To investigate the potential role of human papillomavirus (HPV) infection in the pathogenesis of esophageal carcinomas in the Anyang area of China, we have evaluated specimens collected by balloon cytology examination from volunteers in two regions with significantly different incidences of esophageal carcinoma. 138 donors were from a village in a county with an esophageal carcinoma (EC) age-adjusted mortality rate of 132×105, the remaining 68 were resident in a second village from another county with an EC mortality rate of 52×105. Specimens were evaluated using both polymerase chain reaction (PCR) amplification and in situ hybridization (ISH) protocols. PCR results showed that the prevalence of the human papillomavirus type 16 (HPV-16) E6 gene in the high incidence area was 1.9-fold higher than that of the low incidence area (72 and 37%, respectively, P < 0.01). Moreover, the positive rate corresponded with pathology grade. Similar results were obtained with the HPV-16 E7 gene. As the cells undergoing cytopathological progress, the HPV-16 E6 positive rate was increased, in both villages. In contrast to HPV-16 E6 and E7, detection of the HPV L1 gene was consistently lower, and its prevalence decreased with increasing dysplasia grades (P < 0.05). By ISH analyses, the expression rate of HPV-16 E6 in the specimens collected from the high incidence area was 2.2-fold higher than those from the low incidence area (49 versus 22%, respectively; P < 0.05), and transcription of the E6 gene paralleled cytopathology. HPV-18 was also detected in 17 and 15% of the specimens from the high and low incidence areas, respectively, but most of these samples were also simultaneously HVP-16 positive. These results suggest that HVP-16 plays a causative role in the high incidence of esophageal cancer in the Anyang region of China.

Introduction

Esophageal carcinoma is one of the major cancers in China. The area of Anyang is located at the foot of Tai Hang Mountain in Henan province and has the highest incidence and mortality of esophageal cancer in China. Extensive investigations on natural geographic environment, life habits and trace elements in the diet have failed to establish the etiology of esophageal cancer in this district (1,12).

Human papillomaviruses (HPV) play an important role in the development of squamous cell carcinomas at various body sites, including the anogenital, upper respiratory and digestive tracts. DNA genomes from 82 different HPV types have been cloned and characterized to date. Among them, HPV type 6, 11, 16, 18 and 31 represent the most common types found in the epithelium of squamous cell hyperplasias, dysplasias and carcinomas. HPV fall into high-risk (HPV-16, -18 and -31) and low risk types (HPV-6 and -11) primarily based on their association with neoplasms in the anogenital tract. Members of the high risk HPV group promote carcinogenesis and their DNA usually integrates into the host genome, whereas the low risk HPV types primarily exist in benign tissues and show no evidence of viral integration (15).

HPV infection was first suggested as being a contributory factor in the development of esophageal cancer in 1982 by Syrjanen et al. (2), who described condylomatous changes (the cytopathic changes of HPV infection) in one patient's esophageal specimens. Later, the presence of HPV antigen was demonstrated by immunohistochemical techniques (20). Subsequently, many studies on HPV infection in esophageal cancer have been reported (311). However, the involvement of HPV remains controversial, since different studies have demonstrated infection rates varying from the lowest at 0% to the highest at 67%. This range may not accurately reflect the true situation. One possible reason for this variation is the use of different methods to measure infection rates: polymerase chain reaction (PCR) amplification targeting different fragments of the virus, Southern blot, in situ hybridization and immunohistochemistry have all been used to develop the data. Another possibility is that most studies have only used tumor tissues at advanced stages, whereas exposed `normal' esophageal epithelium has not been tested. Finally, the incident rate of this disease varies significantly all over the world. In the Anyang area, the esophageal cancer age-adjusted mortality rate among its 13 counties varies from 141×105 to 23×105, which offers an opportunity to evaluate these three possibilities. Accordingly, we collected specimens by esophageal balloon cytology examination from volunteers living in two villages. The villages we selected for analysis were Shangzhuang and Tangmiao, which are located in the counties of Anyang and Neihuang, and have an age-adjusted mortality rate of esophageal carcinoma of 132×105 and 52×105, respectively. They are situtuated approximately 100 km apart. Shangzhuang is a mountain village. By comparison, Tangmiao is situated in the plain area. Partly because of the natural environment and traffic, the economic conditions in Shangzhuang are poor in relation to that in Neihuang. We have conducted parallel assays using PCR and in situ hybridization to detect HPV.

Materials and methods

Esophageal balloon cytology examination, samples collection and preparation

The specimens evaluated for this report were collected from 206 individuals over 35 years of age that participated in a pilot study designed for early detection of esophageal cancer in China. The group from the high incidence village included 61 males and 77 females with an average age of 54.9 years. The second group of 68 volunteers from a relatively low incident village included 23 males and 45 females with an average age of 56.8 years. Volunteers had to swallow a deflated balloon, which was then expanded and gently removed, and their esophageal epithelial cells were then collected. In the process of balloon cytology examination, a new balloon was used for each individual and great care was taken thereafter to avoid contamination of the samples. Cells on the surface of the balloon were smeared onto slides and sent to the Department of Pathology, Anyang Tumor Hospital for cytological diagnosis. Parallel slides were collected for in situ hybridization (ISH) of HPV-16 and -18 E6 genes. After the slide smears had been taken, the remaining cells on the balloon were washed off with saline and concentrated by centrifugation at 4000 g for 5 min. A conspicuous cell precipitation was seen in the tube. The cell precipitation was dissolved in 500 μl lysis buffer (10 mM Tris–HCl pH 7.8, 100 mM NaCl, 10 mM EDTA, 0.5% SDS) and great care was taken in transportation of the tube and in the following DNA extraction procedure to avoid DNA fragmentation.

DNA extraction

Proteinase K (20 mg/ml; 10 μl) was added to the cell lysate. After incubation at 55°C overnight, the DNA was extracted with phenol/chloroform and precipitated with cold ethanol. DNA was dissolved in water and the concentration was determined from its optical density.

PCR

The integrity of DNA was confirmed by amplification of each sample with microsatellite primers (D3S1561, GIBCO BRL). The presence of HPV DNA was evaluated by PCR using type-specific primers for the HPV E6 gene of HPV types 16 and 18 and the HPV E7 gene of HPV type 16. Detection of these genes was undertaken because HPV-16 and -18 represent the most common HPV types found in esophageal squamous cell carcinomas and the E6/E7 genes are recognized oncogenes that provide the virus with its transforming capabilities. We designed HPV-16 E6/E7 and HPV-18 E6 primers according to both the full-length sequences of the HPV-16 and HPV-18 genomes in GenBank and also by reference to the literature (7,9,18). We also evaluated HPV using consensus primers for the HPV L1 gene, primers MY09/MY11 according to Manos (17), since this viral capsid gene has been used by previous investigators to evaluate HPV infection in esophageal tumors (6). Primers sequences and their position in the HPV genome are summarized in Table I. DNA from a HPV type 16 positive esophageal cancer sample was used as a positive control (13) for HPV-16, and HeLa cell DNA as a positive control for HPV-18. We used HPV-16 E6, E7 primers for amplification in HeLa cell DNA (HPV-18 positive) and HPV-18 E6 primers in HPV-16 positive esophageal cancer sample as a negative control and to verify the specificity of these primers.

All PCR reactions were performed in a total volume of 20 μl. PCR mixture contained 10 mM Tris–HCl pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.01% gelatin, 200 pmol each primer, 2 U Taq DNA polymerase and 100 ng DNA. The cycling conditions were 94°C for 45 s, 58°C for 45 s and 72°C for 45 s for 35 cycles. PCR products were electrophoresed on 1.5% agarose gel and visualized with ethidium bromide staining. We also repeated the PCR assay in a different laboratory (located on a different floor of the building) to verify our results. HPV-16 E7 PCR products were digested with the endonuclease restriction enzyme AccI before electrophoresis to check that they were genuine.

In situ hybridization

Slides smeared with esophageal epithelial cells were fixed with 4% paraformaldehyde followed by addition of 0.2 mol/l HCl at room temperature for 10 min. Then the cells were digested with 100 μg/ml proteinase K at 37°C for 7 min. HPV-16 E6 or HPV-18 E6 (25–50 ng) probes labeled with digoxin were added into the hybridization solution containing 50% formamide, 4× SSC, 5% dextran sulfate, 5× Denhardt's solution and 200 mg/ml denatured salmon sperm DNA. The slides were incubated in 20 μl of the above solution overnight. The hybridization temperature was 42°C. After hybridization, the slides were washed with 2× SSC and 1× SSC for 30 min each. Antidigoxin antibody conjugated with alkaline phosphatase was added to the samples for 30 min at 37°C. Purple-blue ISH signals were developed by incubating slides in NBT/BCIP for 15 min. The reaction was stopped by washing the slides with PBS (pH 7.4). The slides were observed under the microscope and pictures were taken for analysis. Slides with HPV-16 positive esophageal cancer cells and HeLa cells were used as positive controls. The hybridization solution without probe was used as a negative control. Instead of sense probe, we used blank hybridization solution as a negative control because it is reported that integration of HPV DNA into a transcriptionally active region of the host chromosome could account for fusion transcripts which are initiated from a cellular promoter and which extend across the whole or part of the integrated viral genome thereby giving rise to viral sense and/or antisense transcripts (26,27).

The E6 gene of HPV-16 and -18 (full-length plasmids were the gift from Dr Zur Hausen, Deutsches Krebsforshungszentrum, Heidelberg, Germany) were cloned into PGEM-T-easy vector (Promega, Madison, WI) by PCR using primers 5′-ATGCACCAAAAGAGAACTGC-3′ and 5′-ACAAGACATACATCGACCGG-3′ for HPV-16 E6, and 5′-GCGCTTTGAGGATCCAACAC-3′ and 5′-ACGAATGGCACTGGCCTCTA-3′ for HPV-18 E6. PCR products were purified and ligated into the vector. Then the constructed vector was transfected into Escherichia coli, and positive clones were selected and determined by direct sequencing. The probes were prepared by in vitro transcription using a kit purchased from Boehringer (Mannheim, Germany). Plasmids containing the E6 gene were linearized by SalI digestion, and the T7 RNA polymerase was used for in vitro transcription according to the manufacturer's instructions. Antisense probes were labeled with digoxin (14). HPV-16 E6 probes were 438 bp (82 to 520 on HPV-16 genome) and HPV-18 E6 probes were 415 bp (110 to 525 on HPV-18 genome).

Statistical analysis

Statistical analysis was performed using the χ2 test to determine differences in positive rates of PCR and the expression rate of ISH between the two areas studied; values of P < 0.05 were considered statistically significant.

Results

Cytological diagnosis

Cytological diagnosis results of the volunteers from the high incident village showed 72 with normal epithelium, 46 with mild dysplasia and 17 with severe dysplasia, while two were diagnosed with squamous carcinoma, and one with adenocarcinoma. Among the participants from the low incident village, 40 had normal epithelium, 24 mild dysplasia and four were found to have severe dysplasia.

PCR and ISH data

The results from the PCR evaluations with microsatellite primers (not shown) showed that all of the specimen DNAs were suitable for PCR analyses. PCR positive controls of HPV L1, HPV-16 E6, HPV-16 E7 and HPV-18 E6 were observed as a specific band of expected size of 450, 321, 203 and 415 bp, respectively (Figure 1). In the negative control, no specific band was detected, thus demonstrating the specificity of the primers. HPV-16 E7 products digested with AccI are 131 and 72 bp fragments (Figure 2).

HPV-16 infection in esophageal epithelial cells is a very common phenomenon in the Anyang area, and the infection rate is much higher in the high incident village (72%) than that of the low incident village (37%) (P < 0.05; Table II). Moreover, as the cells undergoing cytological progress, the HPV-16 E6 positive rate was increased in both villages. The prevalence of HPV-16 E7 was consistent with those obtained for HPV-16 E6. However, in contrast to HPV-16 E6 and E7, the positive rate of HPV L1 was low (33% in normal epithelium, 36% in mild dysplasia and 14% in severe dysplasia). Furthermore, in three early cancer cases the HPV L1 gene was not found, while the HPV-16 E6 and E7 genes were positive, as shown in Table III.

In addition, there were 17 positive samples of HPV L1, HPV-16 (E6 or E7) and HPV-18; 10 samples positive of HPV L1 and HPV-18; 32 samples positive for HPV L1 and HPV-16; 24 samples positive for HPV-18 and HPV-16. The prevalence of HPV-18 was 17 and 15% in high and low incident villages, respectively (P > 0.05). Among them, 19 of the 24 samples from the high incident village and 5 out of 10 samples from the low incident village were also HPV-16 positive (Table IV).

As shown in Figure 3, purple-blue ISH signals were located in the cytoplasm of cells. In those samples diagnosed as normal epithelium, HPV-16 E6 staining was randomly distributed in epithelial cells. But in those samples diagnosed as dysplasia or early cancer, the HPV-16 E6 positive signal was mainly located in the cytoplasm of dysplastic and hyperplastic cells, and only a few morphological normal cells were HPV-16 E6 positive. Negative ISH samples were plain in color without HE staining (data not shown). All ISH positive samples were also PCR positive, no samples were ISH+/PCR–. ISH positive distribution was similar to the PCR results, as the HPV-16 E6 gene expression rate was 49% in the high incident village and 22% in the low incident village (P < 0.05), which corresponded with cytological grade in both villages. HPV-18 E6 gene expression is low (4% in both villages) (Tables II, III and IV).

Summaries of the HPV positive rate distribution for all the esophageal balloon cytology examination samples are shown in Tables II, III and IV.

Discussion

Extensive etiology and epidemiological studies have shown that low vitamins, nitrosoamine compounds and fungal toxins are all possible reasons for esophageal cancer (4). But a clear factor has not been shown. In addition, an association of HPV with esophageal carcinoma has been previously reported in China (3,4,19), France (16), Japan (10,11,22), South Africa (5,23,24), Portugal (7) and United States (9). However, the incidence of infection differs markedly depending on the geographic location of the population under study. Variation in the frequency with HPV also exists within different regions and studies. HPV infection rates vary from 0 to 67% as shown in Table V. These previous reports have indicated that HPV may play a role in human esophageal cancer (35,7,9,11), but a clear etiological determination has been lacking because of inconsistency among these studies. Even for samples from the same population, the infection rates were reported to be very different (4,6,9). Possible explanations for these discordant data maybe varied analytical methodologies and the lack of comparison between samples collected from high and low incident populations within the same study. Furthermore, what is also lacking is a study that analyzes samples exhibiting all the stages of esophageal carcinogenesis. To circumvent these problems we have collected cells from volunteers in Anyang area of Henan Province, where esophageal cancer incidence ranges from very high to moderately high, and assessed these specimens by PCR and ISH.

We used primers for the HPV L1 gene and the E6 and E7 genes of HPV-16 and -18, and conducted PCR and ISH on samples from esophageal balloon cytology examination from individuals living in high and low incident areas. The cytological evaluations showed that cells recovered from some volunteers were morphologically normal, whereas others ranged through grades of mild to severe dysplasia to early carcinoma. Our PCR results show that HPV-16 infection of esophageal epithelium is very common within the Anyang population, and the significantly different (P < 0.01) infection rates of 72 and 37% of the two villages is directly consistent with their respective mortality rates (132×105, 52×105). There were in total 124 positive samples of HPV-16 E6 and 125 positive samples of HPV-16 E7. Besides two samples E7+/E6– and one sample E6+/E7–, all the rest were positive both for E6 and E7.

Additional important findings are shown in Table II and the photomicrographs. Firstly, the viral E6 gene expression-positive rate, as determined by ISH detection of cytoplasmic signal was about 2.2-fold greater in the high incident village (49 and 22%, P < 0.05), while the rate determined by PCR is 1.9-fold greater (72 and 37%, P < 0.05). This means that not only the existence, but also the expression, of the virus may cause the different incidences in these two villages. Secondly, the HPV-16 E6 positive rate parallels the cytopathology in both villages; moreover, in those samples which diagnosed as normal epithelium, HPV-16 E6 staining was randomly distributed in epithelial cells. But in those samples which diagnosed as dysplasia or early cancer, the HPV-16 E6 positive signal was located mostly in the cytoplasm of dysplastic and hyperplastic cells, only a few morphological normal cells were HPV-16 E6 positive. It can be suggested that the E6 gene expression has a role in causing the cells to appear dysplastic. Thirdly, the rate of detection between PCR and ISH methods becomes more consistent with increasing severity of the cytopathological assessment, reaching 100% in the three cancer cases. Besides the possible difference in sensitivity of the two methods, these data imply that HPV-16 E6 gene expression is very important for the progression of the infected cells towards cancer. Taken together, these points strongly suggest that HPV-16 is an important etiological factor in Anyang's high incidence of esophageal cancer. Not only the existence of the viral DNA, but also the expression of E6 gene may contribute to the carcinogenesis of the infected esophageal epithelial cells. There were 34 cases positive for HPV-18 E6 in both villages, but 24 of them were simultaneously infected with HPV-16. Thus, it appears that HPV-18 may be less important as an etiological agent of esophageal cancer in this region.

HPV is a ubiquitous infectious agent. Hence, human genetic factor(s) may be responsible for enhanced susceptibility in certain high incident populations. As shown in Table I, the biggest difference between the two villages is the positive rates of viral detection between samples with normal morphology. This suggests that there are different susceptibilities to viral infection between these two villages. Thus, it will be important to screen for gene polymorphisms which relate to immune competence.

Previous PCR-based investigations to detect HPV have employed the L1 primers that amplify the gene encoding viral capsid protein. Data developed with these primers have failed to detect virus infection in tumor tissues of the same high-risk population as we assayed (12). Subsequently, there was a halt in the search for the presence of the virus, especially within esophageal balloon cytology preparations in this population. L1 gene has been reported frequently lost when the virus integrates into the cell's genome in cervical cancer (15). Our data show that the L1 gene detection rate is much lower than that of E6 and E7 genes, and becomes lower with the carcinogenesis of the cells. Sixty-three HPV L1 negative samples have been detected harboring HPV-16 (detected by E6 primers of HPV16) and 12 samples harboring HPV-18 (detected by E6 primers of HPV18), most of these samples were diagnosed as dysplasia or early cancer (Table III). Besides the fact that primers for E6 and E7 gene are more sensitive than consensus primers for the L1 gene, these results may also imply the possibility of viral gene integration at early stages of carcinogenesis, which cause the loss of the L1 gene, while E6 and E7 gene retained simultaneously. Thus, we think that the L1 gene is not suitable for the detection of HPV infection in cancers.

In summary, HPV-16 may have a causative role in the high incidence of esophageal cancer in Anyang population. More work is needed to search for other factor(s) or cofactor(s), susceptible genes in high-risk individuals and for novel prevention and screening methods to reduce the mortality rate of this disease.

Table I.

Primers

Name  Sequences  Position in HPV genome  Length of PCR product (bp) 
aThe position given is on the HPV-16 genome. 
HPV- L1a  F:GCACAGGG(TC)CA(CT)AA(CT)AATGG  6583–6602  449 
  R:CGTCC(AT)A(AG)(AG)GGA(AT)A(CT)TGATC  7015–7034   
HPV-16 E6  F:GCAAGCAACAGTTACTGCGA  201–220  321 
  R:CAACAAGACATACATCGACC  503–522   
HPV-16 E7  F:AGCTCAGAGGAGGAGGATGA  652–671  203 
  R:GGTTTCTGAGAACAGATGGG  835–854   
HPV-18 E6  F:GCGCTTTGAGGATCCAACAC  110–129  415 
  R:ACGAATGGCACTGGCCTCTA  506–525   
Name  Sequences  Position in HPV genome  Length of PCR product (bp) 
aThe position given is on the HPV-16 genome. 
HPV- L1a  F:GCACAGGG(TC)CA(CT)AA(CT)AATGG  6583–6602  449 
  R:CGTCC(AT)A(AG)(AG)GGA(AT)A(CT)TGATC  7015–7034   
HPV-16 E6  F:GCAAGCAACAGTTACTGCGA  201–220  321 
  R:CAACAAGACATACATCGACC  503–522   
HPV-16 E7  F:AGCTCAGAGGAGGAGGATGA  652–671  203 
  R:GGTTTCTGAGAACAGATGGG  835–854   
HPV-18 E6  F:GCGCTTTGAGGATCCAACAC  110–129  415 
  R:ACGAATGGCACTGGCCTCTA  506–525   
Table II.

Positive detection of HPV-16 E6 in volunteers in high and low incident villages in Anyang

  n  PCR  ISH  Consistency of the two methods (%) 
Numbers in parentheses, %. 
*P < 0.01; **P < 0.05. 
High incident village  138  99 (72) 67 (49)**  68 
Normal epithelium  72  43 (60)  15 (21)  35 
Mild dysplasia  46  39 (85)  35 (76)  90 
Severe dysplasia  17  14 (82)  14 (82)  100 
Early cancer  3 (100)  3 (100)  100 
Low incident village  68  25 (37) 15 (22)**  60 
Normal epithelium  40  7 (18)  1 (3)  14 
Mild dysplasia  24  15 (63)  11 (46)  73 
Severe dysplasia  3 (75)  3 (75)  100 
  n  PCR  ISH  Consistency of the two methods (%) 
Numbers in parentheses, %. 
*P < 0.01; **P < 0.05. 
High incident village  138  99 (72) 67 (49)**  68 
Normal epithelium  72  43 (60)  15 (21)  35 
Mild dysplasia  46  39 (85)  35 (76)  90 
Severe dysplasia  17  14 (82)  14 (82)  100 
Early cancer  3 (100)  3 (100)  100 
Low incident village  68  25 (37) 15 (22)**  60 
Normal epithelium  40  7 (18)  1 (3)  14 
Mild dysplasia  24  15 (63)  11 (46)  73 
Severe dysplasia  3 (75)  3 (75)  100 
Table III.

HPV-16 detection by different methods in different stages of carcinogenesis

Pathological types  n  PCR  ISH  
    L1  E6  E7  E6 
Numbers in parentheses, %. 
Normal epithelium  112  37 (33)  50 (45)  49 (44)  16 (14) 
Mild dysplasia  70  25 (36)  54 (77)  56 (80)  46 (60) 
Severe dysplasia  21  3 (14)  17 (81)  17 (81)  17 (81) 
Early cancer  3 (100)  3 (100)  3 (100) 
Pathological types  n  PCR  ISH  
    L1  E6  E7  E6 
Numbers in parentheses, %. 
Normal epithelium  112  37 (33)  50 (45)  49 (44)  16 (14) 
Mild dysplasia  70  25 (36)  54 (77)  56 (80)  46 (60) 
Severe dysplasia  21  3 (14)  17 (81)  17 (81)  17 (81) 
Early cancer  3 (100)  3 (100)  3 (100) 
Table IV.

Positive detection of HPV-18 E6 in volunteers in high and low incident villages in Anyang

  n  PCR  ISH  HPV-16 positive 
Numbers in parentheses, %. 
*P > 0.05; **P > 0.05. 
High incident village  138  24 (17)  5 (4)  19 
Low incident village  68  10 (15)*  3 (4)** 
  n  PCR  ISH  HPV-16 positive 
Numbers in parentheses, %. 
*P > 0.05; **P > 0.05. 
High incident village  138  24 (17)  5 (4)  19 
Low incident village  68  10 (15)*  3 (4)** 
Table V.

HPV and squamous carcinoma of the esophagus

Reference  Geographic source  Tissue  Method of detection  Frequency ()  HPV type 
ESCC, Squamous carcinoma of the esophagus; ISH, in situ hybridization; IHC, immunohistochemistry. 
(7)  Poutugal  ESCC  Morphology  33   – 
  Caucasian  ESCC  PCR(HPV-16 E6)/Southern  50   16 
      PCR(HPV-18 E6)/Southern  18.8   18 
    Normal epithilium  PCR/Southern  100   16 & 18 
    Normal epithilium  PCR  0   – 
(21)  Slovenia  ESCC  PCR  0 (121)  None 
(22)  Japan  ESCC  PCR  0   16, 18 
    ESCC  PCR/Southern  3/41  18 
      PCR/Southern  0/41  16 
    Normal epithilium  PCR/Southern  3/41  18 
(9)  Beijing,China  ESCC  ISH  0 (83)  None 
      PCR(L1 0 (70)  None 
      PCR(HPV-6 E6 1.43 (70) 
      PCR(HPV-16 E6 2.86 (70)  16 
      PCR(HPV-18 E6 0   None 
  Cincinnati  ESCC  ISH  0 (27)  None 
      PCR(L1 0 (23)  None 
      PCR(HPV-6 E6 0 (23)  None 
      PCR(HPV-16 E6 4.35 (23)  16 
      PCR(HPV-18 E6 0 (23)  None 
(3)  Fuzhou, China  ESCC  PCR  60 (40)  6, 11, 16, 18 
(16)  France  ESCC  PCR(L1,E6 0 (75)  6, 11, 16, 18 
    Normal epithilium  PCR(L1,E6 0 (49)  6, 11, 16, 18 
(11)  Japan  ESCC  PCR(HPV-16,-18 E7 6.7 (45)  16 & 18 
(12)  Linxian, China  ESCC  PCR(L1)/Southern  0 (35)  None 
    Normal epithilium  PCR(L1)/Southern  0 (52)   
(4)  Linxian, China  Normal epithilium  Filter ISH  22.2 (9)  11, 16, 18 
    Mild dysplasia    50 (6)  11, 16, 18 
    Intermidiate dysplasia    80.6 (31)  11, 16, 18 
    Server dysplasia    67.9 (28)  11, 16, 18 
    ESCC    66.7 (6)  11, 16, 18 
(19)  Linxian, China  ESCC  Morphology  49 (51)   
      ISH  43.1 (51)  6, 11, 16, 18 
      PCR(E5/L1 49 (51)  6, 11, 16, 18 
      Southern  45 (20)  6, 11, 16, 18 
(6)  Anyang, China  ESCC  PCR(L1 17.1 (117)  Varies 
(25)  Linxian, China  ESCC  IHC  23 (23)   
  Japan  ESCC  IHC  13 (23)   
(24)  South Africa  ESCC  PCR(L1 43 (14)   
(23)  China  ESCC  PCR(L1 34.5 (29)  Varies 
  South Africa  ESCC  PCR(L1 21.6 (34)  Varies 
Reference  Geographic source  Tissue  Method of detection  Frequency ()  HPV type 
ESCC, Squamous carcinoma of the esophagus; ISH, in situ hybridization; IHC, immunohistochemistry. 
(7)  Poutugal  ESCC  Morphology  33   – 
  Caucasian  ESCC  PCR(HPV-16 E6)/Southern  50   16 
      PCR(HPV-18 E6)/Southern  18.8   18 
    Normal epithilium  PCR/Southern  100   16 & 18 
    Normal epithilium  PCR  0   – 
(21)  Slovenia  ESCC  PCR  0 (121)  None 
(22)  Japan  ESCC  PCR  0   16, 18 
    ESCC  PCR/Southern  3/41  18 
      PCR/Southern  0/41  16 
    Normal epithilium  PCR/Southern  3/41  18 
(9)  Beijing,China  ESCC  ISH  0 (83)  None 
      PCR(L1 0 (70)  None 
      PCR(HPV-6 E6 1.43 (70) 
      PCR(HPV-16 E6 2.86 (70)  16 
      PCR(HPV-18 E6 0   None 
  Cincinnati  ESCC  ISH  0 (27)  None 
      PCR(L1 0 (23)  None 
      PCR(HPV-6 E6 0 (23)  None 
      PCR(HPV-16 E6 4.35 (23)  16 
      PCR(HPV-18 E6 0 (23)  None 
(3)  Fuzhou, China  ESCC  PCR  60 (40)  6, 11, 16, 18 
(16)  France  ESCC  PCR(L1,E6 0 (75)  6, 11, 16, 18 
    Normal epithilium  PCR(L1,E6 0 (49)  6, 11, 16, 18 
(11)  Japan  ESCC  PCR(HPV-16,-18 E7 6.7 (45)  16 & 18 
(12)  Linxian, China  ESCC  PCR(L1)/Southern  0 (35)  None 
    Normal epithilium  PCR(L1)/Southern  0 (52)   
(4)  Linxian, China  Normal epithilium  Filter ISH  22.2 (9)  11, 16, 18 
    Mild dysplasia    50 (6)  11, 16, 18 
    Intermidiate dysplasia    80.6 (31)  11, 16, 18 
    Server dysplasia    67.9 (28)  11, 16, 18 
    ESCC    66.7 (6)  11, 16, 18 
(19)  Linxian, China  ESCC  Morphology  49 (51)   
      ISH  43.1 (51)  6, 11, 16, 18 
      PCR(E5/L1 49 (51)  6, 11, 16, 18 
      Southern  45 (20)  6, 11, 16, 18 
(6)  Anyang, China  ESCC  PCR(L1 17.1 (117)  Varies 
(25)  Linxian, China  ESCC  IHC  23 (23)   
  Japan  ESCC  IHC  13 (23)   
(24)  South Africa  ESCC  PCR(L1 43 (14)   
(23)  China  ESCC  PCR(L1 34.5 (29)  Varies 
  South Africa  ESCC  PCR(L1 21.6 (34)  Varies 
Fig. 1.

Results of HPV PCR on esophageal epithelium. (A) PCR amplification of HPV L1 in human esophageal epithelium samples. Lane 1, DNA marker (100 bp DNA ladder, GIBCO BRL); lane 2, positive control (HeLa cell DNA); lane 3, negative control (without template); lanes 6 and 7, positive samples; lanes 4, 5, 8 and 9, negative samples. (B) PCR amplification of HPV-16 E6 in human esophageal epithelium samples. Lane 1, DNA markers (100 bp DNA ladder); lane 2, positive control [HPV-16 positive esophageal carcinoma (13)]; lane 3, negative control (without template); lane 5, 6 and 8, positive samples; lanes 4, 7 and 9, negative samples. (C) PCR amplification of HPV-16 E7 in human esophageal epithelium samples. Lane 1, DNA markers (100 bp DNA ladder); lane 2, positive control [HPV-16 positive esophageal carcinoma (13)]; lane 3, negative control (without template); lanes 5, 6, 8 and 9, positive samples; lanes 4 and 7, negative samples. (D) PCR amplification of HPV-18 E6 in human esophageal epithelium samples. Lane 1, DNA markers (100 bp DNA ladder); lane 2, positive control (HeLa cell DNA); lane 3, negative control (without template); lanes 4 and 8, positive samples; lanes 5, 6, 7 and 9, negative samples.

Fig. 1.

Results of HPV PCR on esophageal epithelium. (A) PCR amplification of HPV L1 in human esophageal epithelium samples. Lane 1, DNA marker (100 bp DNA ladder, GIBCO BRL); lane 2, positive control (HeLa cell DNA); lane 3, negative control (without template); lanes 6 and 7, positive samples; lanes 4, 5, 8 and 9, negative samples. (B) PCR amplification of HPV-16 E6 in human esophageal epithelium samples. Lane 1, DNA markers (100 bp DNA ladder); lane 2, positive control [HPV-16 positive esophageal carcinoma (13)]; lane 3, negative control (without template); lane 5, 6 and 8, positive samples; lanes 4, 7 and 9, negative samples. (C) PCR amplification of HPV-16 E7 in human esophageal epithelium samples. Lane 1, DNA markers (100 bp DNA ladder); lane 2, positive control [HPV-16 positive esophageal carcinoma (13)]; lane 3, negative control (without template); lanes 5, 6, 8 and 9, positive samples; lanes 4 and 7, negative samples. (D) PCR amplification of HPV-18 E6 in human esophageal epithelium samples. Lane 1, DNA markers (100 bp DNA ladder); lane 2, positive control (HeLa cell DNA); lane 3, negative control (without template); lanes 4 and 8, positive samples; lanes 5, 6, 7 and 9, negative samples.

Fig. 2.

AccI digestion of HPV-16 E7 PCR products. Lane 1, DNA markers (100 bp DNA ladder); lanes 2 and 3, positive control, uncut and cut; lanes 4 and 5, positive sample, uncut and cut; lane 6, DNA markers (PBR322/BSTNI, Biolabs).

Fig. 2.

AccI digestion of HPV-16 E7 PCR products. Lane 1, DNA markers (100 bp DNA ladder); lanes 2 and 3, positive control, uncut and cut; lanes 4 and 5, positive sample, uncut and cut; lane 6, DNA markers (PBR322/BSTNI, Biolabs).

Fig. 3.

(A) ISH positive of HPV-16 E6 mRNA in one of the samples of morphologically normal human esophageal epithelium. The positive signal is located in the cytoplasm. Magnification, 200×. (B) ISH positive of HPV-16 E6 mRNA in a sample with mild dyspasia. The positive signal is located in the cytoplasm. Magnification, 200×.

Fig. 3.

(A) ISH positive of HPV-16 E6 mRNA in one of the samples of morphologically normal human esophageal epithelium. The positive signal is located in the cytoplasm. Magnification, 200×. (B) ISH positive of HPV-16 E6 mRNA in a sample with mild dyspasia. The positive signal is located in the cytoplasm. Magnification, 200×.

4
To whom correspondence should be addressed Email: keyang@mx.cei.gov.cn

This work was supported by the National Nature and Science Foundation, grant no. 30070834 and National 973 Project of Fundamental Investigation on Human Carcinogenesis, grant no. 1998051203.

References

1
Chang,F., Syrjanen,S., Wang,L. and Syrjanen,K. (
1992
) Infection agents in the etiology of esophageal cancer.
Gastroenterology
 ,
103
,
1336
–1348.
2
Syrjanen,K.H. (
1982
) Histological changes identical to those of condylomatous lesions found in esophageal squamous cell carcinoma.
Arch. Geschwolstforsh.
 ,
52
,
283
–292.
3
Chen,B.F., Yin,H. and Dhurandhar,N. (
1994
) Detection of human papillomavirus DNA in esophageal squamous cell carcinomas by PCR using general consensus primers.
Hum. Pathol.
 ,
25
,
920
–923.
4
Chang,F., Syrjanen,S., Shen,Q., Wang,L., Wang,D. and Syrjanen, KJ. (
1992
) Human papillomavirus involvement in esophageal precancerous lesion and squamous cell carcinoma as evidenced by microscopy and different DNA techniques.
Scand. J. Gastroenterol.
 ,
27
,
553
–563.
5
Cooper,K., Taylor,L. and Govind,S. (
1995
) Human papillomavirus DNA in esophageal South Africa.
J. Pathol.
 ,
175
,
273
–277.
6
De Villiers,E.M., Lavergne,D., Chang,F., Syrjanen,K., Tosi,P., Cintorino,M., Santopietro,R. and Syrjanen,S. (
1999
) An interlaboratory study to determine the presence of HPV DNA in esophageal carcinoma from China.
Int. J. Cancer
 ,
82
,
225
–228.
7
Fidalgo,P.O., Cravo,M.L., Chaves,P.P., Leitao,C.N. and Mira,F.C. (
1995
) High prevalence of human papillomavirus in squamous cell carcinoma and matched normal esophageal mucosa.
Cancer
 ,
76
,
1522
–1528.
8
Smits,H.L., Tjong-A-Hung,S.P., Schegget,J., Ter Schegget,J., Nooter,K and Kok,T. (
1995
) Absence of HPV DNA from esophageal carcinoma as detection by multiple broad spectrum PCR.
J. Med. Virol.
 ,
46
,
213
–215.
9
Suzuk,L., Noffsinger,A.E., Hui,Y.Z. and Fenoglio-Preiser,C.M. (
1996
) Detection of human papillomavirus in esophageal squamous cell carcinoma.
Cancer
 ,
78
,
704
–710.
10
Togava,K., Jaskiewicz,K., Takahashi,H., Meltzer,S.J. and Rustgi,A.K. (
1994
) Human papillomavirus DNA sequences in esophagus squmous cell carcinoma.
Gastroenterology
 ,
107
,
128
–136.
11
Toh,Y., Kuwano,H., Tanaka,S., Baba,K., Matsuda,H., Sugimacki,K. and Mori,R. (
1992
) Detection of HPV DNA in esophageal carcinoma in Japan by polymerase chain reaction.
Cancer
 ,
70
,
2234
–2238.
12
Lu,S.X., Luo,F.Q., Li,H.C. and Lin,R.C. (
1995
) Detection of HPV in esophageal cancer and adjacent mucosa.
Chin. J. Oncol.
 ,
17
,
321
–334.
13
Lu,Z.M., Chen,K.N., Guo,M., Li,T., Xin,H.P., Mei,Q., Yang,H.H. and Ke,Y. (2000) Detection of HPV and EBV in human esophageal cancer in a high-incident area and correlation with p53 expression. Chin. J. Oncol., in press.
14
Van den Brule,A.J., Cromme,F.V., Snijders,P.J.F., Smit,L., Dudejans,C.B., Baak,J.P., Meijer,C.J. and Walboomers,J.M. (
1991
) Nonradioactive RNA in situ hybridization detection of human papillomavirus 16-E7 transcripts in squamous cell carcinomas of the uterine cervix using confocal laser scan microscopy.
Am. J. Pathol.
 ,
139
,
1037
–1045.
15
Zur Hausen,H. (
1996
) Papillomavirus infectious—a major cause of human cancers.
Biochim. Biophys. Acta
 ,
1288
,
F55
–F78.
16
Benamouzig,R., Pigot,F., Quiroga,G., Validire,P., Chaussade,S. and Catalan,F. (
1992
) Human papillomavirus infection in esophageal squamous cell carcinoma in western countries.
Int. J. Cancer
 ,
50
,
549
–552.
17
Manos,M.M., Ting,Y., Wright,D.K., Lewis,A.J., Broker,T.R. and Wolinsky,S.M. (
1989
) The use of polymerase chain reaction amplification for the detection of genital human papillomavirus.
Cancer Cells
 ,
7
,
209
–214.
18
Nuovo,G.J., Darfler,M.M., Impraim,C.C. and Bromley,S.E. (
1991
) Occurrence of multiple types of human papillomavirus in genital tract lesions.
Am. J. Pathol.
 ,
138
,
53
–58.
19
Chang,F., Syrjanen,S., Shen,Q., Honxjiu,J. and Syrjanen,K. (
1990
Human papillomavirus (HPV) DNA in esophageal precancer lesions and squamous cell carcinoma from China.
Int. J. Cancer
 ,
45
,
21
–25.
20
Winkler,B., Capo,V., Rrumann,W., Ma,A., La Porta,R., Reilly,S., Green,P.M.R., Richard,R.M. and Crum,C.P. (
1985
) Human papillomavirus infection of esophagus.
Cancer
 ,
55
,
149
–155.
21
Poljak,M., Cerar,A. and Seme,K. (
1998
) Human papollomavirus infection in esophageal carcinomas: a study of 121 lesions using multiple broad-spectrum polymerase chain reactions and literature review.
Hum. Pathol.
 ,
29
,
266
–271.
22
Mizobuchi,S., Sakamoto,H., Tachimori,Y., Kato,H., Watanabe,H. and Terada,M. (
1997
) Absence of human papillomavirus-16 and -18 DNA and Epstein–Barr virus DNA in esophageal squamous cell carcinoma.
Jpn J. Clin. Oncol.
 ,
27
,
1
–5.
23
Lavergno,D. and De Villier,E.M. (
1999
) Papillomavirus in esophageal papillomas and carcinomas.
Int. J. Cancer
 ,
80
,
681
–684.
24
Williamson,A.L., Jaskiesicz,K. and Gunning,A. (
1991
) The detection of human papillomavirus in esophageal lesions.
Anticancer Res.
 ,
11
,
263
–265.
25
Mori,M., Shimono,R.F., Kuwano,H., Sugimachi,I.K. and Zhang,R.G. (
1989
) Papillomavirus and oesophageal cancer in the Japanese and Chinese.
Am. J. Gastroenterol.
 ,
84
,
1126
–1127.
26
Higgins,G.D., Uzelin,D.M., Phillips,G.E. and Burrell,C.J. (
1991
) Presence and distribution of human papillomavirus sense and antisense RNA transcripts in genital cancer.
J. Gen. Virol.
 ,
72
,
885
–895.
27
Vormwald-Dogan,V., Fischer,B., Bludau,H., Freese,U.K., Gissmann,L., Glitz,D., Schwarz,E. and Durst,M. (
1992
) Sense and antisense transcripts of human papillomavirus type 16 in cervical cancers.
J. Gen. Virol.
 ,
73
,
1833
–1838.