophyllum.

In the present study, we aimed to clarify the phylogenetic relationships in Melanthiaceae sensu APG III with expanded sampling covering all genera and multiple plastid loci. The monophyly of the family was strongly supported (BS_MP = 96%, BS_ML = 100%, PP_BI = 1.00) and support was higher than in previous studies of Liliales (e.g. Chase et al., 2000, BS_MP = 83%; Rudall et al., 2000, BS_MP = 86%; Kim et al., 2013, BS_ML = 72%). The phylogenetic positions of all genera of the family were clearly confirmed. In Melanthieae, Zigadenus glaberrimus Michx. was the first branching taxon and Toxicoscordion formed the subsequent branch as a sister of the remainder of the tribe. Schoenocaulon A.Gray was then sister to the remaining genera. Melanthium was sister to Stenanthium (BS_MP = 60%, BS_ML = 100%, PP_BI = 1.00) and Veratrum was sister to Amianthium A.Gray (BS_MP = 77%, BS_ML = 93%, PP_BI = 1.00) in the present study. Veratrum formed two clades.

Chionographideae consisted of two genera (Chamaelirium Willd., Chionographis Maxim.) and were strongly supported (BS_MP = 100%, BS_ML = 100%, PP_BI = 1.00). Heloniadeae were strongly supported (BS_MP = 98%, BS_ML = 100%, PP_BI = 1.00), and Helonias bullata L. were sister to Ypsilandra Franch. + Heloniopsis A.Gray. In Parideae, Pseudotrillium rivale (S.Watson) S.B.Farmer was sister to the remainder of the tribe. In Trillium, T. govanianum Wall. and T. undulatum Willd. formed the first-branching clade. Trillium subgenus Phyllantherum was monophyletic with strong support (BS_MP = 99%, BS_ML = 100%, PP_BI = 1.00), whereas subgenus Trillium was paraphyletic. Paris was divided into two clades corresponding to subgenera Paris and Daiswa.

Character reconstruction in Melanthiaceae

Morphological character evolution in Melanthiaceae mapped on the Bayesian tree is shown in Figure 2. In Melanthieae, calcium oxalate crystals form raphides and styloids whereas they form cuboidal crystals in the other tribes (Fig. 2, character a, two steps, CI (Consistency index) = 0.5) . The rootstock is a rhizome in Parideae, Heloniadeae, Chionographideae and Zigadenus glaberrimus. Different types of rootstock occur in Melanthieae (except Z. glaberrimus) and Xerophylleae (Fig. 2, character b, two steps, CI = 0.5). The inflorescence is paniculate in Melanthieae, Heloniadeae and Chionographideae. However, in Schoenocaulon (Melanthieae) the inflorescence is spike-like and in Chionographis and Ypsilandra the inflorescence is spike-like and umbellate, respectively. In Parideae the inflorescence is a solitary flower and in Xerophylleae it is corymbose (Fig. 2, character c, five steps, CI = 0.2). The superior ovary was confirmed for Melanthiaceae, but in Amianthium, Veratrum, Anticlea, Melanthium and Stenanthium (Melanthieae) the ovary is semi-inferior (Fig. 2, character d, two steps, CI = 0.5). Fusion of tepals to the base of the ovary occurs in three genera (Anticlea, Melanthium and Stenanthium; Fig. 2, character e, two steps, CI = 0.5). The recurved stigma and beak-like style occur in Melanthium and Stenanthium (Fig. 2, characters f and g, two steps, CI = 0.5, respectively).

Figure 2.

Character reconstructions of seven morphological characters in Melanthiaceae mapped on to the Bayesian tree from Fig. 1.

Discussion

Phylogenetic relationships in Melanthiaceae

Classification systems based on the morphological characteristics of Melanthiaceae have undergone many changes (Table 1) and there has been controversy surrounding the definition and circumscription of the family, leading to transfers among genera and tribes. In the APG system (APG, 1998; APG II, 2003; APG III, 2009) Melanthiaceae (including Trilliaceae) were placed in Liliales, based on molecular phylogenetic data. This was supported by the morphological characters extrorse anthers and ovaries often with three distinct styles. Following earlier molecular studies, Melanthiaceae composed of five tribes were proposed by many researchers (e.g. Chase et al., 2000; Rudall et al., 2000; Kim et al., 2013). The tree topology for Melanthiaceae obtained here from five plastid regions is in accordance with the overall topologies reported in previous studies of Liliales (Chase et al., 2000; Rudall et al., 2000; Kim et al., 2013). However, Petermannia F.Muell., which was recovered as sister to this family with moderate support by Kim et al. (2013), was found to be more closely related to Colchicaceae than to Melanthiaceae in this study. It seems that this different position of Petermannia is due to the use of other data in addition to rbcL alone as used in some previous studies.

Phylogenetic relationships of tribes

Our data for five plastid loci suggest slightly different relationships among the genera of Melanthieae identified by Zomlefer et al. (2001). Although the position of Z. glaberrimus as the first-branching clade in Melanthieae was the same, there were conflicts concerning the relationships among the remaining taxa, especially regarding the positions of Melanthium, Schoenocaulon and Toxicoscordion (Fig. 3). Zomlefer et al. (2001) suggested an expanded generic concept for Veratrum, including Melanthium, based on their molecular phylogenetic study and they delimited it from the other genera by the synapomorphic characters of pubescence of vegetative parts (at least of the inflorescence) and broadly winged seeds (Zomlefer, 1997a). Our results indicate that both genera should be recognized as independent taxa. In Veratrum, sections Fuscoveratrum and Veratrum were recognized and supported in previous studies. The positions of Toxicoscordion and Schoenocaulon were reversed relative to the tree of Zomlefer et al. (2001) and their positions were strongly supported in our analyses (Fig. 3). This conflicting phylogenetic relationship is discussed in more detail in the next section referring to morphological characters.

Figure 3.

Comparison of phylogenetic relationships and positions among the genera in Melanthieae. A, summarized MP tree of Zomlefer et al. (2001) based on the combined ITS 1 & 2 sequence data; B, summarized tree based on the present study using combined data of five plastid loci (atpB, rbcL, matK, ndhF and trnL-F). Numbers above branches are bootstrap percentages (BP) obtained from maximum parsimony (left) and maximum likelihood (right) analyses.

Chionographideae are composed of Chamaelirium and Chionographis. Heloniadeae are also a comparatively small tribe composed of three genera (Heloniopsis, Ypsilandra and Helonias). Helonias bullata L. was sister to the remaining taxa and Ypsilandra and Heloniopsis formed a clade with strong support. In addition, there are three tribe-specific indels in matK and ndhF (data not shown). Xerophylleae are a monotypic tribe containing only two species [Xerophyllum tenax (Pursh) Nutt. and X. asphodeloides (L.) Nutt.]. They were considered the sister group of Melanthieae on the basis of morphological characters (e.g. calcium oxalate crystals as raphides and styloids, bulb-like rhizome) by Goldblatt (1995), but molecular phylogenetic analysis demonstrated a sister-group relationship with Parideae instead.

Parideae are the most distinctive group in the family due to the autapomorphies of a solitary flower, berries, septal nectaries, large chromosomes and basic chromosome number x = 5. Therefore, they had been treated as a separate family Trilliaceae (e.g. Tamura, 1998b) before the recent familial circumscription was established and supported by molecular phylogenetic studies. In Paris, two subgenera and five sections [sections Paris and Kinugasa (Tatew. & Sutô) Hara in subgenus Paris; Euthyra (Salisb.) Franch., Thibeticae H.Li and Axiparis H.Li in subgenus Daiswa (Raf.) H.Li] were recognized by Ji et al. (2006) based on rhizome, stamen, ovary shape, placentation, fruit, seed and pollen characters and molecular data. This subgeneric concept was also supported in the present study. In Trillium, which comprised two subgenera divided by the presence of a pedicel, subgenus Phyllantherum was monophyletic, whereas subgenus Trillium was paraphyletic. Pseudotrillium rivale, first recognized as Pseudotrillium by Farmer & Schilling (2002) on the basis of morphological characters including a thick, heart-shaped leaf, spotted petals and a flower stalk which extends until the ripe fruit touches the ground, and molecular data, was sister to the rest of the tribe with strong support. Trillium govanianum, classified as the separate genus Trillidium by Farmer & Schilling (2002) based on pollen shape (ellipsoidal) and apertures (monosulcate) and narrow anther filaments, was more similar to Paris than to Trillium. The North American species Trillium undulatum was sister to the remainder of Trillium. To clarify the phylogenetic relationships of Trillidium, further studies are needed.

Morphological character evolution in Melanthiaceae

We discussed character evolution based on the phylogenetic relationships recovered here. Using previous phylogenetic and taxonomic studies of Melanthiaceae based on morphological characters (Rudall et al., 2000; Goldblatt, 1995; Tamura, 1998b; Osaloo & Kawano, 1999; Rydberg, 1903; Zomlefer, 1997a; Dahlgren et al., 1985; Flora of North America Editorial Committee, 2002; Wu & Raven, 2000), we examined seven representative morphological features to identify key characters that can be used to reflect the relationships in Melanthiaceae.

Calcium oxalate crystals as raphides and styloids and paniculate inflorescences occur commonly in Melanthieae. A bulb-like root derived from the rhizome in the tribe was confirmed with the exception of Zigadenus (Goldblatt, 1995; Zomlefer, 1997a). In Schoenocaulon, the only genus found in South America, the spike-like inflorescence was derived from the paniculate inflorescence. A superior ovary is found widely in Melanthiaceae (Dahlgren et al., 1985; Zomlefer, 1997a; Flora of North America Editorial Committee, 2002) and this has been considered as a synapomorphy for this family. However, Amianthium, Veratrum, Stenanthium, Melanthium and Anticlea have a semi-inferior ovary; this is considered to be a derived character. Tepals fused to the ovary are a notable feature in Stenanthium, Melanthium and Anticlea (Rydberg, 1903; Dahlgren et al., 1985; Flora of North America Editorial Committee, 2002). These characters could be considered as potential synapomorphies for these clades. Stenanthium and Melanthium shared the recurved stigma and beak-like style (Flora of North America Editorial Committee, 2002). From the molecular phylogenetic study and morphological character comparison presented here, we were able to obtain a well-supported phylogenetic tree for Melanthieae, in which an expanded Veratrum s.l. was not supported.

Updated classification of Melanthiaceae

Most of the previous phylogenetic studies of Melanthiaceae focused on the tribal level or included more limited sampling. To improve our knowledge on the evolution of this family, we increased taxon sampling and used several outgroups from the nearest families of Liliales. As a result of our study, we suggest the following classification system for Melanthiaceae.

1. Tribe Melanthieae (eight genera) Veratrum L., Amianthium A.Gray, Anticlea Kunth, Melanthium J.Clayton ex L., Schoenocaulon A.Gray, Toxicoscordion Rydb., Stenanthium (A.Gray) Kunth, Zigadenus Michx.

2. Tribe Chinographideae (two genera) Chamaelirium Willd., Chionographis Maxim.

3. Tribe Heloniadeae (three genera) Helonias L., Heloniopsis A.Gray, Ypsilandra Franch.

4. Tribe Xerophylleae (one genus) Xerophyllum Michx.

5. Tribe Parideae (three genera) Pseudotrillium S.B.Farmer, Trillium L., Paris L.

Acknowledgements

The authors appreciate Dr Susan Farmer of Abraham Baldwin Agricultural College who kindly provided the American Trillium spp. used in this study and the herbaria KUN, NY, US, NSW, KYO, PE, HAST and TI for permission to use materials for DNA extraction. This work was supported by National Research Foundation of Korea (NRF) Grant Fund (MEST 2010-0029131).

Author notes

†

These authors equally contributed to this study.