Abstract

Objective: The role of Chlamydia pneumoniae in atherosclerosis is still debated. In this study a novel mouse model was applied to determine the direct impact of C. pneumoniae on the arterial wall and the development of atherosclerosis.

Methods: Direct effects of C. pneumoniae on collar-induced atherosclerosis were studied after local delivery of C. pneumoniae to carotid arteries of LDL receptor-deficient (LDLr-/-) mice.

Results: The presence of C. pneumoniae in the vessel wall was quantified by RT-PCR (6.2 × 104 copies/artery) and resulted in a 2.0-fold increase in intima/media ratios (p<0.05) and a 1.7-fold increase in stenosis (p<0.05). Immunostaining revealed a 2.98-fold (p<0.01) increased macrophage content and a tendency towards lower numbers of smooth muscle cells and collagen in lesions of infected carotid arteries. Direct delivery of another respiratory pathogen, Mycoplasma pneumoniae, to the carotids did not affect size or composition of the atherosclerotic lesions. Presence of C. pneumoniae in the carotid arteries resulted within 7 days in a marked upregulation of the expression of MCP-1 (p<0.01) and ICAM-1 as determined on mRNA and protein levels. These in vivo data were in line with data obtained with in vitro infections of macrophages and endothelial cells with C. pneumoniae.

Conclusions: We conclude that C. pneumoniae in carotid arteries leads to more pronounced atherosclerotic lesions with a more vulnerable morphology and that this model is suitable to monitor direct effects of C. pneumoniae on atherogenesis.

Atherosclerosis is considered to be an inflammatory disease [1] and possible involvement of infectious agents has been studied. Until now most evidence indicates that Chlamydia pneumoniae may promote atherogenesis. This gram-negative bacterium, a common human pathogen, causes mild upper respiratory tract infections. The majority of people are repeatedly infected with C. pneumoniae during a lifetime. By the age of 65, anti-C. pneumoniae antibodies are found in 80% of the male and 70% of the female population [2].

Epidemiological studies show an association of serum antibodies against C. pneumoniae and cardiovascular disease [3]. Accumulating data revealed that, due to its obligate intracellular character, C. pneumoniae is able to disseminate via the circulation throughout the body within monocytes and can in this way enter the atherosclerotic lesion [4]. Its ability to infiltrate lesions is illustrated by the observation that in up to 50% of the human atherosclerotic lesions C. pneumoniae is detected [5]. Data from sero-epidemiological and pathology studies underline the possible relation between C. pneumoniae and atherosclerosis, but cannot provide definite proof for a causal relation between C. pneumoniae infection and atherosclerosis. Several clinical trials with antibiotics against these bacteria attempted to demonstrate a causal role in cardiovascular disease, but did not always show decreased pathology [6]. In vitro, C. pneumoniae has various pro-atherosclerotic effects on atheroma-associated cell types. Infection of endothelial cells (ECs) leads to increased expression of adhesion molecules, such as E-selectin, intercellular adhesion molecule-1 (ICAM-1), and vascular cell adhesion molecule-1 (VCAM-1) [7], chemokines, such as monocyte chemoattractant protein-1 (MCP-1) [8], and cytokines, such as interleukin (IL)-1, IL-8, and tumor necrosis factor-α (TNF-α) [9], resulting in pro-atherosclerotic processes, such as enhanced adherence and migration of monocytes [8]. Infection of monocytes with C. pneumoniae increases adherence of infected monocytes to ECs [10,11] and promotes low density lipoprotein (LDL) oxidation [12], resulting in accelerated uptake of cholesterol by macrophages and subsequent foam cell formation. Increased LDL oxidation was also observed upon infection of ECs with C. pneumoniae[13]. Smooth muscle cells (SMCs) respond to C. pneumoniae infection by elevated expression of matrix metalloproteinases (MMPs), which may contribute to plaque destabilization [14]. Although in vitro data point to pro-atherosclerotic effects of C. pneumoniae, most of these still have to be confirmed in vivo. Many groups have used animal models to chart the relation between C. pneumoniae infection and cardiovascular disease. However, until now these models did not result in a general consensus about the contribution of C. pneumoniae to atherosclerosis [15,16]. The differences in the observed effects of C. pneumoniae on atherosclerosis may arise from the fact that C. pneumoniae could not always be detected at the site of atherosclerosis after initial lung infection. Therefore, we developed a novel model in which the impact of C. pneumoniae on the arterial wall and subsequent atherogenesis can be studied. C. pneumoniae was delivered to the carotid artery of LDL receptor deficient (LDLr-/-) mice by means of local intra-vascular incubation. Subsequently, the influence of C. pneumoniae, present in the vessel wall, on atherosclerosis was studied by collar placement around the incubated carotid artery. In addition we determined the effect of Mycoplasma pneumoniae on lesion formation in the carotid artery. M. pneumoniae is, like C. pneumoniae, a mild respiratory pathogen that has directly been detected in atherosclerotic lesions [17]. The epidemiological behavior of M. pneumoniae and its ability to produce chronic sequelae following respiratory infection may point to a role for M. pneumoniae in atherosclerosis similar to C. pneumoniae[18]. Since C. pneumoniae may also affect cardiovascular disease by interfering with the thrombogenicity of the vessel wall or atherosclerotic plaque, we also determined the effect of a C. pneumoniae presence in the vascular wall on acute arterial thrombus formation.

Methods

Bacteria

C. pneumoniae strain AR39 (Washington Research Foundation, Washington, USA) was cultured in Buffalo Green Monkey cells. The titer was determined as previously described [19]. M. pneumoniae was kindly provided by Dr Brugman and Dr Thuis from the National Institute for Public Health and Environment (Bilthoven, The Netherlands).

Delivery of C. pneumoniae and induction of atherosclerosis

Animal work was carried out in compliance with guidelines issued by the Dutch government, which conform to the NIH guidelines. Male LDLr-/- mice, 12–14 weeks old, were put on a “Western-type” diet, containing 0.25% cholesterol and 15% cocoa butter (Special Diet Services, UK). After two weeks mice were anesthetized as previously described [20], and injected intravenously with 200 μl 20 U/ml heparin (Leo Pharma, Netherlands). Subsequently, 15 mice were inoculated with 5 × 105C. pneumoniae infection forming units (IFU) in 10 μl sucrose–phosphate–glutamic acid (SPG) medium by instillation into the right common carotid artery via the external carotid artery [21]. Carotids of 14 control mice were incubated with a SPG medium. An additional group of mice (n=9) was incubated with 5 × 105M. pneumoniae bacteria. Suspensions were left inside the common carotid artery for 60 min and subsequently were aspirated from the common carotid artery. Thereafter, the external carotid artery was ligated to prevent blood loss [21]. Immediately after incubation atherosclerosis was induced by bilateral perivascular collar placement [20]. Furthermore, 83 male LDLr-/- mice were locally incubated (40 mice with C. pneumoniae and 43 mice with the SPG medium) without induction of atherosclerosis by collar placement. Twelve mice per time point were sacrificed at day 1, 2, 4, and 7 post-infection for gene expression studies. Another 16 mice were sacrificed 7 days post-infection for DNA isolation or immunohistochemistry and in the remaining 19 animals acute thrombus formation was induced prior to their sacrifice at day 7 post-infection. Acute thrombosis was induced in the right carotid artery by peri-arterial application of FeCl3 (40%) resulting in the formation of platelet and fibrin-rich thrombi, as previously described [22]. A Doppler flow probe was used to measure blood flow. Time to occlusion was defined as the time after initiation of arterial injury with FeCl3, required for blood flow to decline to <0.2 ml/min.

Immunohistochemistry

For immunohistochemistry carotid arteries were perfused and isolated as previously described [20]. Transverse 5 μm cryosections, prepared in a proximal direction from the carotid bifurcation, were routinely stained with hematoxylin (Sigma Diagnostics, MO) and eosin (Merck Diagnostica, Germany). Each vessel was assessed ∼0.5 mm proximal to the collar, and the site of maximal stenosis was used for morphometric assessment [20]. Corresponding sections were stained immunohistochemically with antibodies against a macrophage-specific antigen (MOMA-2, polyclonal rat IgG2b, diluted 1:50; Research Diagnostics Inc., NJ), alpha smooth muscle cell actin (monoclonal mouse IgG2a (clone 1A4), dilution 1:500; Sigma Diagnostics), and ICAM-1 (monoclonal rat IgG2a (clone BSA2), dilution 1:200; R and D Systems, UK). Slides were incubated with primary antibodies for 2 h at room temperature. As secondary antibodies goat anti-mouse IgG peroxidase conjugate (dilution 1:500; Nordic, The Netherlands) and goat anti-rat IgG alkaline phosphatase conjugate (dilution 1:50; Sigma Diagnostics) were used (one hour of incubation at room temperature), with 3,3′-diamino-benzidine (Sigma Diagnostics), nitro blue tetrazolium (Sigma Diagnostics) and 5-bromo-4-chloro-3-indolyl phosphate (Sigma Diagnostics) as enzyme substrates [20]. Sections were stained for collagen by a Picrosirius Red (Direct red 80) staining. Sections were analyzed using a Leica DM-RE microscope and LeicaQwin software (Leica Imaging Systems, UK). Contents of macrophages, smooth muscle cells, and collagen were obtained by dividing the area of specific staining within the intima by the total intima area.

Detection of C. pneumoniae

DNA was isolated from incubated carotid arteries, after perfusion with PBS, using a QIAamp DNA MiniKit (Westburg, Netherlands). For detection of C. pneumoniae DNA quantitative PCRs were performed on an ABI PRISM 7700 machine (Applied Biosystems, CA) using primers for the outer membrane protein A (OMP A) gene (Table 1), which is highly conserved within C. pneumoniae species [23], and probe 5′-AAACTTAACTGCATGGACCCTTCTTTACTAGG-3′ (FAM), (reverse primers; 300 nM, forward primers; 900 nM, and probes; 200 nM). PCR conditions were the same as used in the gene expression assays. Amounts of C. pneumoniae copies were obtained after performing regression analysis on a standard curve, which was created by performing PCRs under the same conditions on dilutions of plasmids containing the OMP A gene in the presence of representative amounts of DNA isolated from murine carotids.

Table 1

Primer sequences used in quantitative PCR

Gene Forward primer (5′–′3) Reverse primer (5′–′3) 
E-selectin CCCTGCCCACGGTATCAG CCCTTCCACACAGTCAAACGT 
HPRT TTGCTCGAGATGTCATGAAGGA AGCAGGTCAGCAAAGAACTTATAG 
ICAM-1 GGACCACGGAGCCAATTTC CTCGGAGACATTAGAGAACAATGC 
IL-1 TGGTGTGTGACGTTCCCATTA AGGTGGAGAGCTTTCAGCTCATAT 
IL-6 GAAGAATTTCTAAAAGTCACTTTGAGATCTAC CACAGTGAGGAATGTCCACAAAC 
IL-12 AGTGAAAATGAAGCTCTGCATCC GATAGCCCATCACCCTGTTGA 
MCP-1 GCATCTGCCCTAAGGTCTTCA GCATCTGCCCTAAGGTCTTCA 
OMP A (C. pneumoniaeTCCGCATTGCTCAGCC AAACAATTTGCATGAAGTCTGAGAA 
TF TCCTGGCCACCATCTTTATCAT GCAGGCAGTGAGCGTTAG 
TNF GCCAGCCGATGGGTTGTA AGGTTGACTTTCTCCTGGTATGAGA 
VCAM-1 ACAAAACGATCGCTCAAATCG CGCGTTTAGTGGGCTGTCTATC 
Gene Forward primer (5′–′3) Reverse primer (5′–′3) 
E-selectin CCCTGCCCACGGTATCAG CCCTTCCACACAGTCAAACGT 
HPRT TTGCTCGAGATGTCATGAAGGA AGCAGGTCAGCAAAGAACTTATAG 
ICAM-1 GGACCACGGAGCCAATTTC CTCGGAGACATTAGAGAACAATGC 
IL-1 TGGTGTGTGACGTTCCCATTA AGGTGGAGAGCTTTCAGCTCATAT 
IL-6 GAAGAATTTCTAAAAGTCACTTTGAGATCTAC CACAGTGAGGAATGTCCACAAAC 
IL-12 AGTGAAAATGAAGCTCTGCATCC GATAGCCCATCACCCTGTTGA 
MCP-1 GCATCTGCCCTAAGGTCTTCA GCATCTGCCCTAAGGTCTTCA 
OMP A (C. pneumoniaeTCCGCATTGCTCAGCC AAACAATTTGCATGAAGTCTGAGAA 
TF TCCTGGCCACCATCTTTATCAT GCAGGCAGTGAGCGTTAG 
TNF GCCAGCCGATGGGTTGTA AGGTTGACTTTCTCCTGGTATGAGA 
VCAM-1 ACAAAACGATCGCTCAAATCG CGCGTTTAGTGGGCTGTCTATC 

Cell culture

Murine macrophages (RAWs) and endothelial cells (H5Vs) were cultured in DMEM containing 10% Fetal Bovine Serum (FBS), 2 mmol/l l-glutamine, 100 U/ml penicillin, and 100 μg/ml streptomycin (BioWhittaker Europe) in a humidified atmosphere (5% CO2) at 37 °C. Prior to infection cells were transferred into 24-well plates (2.5 × 105 RAWs/well or 1.0 × 105 H5Vs/well) and incubated overnight.

In vitro infection

Cells were washed twice with DMEM containing 10% FBS and 2 mmol/l l-glutamine and subsequently inoculated with C. pneumoniae with a m.o.i of 1. Mock infection was performed with a SPG medium. Immediately after inoculation, plates were centrifuged for 60 min with 800 × g at 37 °C. After another 60 min of inoculation with C. pneumoniae, infected cells were washed twice and incubated for 0, 2, 4, 6, and 8 h prior to total RNA isolation.

Analysis of gene expression by real time quantitative PCR

Total RNA was isolated from RAWs, H5Vs and carotid arteries using TRIzol reagent (Invitrogen, Netherlands) according to manufacturer's instructions. Two arteries were pooled resulting in n=3 per treatment per time point. Generation of cDNA, quantitative RT-PCR, calculations of ratios of target genes and the house hold gene, Hypoxanthine-guanine phosphoribosyl-transferase (HPRT), and the design of primers (Table 1) were performed as previously described [24].

Data analysis

Values are expressed as mean ± sem. A 2-tailed Student's t-test was used to compare individual groups of mice or cells. Levels of p<0.05 were considered significant.

Results

Local incubation of the right common carotid artery with C. pneumoniae did not affect total serum cholesterol levels 5 weeks after collar placement (Fig. 1C). Successful infection of the arterial wall with C. pneumoniae was confirmed by quantitative RT-PCR on the OMP A gene of C. pneumoniae. Every artery incubated with C. pneumoniae was highly positive for the OMP A gene and on average, 6.2 × 104C. pneumoniae copies were detected in bacteria incubated carotid arteries 7 days post local incubation. C. pneumoniae DNA was absent in lungs, livers and spleens of C. pneumoniae incubated mice and in right carotid arteries of control incubated mice.

Fig. 1

Five weeks after collar placement and simultaneous C. pneumoniae infection mice were sacrificed and carotid arteries were isolated for quantification of lesion formation. Representative cross-sections of collar induced plaques in carotid arteries of LDLr-/- mice are shown after incubation with C. pneumoniae (B) or SPG medium (A). During the experiment total serum cholesterol levels were monitored (C). Using computer assisted morphometric analysis we determined intima area (D), intima/media ratio (E), and intima/lumen ratio (F) after incubation with C. pneumoniae or SPG medium (*=p<0.05).

Fig. 1

Five weeks after collar placement and simultaneous C. pneumoniae infection mice were sacrificed and carotid arteries were isolated for quantification of lesion formation. Representative cross-sections of collar induced plaques in carotid arteries of LDLr-/- mice are shown after incubation with C. pneumoniae (B) or SPG medium (A). During the experiment total serum cholesterol levels were monitored (C). Using computer assisted morphometric analysis we determined intima area (D), intima/media ratio (E), and intima/lumen ratio (F) after incubation with C. pneumoniae or SPG medium (*=p<0.05).

Effect of C. pneumoniae presence in the vessel wall on atherosclerosis

After positive identification of the presence of C. pneumoniae we determined the effect of C. pneumoniae on de novo atherosclerosis in carotid arteries of LDLr-/- mice. Five weeks after local incubation of carotid arteries and simultaneous collar placement we determined the degree of atherosclerosis. Incubation of the carotid artery with C. pneumoniae resulted in 1.87-fold increased neointima area (Fig. 1A, B, D; 57,711 ± 10,943 vs. 30,891 ± 9997 μm2), which translated into markedly 2.03-fold increased intima/media ratios (Fig. 1E; 1.27 ± 0.23 vs. 0.62 ± 0.15, p<0.05) and a 1.74-fold increased degree of lumen stenosis (Fig. 1F; 0.53 ± 0.08 vs. 0.30 ± 0.07, p<0.05), as compared to SPG medium incubated arteries. In comparison we performed similar experiments and incubated the carotid artery with M. pneumoniae. Incubation with M. pneumoniae did not affect the extent of atherosclerosis as compared to SPG medium incubated arteries, which was reflected by similar intima area, intima/media and intima/lumen ratios.

Plaque morphology

Composition of lesions was determined by histological and immunohistochemical staining techniques. The increased lesion size in C. pneumoniae infected arteries was found to be largely attributable to a significant 2.98-fold increased macrophage content of the lesion, as determined by MOMA-2 staining (Fig. 2C; 0.145 ± 0.025 vs. 0.048 ± 0.020, p<0.01). The higher macrophage content was accompanied by a decrease in smooth muscle cells and collagen. In C. pneumoniae infected carotid arteries a tendency towards less staining for alpha-smooth muscle cell actin per intima area was observed as compared with control incubated carotid arteries (Fig. 2F; 0.027 ± 0.007 vs. 0.064 ± 0.031), which was in parallel with the lower collagen content after C. pneumoniae incubation (Fig. 2I; 0.136 ± 0.055 vs. 0.069 ± 0.018). Again incubation with M. pneumoniae did not change the composition of the atherosclerotic plaques as compared to SPG medium incubated carotid arteries.

Fig. 2

Immunohistochemical analysis of plaques developed upon C. pneumoniae incubation (B,E,H) or control incubation (A,D,G). Increased MOMA-2 staining per intima area was observed in bacteria incubated arteries (A,B,C). Both ASMA (D,E) and Picrosirius Red staining (G,H) per intima area were diminished in bacteria incubated arteries as compared to controls (F,I, respectively) (**=p<0.01).

Fig. 2

Immunohistochemical analysis of plaques developed upon C. pneumoniae incubation (B,E,H) or control incubation (A,D,G). Increased MOMA-2 staining per intima area was observed in bacteria incubated arteries (A,B,C). Both ASMA (D,E) and Picrosirius Red staining (G,H) per intima area were diminished in bacteria incubated arteries as compared to controls (F,I, respectively) (**=p<0.01).

Inflammatory effect on the vessel wall

Since M. pneumoniae in no way affected the size or composition of the plaque we subsequently focused on the effect of the presence of C. pneumoniae on the expression of inflammatory markers in the vessel wall both at mRNA and protein level in LDLr-/- mice without induction of atherosclerosis. The presence of C. pneumoniae in the vessel wall after local incubation resulted 7 days later in a marked increase in ICAM-1 expression at protein level. Increased ICAM-1 staining was mainly located at the endothelial cell layer (Fig. 3A,B). Furthermore, at day 2 and 4 after local incubation with C. pneumoniae mRNA levels of MCP-1 in C. pneumoniae incubated carotids appeared to be significantly elevated 4.64- (p<0.01) and 6.79-fold (p<0.01), respectively (Fig. 3C), whereas no changes in mRNA levels for ICAM-1, VCAM-1, E-selectin, IL-6, IL-12, and Tissue Factor (TF) were observed.

Fig. 3

Analysis of inflammatory effects of C. pneumoniae on the arterial wall. Seven days post-incubation antibody staining showed that C. pneumoniae in the arterial wall increased ICAM-1 expression (B, arrows) as compared to controls (A). Expression of MCP-1 in the arterial wall on mRNA level was increased markedly at days 2 and 4 after local incubation with C. pneumoniae (▴) as compared with control incubation (□). (C, **=p<0.01).

Fig. 3

Analysis of inflammatory effects of C. pneumoniae on the arterial wall. Seven days post-incubation antibody staining showed that C. pneumoniae in the arterial wall increased ICAM-1 expression (B, arrows) as compared to controls (A). Expression of MCP-1 in the arterial wall on mRNA level was increased markedly at days 2 and 4 after local incubation with C. pneumoniae (▴) as compared with control incubation (□). (C, **=p<0.01).

Effect of C. pneumoniae on acute arterial thrombosis

The effect of C. pneumoniae in the vessel wall on the thrombogenicity of the carotid artery was assessed using a FeCl3-induced acute arterial thrombosis model. Seven days after infection of the carotid artery with C. pneumoniae no significant differences in time to occlusion after thrombus induction were observed between the SPG medium and the bacteria incubated arteries (1001 ± 138 vs. 1147 ± 164 s, respectively).

In vitro effect of C. pneumoniae on macrophages and endothelial cells

To further elucidate by which mechanisms C. pneumoniae is capable of stimulating atherogenesis, effects of C. pneumoniae on different cell types, present in the vessel wall, such as ECs and macrophages, were evaluated at mRNA level. The initial level of expression was measured at t=0 h post-infection, which represents the time point immediately after 1 h of centrifugation plus 1 h of incubation with C. pneumoniae. Infection of H5Vs with C. pneumoniae showed an inflammatory response, reflected in increased mRNA levels for MCP-1, for a number of adhesion molecules (E-selectin, ICAM-1, and VCAM-1) and for the cytokines TNF-α and IL-6. Peak values were observed at 2–6 h post-infection (Fig. 4A–F). At 8 h post-infection differences in expression levels between control and infected cells were smaller, while cell viability did not change. In RAWs, TNF-α and MCP-1 expression levels were elevated upon infection (Fig. 4G,H) and reached a maximum within the first hour, which was earlier than in H5Vs.

Fig. 4

Effects of C. pneumoniae on H5Vs (A–F) or RAWs (G,H). Cells were incubated with C. pneumoniae (▴) or SPG medium (□) for 2 h, including 1 h of centrifugation at 800 × g. Subsequently, cells were washed and incubated with medium prior to RNA isolation at indicated timepoints. Quantitative RT-PCR revealed that expression levels of several adhesion molecules, such as ICAM-1, VCAM-1, and E-selectin, were markedly elevated upon infection of H5Vs (A-C). Infection of H5Vs also caused an upregulation of MCP-1, TNF-α and IL-6 (D-F). Expression levels of MCP-1 and TNF-α were also elevated in RAWs upon infection with C. pneumoniae (*=p<0.05, **=p<0.01).

Fig. 4

Effects of C. pneumoniae on H5Vs (A–F) or RAWs (G,H). Cells were incubated with C. pneumoniae (▴) or SPG medium (□) for 2 h, including 1 h of centrifugation at 800 × g. Subsequently, cells were washed and incubated with medium prior to RNA isolation at indicated timepoints. Quantitative RT-PCR revealed that expression levels of several adhesion molecules, such as ICAM-1, VCAM-1, and E-selectin, were markedly elevated upon infection of H5Vs (A-C). Infection of H5Vs also caused an upregulation of MCP-1, TNF-α and IL-6 (D-F). Expression levels of MCP-1 and TNF-α were also elevated in RAWs upon infection with C. pneumoniae (*=p<0.05, **=p<0.01).

Discussion

In the present study, we investigated how direct infection of the vessel wall with C. pneumoniae affects atherosclerosis and thrombogenicity of the carotid artery. Although many groups have studied effects of lung infection with C. pneumoniae on atherosclerosis, little is known about the direct effect of C. pneumoniae in the vessel wall on this inflammatory process. Local administration of C. pneumoniae in coronary arteries of pigs or rabbits has been reported [25,26], but was never performed in atherosclerosis prone mice. Therefore, we established a novel model in which C. pneumoniae is delivered from the luminal side of the carotid artery to the vessel wall. This model mimics the delivery of C. pneumoniae to the arterial wall by infected monocytes and subsequent infection of arterial wall cells by C. pneumoniae after proliferation within macrophages. Using this model we can be sure that the arterial wall is infected. Therefore, this model may be preferred to study the in vivo effect of C. pneumoniae on the arterial wall, since in previous publications effects of C. pneumoniae on atherosclerosis via airway infection were not always accompanied by the positive identification of C. pneumoniae in the arterial wall. The fact that infection via the respiratory tract does not per se lead to positive infection of the arterial wall with C. pneumoniae may explain some of the conflicting results on the effects of C. pneumoniae in atherosclerosis prone mice. Furthermore, this local incubation model offers the opportunity to study the role of C. pneumoniae in the arterial wall without interference of indirect effects, such as effects on lipid metabolism or on systemic inflammation.

By means of local intra-vascular incubation with C. pneumoniae in the common carotid artery it is possible to introduce these bacteria in the vessel wall, which was confirmed by detecting the C. pneumoniae specific Omp A gene in the vessel wall 7 days after incubation in all C. pneumoniae incubated arteries. This detection method circumvents the problems that are met when using immunohistochemistry, in which antigens may be missed while cutting sections or when cross-reactivity with non-chlamydial plaque constituents may occur [27]. In addition, by detecting C. pneumoniae specific DNA it is possible to quantify the number of bacteria that infected the arterial wall. While C. pneumoniae was detected in high amounts in the arterial wall of incubated arteries, these bacteria were not detected in the lungs, liver and spleen of the mice that were locally incubated with C. pneumoniae, indicating the lack of systemic infection upon local incubation. Since ECs form the first barrier that has to be past and C. pneumoniae is able to infect these cells, both in vivo and in vitro, and replicate inside ECs [28,29], entrance of the elementary bodies seems to occur via infection of ECs. Although this model does not entirely mimic the physiological situation, in which bacteria are presumed to enter the vessel wall primarily while residing in monocytes and in which relatively less C. pneumoniae is found in the atherosclerotic plaque, it offers the opportunity to study effects of the actual presence of C. pneumoniae in the vessel wall.

With this local incubation model we demonstrate that C. pneumoniae in the vessel wall enhances collar-induced atherosclerosis in carotid arteries of LDLr-/- mice. Larger lesions were observed in bacteria incubated arteries, which translated into significant larger intima/media and intima/lumen ratios. These results indicate that presence of C. pneumoniae in the arterial wall creates inflammatory stimuli that enhance atherosclerosis and that systemic inflammation as induced by airway infection with C. pneumoniae is not a necessary stimulation for atherosclerosis development. In contrast, infection of the carotid artery with M. pneumoniae, a mild respiratory pathogen that has also been implicated in atherosclerosis, did not affect the size and composition of the atherosclerotic lesions in LDLr-/- mice.

In order to further evaluate the role of C. pneumoniae in different processes involved in atherosclerosis, lesion composition was elucidated by immunohistochemistry. Although larger lesions usually contain relatively less macrophages than smaller lesions, in this experiment the larger lesions in the bacteria incubated group contained relatively more macrophages. Presence of mononuclear infiltrates in vascular tissue upon infection with C. pneumoniae was studied previously. However, the outcome of these studies was not univocal [30–33]. The higher macrophage content observed after C. pneumoniae infection is in line with our in vitro and in vivo data, which showed elevated expression levels of ICAM-1 and MCP-1 upon infection, which can result in increased adherence of circulating monocytes to the endothelium and attraction of these cells into the intima. Furthermore, the finding that C. pneumoniae infection of monocytes can rescue these cells from apoptosis can also contribute to the increased macrophage content [34].

Lesions developed after C. pneumoniae incubation showed a tendency towards decreased α-actin and Picrosirius Red staining, which is indicative for reduced numbers of VSMCs and reduced collagen content, respectively. In vitro studies have shown that proliferation of SMCs can be stimulated by C. pneumoniae both directly and indirectly [35,36]. However, conditioned medium from C. pneumoniae infected SMCs inhibits proliferation of SMCs through induction of prostaglandin E2[37]. The sum of the in vitro C. pneumoniae induced effects is not well documented in vivo. Distinct observations have been reported in which both stimulatory and inhibiting actions of C. pneumoniae on SMCs proliferation were suggested [25,38,39]. Our study makes a net stimulatory effect of C. pneumoniae on SMCs in vivo less likely. Since collagen is mainly produced by the VSMCs in atherosclerotic lesions, the observed trend in the amount of collagen in the C. pneumoniae incubated carotids fits with the decreased amount of SMCs observed in the atherosclerotic lesions. Several groups have reported that upon infection with C. pneumoniae both macrophages and SMCs produce MMPs [40,41], which are able to degrade collagen. Previously, enhanced MMP-2 and MMP-9 production was observed in atherosclerotic lesions upon infection with C. pneumoniae in LDLr/ApoE double knock out mice [39]. This lesion morphology with more macrophages and the lack of compensatory elevated amounts of VSMCs and collagen point to a net destabilizing effect of C. pneumoniae.

Presence of C. pneumoniae in the vessel wall resulted in enhanced expression of MCP-1 at mRNA level. It remained unclear from these experiments to which cell types this increased expression can be contributed. However, since ECs, macrophages and VSMCs [41] in vitro show elevated expression of MCP-1 upon infection with C. pneumoniae they can be all involved in this response. Immunohistochemistry revealed increased ICAM-1 protein expression mainly on ECs, which, combined with the found elevated MCP-1 expression level, could contribute to the increased macrophage content, as observed in infected lesions. The lack of increased expression of ICAM-1 at mRNA level could be explained by the fact that expression levels at mRNA level were not specifically measured in the endothelium, but in the total vessel wall, which may dilute the ICAM-1 signal.

In vitro studies have shown that C. pneumoniae increases the expression of the pro-coagulant proteins TF and plasminogen activator inhibitor-1 in ECs, SMCs and macrophages [42,43], and accelerates clotting and phosphatidylserine exposure in several cell types [44]. However, in our in vivo model, in which acute thrombus formation was induced by peri-arterial application of FeCl3, no pro-thrombotic effect was observed 7 days after delivery of C. pneumoniae to the arterial wall. In addition, no upregulation of mRNA levels for TF was detected in the vessel wall during the first week after delivery of C. pneumoniae. These data suggest that previously shown in vitro indications for increased thrombogenicity upon infection with C. pneumoniae may be compensated by antithrombotic actions of C. pneumoniae in vivo, such as induction of the anti-thrombotic cytokine IL-10 [34,45], resulting in the absence of a significant effect of C. pneumoniae in the vessel wall on thrombogenicity.

In vitro infections of mouse ECs and macrophages with C. pneumoniae were performed to support the results observed in vivo. As demonstrated previously, infection of ECs induced an inflammatory response marked by elevated mRNA levels of IL-6, TNF-α, E-selectin, ICAM-1, and VCAM-1. Combined with the elevated MCP-1 expression in both macrophages and ECs, these data suggest that C. pneumoniae promotes monocyte adhesion and migration to the inner layers of the vessel wall, which is in accordance with the in vivo results.

In conclusion, this study demonstrates that direct infection of the carotid artery with C. pneumoniae enhances atherosclerosis in a novel model. C. pneumoniae affects the composition of the developing lesions towards a more vulnerable morphology via an increase in macrophage content, which was not observed after infection of the carotid artery with M. pneumoniae. Therefore, this study supports the specific contribution of C. pneumoniae to the progression of atherosclerosis. Enhanced macrophage content caused the major increase in lesion formation, and chemokines contributed to this increase. This local delivery model offers the opportunity to further elucidate the site-specific influences of C. pneumoniae on atherosclerosis.

Acknowledgments

This study was supported by grant 2000.198 and grant 2000D040 from the Netherlands Heart Foundation. J. Kuiper is the Established Investigator of the Netherlands Heart Foundation (grant 2000D040).

References

[1]
Ross
R.
Atherosclerosis–an inflammatory disease
N Engl J Med
 
1999
340
115
126
[2]
Grayston
J.T.
Infections caused by Chlamydia pneumoniae strain TWAR
Clin Infect Dis
 
1992
15
757
761
[3]
Saikku
P.
Leinonen
M.
Mattila
K.
Ekman
M.R.
Nieminen
M.S.
Makela
P.H.
et al
Serological evidence of an association of a novel Chlamydia, TWAR, with chronic coronary heart disease and acute myocardial infarction
Lancet
 
1988
2
983
986
[4]
Moazed
T.C.
Kuo
C.C.
Grayston
J.T.
Campbell
L.A.
Evidence of systemic dissemination of Chlamydia pneumoniae via macrophages in the mouse
J Infect Dis
 
1998
177
1322
1325
[5]
Kuo
C.C.
Shor
A.
Campbell
L.A.
Fukushi
H.
Patton
D.L.
Grayston
J.T.
Demonstration of Chlamydia pneumoniae in atherosclerotic lesions of coronary arteries
J Infect Dis
 
1993
167
841
849
[6]
Muhlestein
J.B.
Antibiotic treatment of atherosclerosis
Curr Opin Lipidol
 
2003
14
605
614
[7]
Kaukoranta-Tolvanen
S.S.
Ronni
T.
Leinonen
M.
Saikku
P.
Laitinen
K.
Expression of adhesion molecules on endothelial cells stimulated by Chlamydia pneumoniae
Microb Pathog
 
1996
21
407
411
[8]
Molestina
R.E.
Miller
R.D.
Ramirez
J.A.
Summersgill
J.T.
Infection of human endothelial cells with Chlamydia pneumoniae stimulates transendothelial migration of neutrophils and monocytes
Infect Immun
 
1999
67
1323
1330
[9]
Coombes
B.K.
Mahony
J.B.
cDNA array analysis of altered gene expression in human endothelial cells in response to Chlamydia pneumoniae infection
Infect Immun
 
2001
69
1420
1427
[10]
Kalayoglu
M.V.
Perkins
B.N.
Byrne
G.I.
Chlamydia pneumoniae-infected monocytes exhibit increased adherence to human aortic endothelial cells
Microbes Infect
 
2001
3
963
969
[11]
May
A.E.
Redecke
V.
Gruner
S.
Schmidt
R.
Massberg
S.
Miethke
T.
et al
Recruitment of Chlamydia pneumoniae-infected macrophages to the carotid artery wall in noninfected, nonatherosclerotic mice
Arterioscler Thromb Vasc Biol
 
2003
23
789
794
[12]
Kalayoglu
M.V.
Hoerneman
B.
LaVerda
D.
Morrison
S.G.
Morrison
R.P.
Byrne
G.I.
Cellular oxidation of low-density lipoprotein by Chlamydia pneumoniae
J Infect Dis
 
1999
180
780
790
[13]
Dittrich
R.
Dragonas
C.
Mueller
A.
Maltaris
T.
Rupp
J.
Beckmann
M.W.
et al
Endothelial Chlamydia pneumoniae infection promotes oxidation of LDL
Biochem Biophys Res Commun
 
2004
319
501
505
[14]
Rodel
J.
Prochnau
D.
Prager
K.
Pentcheva
E.
Hartmann
M.
Straube
E.
Increased production of matrix metalloproteinases 1 and 3 by smooth muscle cells upon infection with Chlamydia pneumoniae
FEMS Immunol Med Microbiol
 
2003
38
159
164
[15]
Campbell
L.A.
Rosenfeld
M.
Kuo
C.C.
The role of Chlamydia pneumoniae in atherosclerosis–recent evidence from animal models
Trends Microbiol
 
2000
8
255
257
[16]
Caligiuri
G.
Rottenberg
M.
Nicoletti
A.
Wigzell
H.
Hansson
G.K.
Chlamydia pneumoniae infection does not induce or modify atherosclerosis in mice
Circulation
 
2001
103
2834
2838
[17]
Higuchi
M.L.
Sambiase
N.
Palomino
S.
Gutierrez
P.
Demarchi
L.M.
Aiello
V.D.
et al
Detection of Mycoplasma pneumoniae and Chlamydia pneumoniae in ruptured atherosclerotic plaques
Braz J Med Biol Res
 
2000
33
1023
1026
[18]
Taylor-Robinson
D.
Chlamydia pneumoniae infection and coronary heart disease. Trials should assess whether antibiotics eliminate organism from atherosclerotic lesions
BMJ
 
1997
315
1538
[19]
Verkooyen
R.P.
Harreveld
S.
Ahmad Mousavi Joulandan
S.
Diepersloot
R.J.
Verbrugh
H.A.
Survival of Chlamydia pneumoniae following contact with various surfaces
Clin Microbiol Infect
 
1995
1
114
118
[20]
von der Thusen
J.H.
van Berkel
T.J.
Biessen
E.A.
Induction of rapid atherogenesis by perivascular carotid collar placement in apolipoprotein E-deficient and low-density lipoprotein receptor-deficient mice
Circulation
 
2001
103
1164
1170
[21]
von der Thusen
J.H.
van Vlijmen
B.J.
Hoeben
R.C.
Kockx
M.M.
Havekes
L.M.
van Berkel
T.J.
et al
Induction of atherosclerotic plaque rupture in apolipoprotein E-/- mice after adenovirus-mediated transfer of p53
Circulation
 
2002
105
2064
2070
[22]
Weiler
H.
Lindner
V.
Kerlin
B.
Isermann
B.H.
Hendrickson
S.B.
Cooley
B.C.
et al
Characterization of a mouse model for thrombomodulin deficiency
Arterioscler Thromb Vasc Biol
 
2001
21
1531
1537
[23]
Jantos
C.A.
Heck
S.
Roggendorf
R.
Sen-Gupta
M.
Hegemann
J.H.
Antigenic and molecular analyses of different Chlamydia pneumoniae strains
J Clin Microbiol
 
1997
35
620
623
[24]
Hoekstra
M.
Kruijt
J.K.
Van Eck
M.
Van Berkel
T.J.
Specific gene expression of ATP-binding cassette transporters and nuclear hormone receptors in rat liver parenchymal, endothelial, and Kupffer cells
J Biol Chem
 
2003
278
25448
25453
[25]
Pislaru
S.V.
Van Ranst
M.
Pislaru
C.
Szelid
Z.
Theilmeier
G.
Ossewaarde
J.M.
et al
Chlamydia pneumoniae induces neointima formation in coronary arteries of normal pigs
Cardiovasc Res
 
2003
57
834
842
[26]
Muhlestein
J.B.
Chlamydia pneumoniae-induced atherosclerosis in a rabbit model
J Infect Dis
 
2000
181
Suppl 3
S505
S507
[27]
Hoymans
V.Y.
Bosmans
J.M.
Ursi
D.
Martinet
W.
Wuyts
F.L.
Van Marck
E.
et al
Immunohistostaining assays for detection of Chlamydia pneumoniae in atherosclerotic arteries indicate cross-reactions with nonchlamydial plaque constituents
J Clin Microbiol
 
2004
42
3219
3224
[28]
Laitinen
K.
Laurila
A.
Pyhala
L.
Leinonen
M.
Saikku
P.
Chlamydia pneumoniae infection induces inflammatory changes in the aortas of rabbits
Infect Immun
 
1997
65
4832
4835
[29]
Gaydos
C.A.
Summersgill
J.T.
Sahney
N.N.
Ramirez
J.A.
Quinn
T.C.
Replication of Chlamydia pneumoniae in vitro in human macrophages, endothelial cells, and aortic artery smooth muscle cells
Infect Immun
 
1996
64
1614
1620
[30]
Neureiter
D.
Heuschmann
P.
Stintzing
S.
Kolominsky-Rabas
P.
Barbera
L.
Jung
A.
et al
Detection of Chlamydia pneumoniae but not of Helicobacter pylori in symptomatic atherosclerotic carotids associated with enhanced serum antibodies, inflammation and apoptosis rate
Atherosclerosis
 
2003
168
153
162
[31]
Aalto-Setala
K.
Laitinen
K.
Erkkila
L.
Leinonen
M.
Jauhiainen
M.
Ehnholm
C.
et al
Chlamydia pneumoniae does not increase atherosclerosis in the aortic root of apolipoprotein E-deficient mice
Arterioscler Thromb Vasc Biol
 
2001
21
578
584
[32]
Campbell
L.A.
Blessing
E.
Rosenfeld
M.
Lin
T.
Kuo
C.
Mouse models of C. pneumoniae infection and atherosclerosis
J Infect Dis
 
2000
181
Suppl 3
S508
S513
[33]
Davidson
M.
Kuo
C.C.
Middaugh
J.P.
Campbell
L.A.
Wang
S.P.
Newman
W.P.
III
et al
Confirmed previous infection with Chlamydia pneumoniae (TWAR) and its presence in early coronary atherosclerosis
Circulation
 
1998
98
628
633
[34]
Geng
Y.
Shane
R.B.
Berencsi
K.
Gonczol
E.
Zaki
M.H.
Margolis
D.J.
et al
Chlamydia pneumoniae inhibits apoptosis in human peripheral blood mononuclear cells through induction of IL-10
J Immunol
 
2000
164
5522
5529
[35]
Coombes
B.K.
Mahony
J.B.
Chlamydia pneumoniae infection of human endothelial cells induces proliferation of smooth muscle cells via an endothelial cell-derived soluble factor(s)
Infect Immun
 
1999
67
2909
2915
[36]
Sasu
S.
LaVerda
D.
Qureshi
N.
Golenbock
D.T.
Beasley
D.
Chlamydia pneumoniae and chlamydial heat shock protein 60 stimulate proliferation of human vascular smooth muscle cells via toll-like receptor 4 and p44/p42 mitogen-activated protein kinase activation
Circ Res
 
2001
89
244
250
[37]
Rodel
J.
Prochnau
D.
Prager
K.
Baumert
J.
Schmidt
K.H.
Straube
E.
Chlamydia pneumoniae decreases smooth muscle cell proliferation through induction of prostaglandin E2 synthesis
Infect Immun
 
2004
72
4900
4904
[38]
Coombes
B.K.
Chiu
B.
Fong
I.W.
Mahony
J.B.
Chlamydia pneumoniae infection of endothelial cells induces transcriptional activation of platelet-derived growth factor-B: a potential link to intimal thickening in a rabbit model of atherosclerosis
J Infect Dis
 
2002
185
1621
1630
[39]
Ezzahiri
R.
Stassen
F.R.
Kurvers
H.A.
van Pul
M.M.
Kitslaar
P.J.
Bruggeman
C.A.
Chlamydia pneumoniae infection induces an unstable atherosclerotic plaque phenotype in LDL-receptor, ApoE double knockout mice
Eur J Vasc Endovasc Surg
 
2003
26
88
95
[40]
Kol
A.
Sukhova
G.K.
Lichtman
A.H.
Libby
P.
Chlamydial heat shock protein 60 localizes in human atheroma and regulates macrophage tumor necrosis factor-alpha and matrix metalloproteinase expression
Circulation
 
1998
98
300
307
[41]
Dechend
R.
Gieffers
J.
Dietz
R.
Joerres
A.
Rupp
J.
Luft
F.C.
et al
Hydroxymethylglutaryl coenzyme A reductase inhibition reduces Chlamydia pneumoniae-induced cell interaction and activation
Circulation
 
2003
108
261
265
[42]
Dechend
R.
Maass
M.
Gieffers
J.
Dietz
R.
Scheidereit
C.
Leutz
A.
et al
Chlamydia pneumoniae infection of vascular smooth muscle and endothelial cells activates NF-kappaB and induces tissue factor and PAI-1 expression: a potential link to accelerated arteriosclerosis
Circulation
 
1999
100
1369
1373
[43]
Bea
F.
Puolakkainen
M.H.
McMillen
T.
Hudson
F.N.
Mackman
N.
Kuo
C.C.
et al
Chlamydia pneumoniae induces tissue factor expression in mouse macrophages via activation of Egr-1 and the MEK-ERK1/2 pathway
Circ Res
 
2003
92
394
401
[44]
Goth
S.R.
Stephens
R.S.
Rapid, transient phosphatidylserine externalization induced in host cells by infection with Chlamydia spp
Infect Immun
 
2001
69
1109
1119
[45]
Caligiuri
G.
Rudling
M.
Ollivier
V.
Jacob
M.P.
Michel
J.B.
Hansson
G.K.
et al
Interleukin-10 deficiency increases atherosclerosis, thrombosis, and low-density lipoproteins in apolipoprotein E knockout mice
Mol Med
 
2003
9
10
17

Author notes

Time for primary review 36 days