Abstract

Neurodegeneration in Alzheimer's disease and various experimental lesion paradigms are associated with an unscheduled upregulation of cell cycle–related proteins, indicating a link between cell cycle reactivation and neuronal death. Recent evidence, however, suggests that at least some of the canonical cell cycle regulators are constitutively expressed in differentiated neurons of the adult brain. Systematic investigations on the constitutive expression of cell cycle regulators in differentiated neurons in vivo, providing the basis for further insights into their potential role under pathological conditions, however, have not been carried out. Here, we demonstrate a constitutive neuronal expression of Cdks 1, 2, and 4; their activators cyclins D, A, B, and E; and their inhibitors p15Ink4b, p16Ink4a, p18Ink4c, p19Ink4d, p21Waf1/Cip1, p27Kip1, and p57Kip2 within the neocortex of adult mice by western blot and immunocytochemistry. Expression was verified by single-cell reverse transcriptase–polymerase chain reaction applied to individual microscopically identified neurons captured with laser dissection. Immunoprecipitation and in vitro kinase assays revealed that Cdks 1, 2, and 4 are properly complexed to cyclins and exhibit kinase activity. This physiological expression of positive cell cycle regulators in adult neurons is clearly not related to neuronal proliferation. Taken together, our findings demonstrate a constitutive expression of functionally active cyclin-dependent kinases and their regulators in differentiated neurons suggesting a noncanonical role of cell cycle regulators potentially linked to neuronal plasticity and/or stability.

Introduction

Once neurons are terminally differentiated, they lose their ability to proliferate. Maintenance of mitotic quiescence is essential for the functional stability of the complexly wired neuronal system. At the same time, however, terminally differentiated neurons retain a remarkable dynamic plasticity, which provides the basis for a lifelong structural adaptation of neuronal networks to meet functional needs. It had traditionally been assumed that the majority of molecules that regulate activation and orderly progression through the cell cycle are repressed in the mitotically quiescent G0 state. Although neurons are terminally differentiated and lack the ability to divide, the expression of potential cell cycle regulators such as cyclins D, A, B, and E as well as Cdks1, 2, and 4 in the adult brain has repeatedly been reported (see Fig. 1 for the role of cell cycle regulatory proteins in cell division cycle) (Tamaru et al. 1993; Miyajima et al. 1995; Li, Chopp, and Powers 1997; Small et al. 1999, 2001; Timsit et al. 1999; Matsunaga 2000; Gärtner et al. 2003; Schmetsdorf et al. 2005). Under pathophysiological conditons, their expression might play a role in apoptotic or necrotic events, associated with neurodegenerative diseases, seizure, ischemia, or stress (Freeman et al. 1994; Arendt et al. 1996; Li, Meyer, and Donoghue 1997; McShea et al. 1997; Nagy et al. 1997; Shirvan, Ziv, Barzilai, et al. 1997; Shirvan, Ziv, Machlin, et al. 1997; Arendt, Holzer, and Gärtner 1998; Arendt, Holzer, Gärtner, and Brückner 1998; Busser et al. 1998; Jordan-Sciutto et al. 1999; Timsit et al. 1999; Fischer et al. 2001; Ino and Chiba 2001; Katchanov et al. 2001; Liu and Greene 2001; Becker and Bonni 2004). Several studies, however, have reported the expression of cyclins, Cdks, and Cdkis under normal conditions in mature neurons, and an involvement in physiological functions beyond cell cycle regulation, including transcription, neuronal morphogenesis, and plasticity, has been proposed (Ross and Risken 1994; Yan and Ziff 1995; Ross et al. 1996; Xiong et al. 1997; Huard et al. 1999; Richter 2001; Becker and Bonni 2005). Still, it remains obscure whether Cdks and cyclins form active complexes in differentiated neurons giving rise to kinase activity under normal conditions. Therefore, in the present study, we analyzed the expression of Cdks, cyclins, and Cdk inhibitors both at the protein and mRNA level by immunocytochemistry and single-cell reverse transcriptase–polymerase chain reaction (RT-PCR) applied to individual microscopically identified neurons captured with laser dissection. Immunoprecipitation and in vitro kinase assays were applied to analyze whether Cdks are properly complexed to cyclins and exhibit kinase activity.

Figure 1.

Schematic illustration of the involvement of cell cycle regulatory proteins in cell division. During the cell division cycle, expression and activity of Cdks and cyclins, the positive regulatory subunits of Cdks, are regulated in a phase-dependent manner. The activity of cyclin–Cdk complexes is negatively controlled by inhibitors of the Ink4 family (p15Ink4b, p16Ink4a, p18Ink4c, p19Ink4d) and of the Cip/Kip family (p21Waf1/Cip1, p27Kip1, p57Kip2). G0, stationary phase; G1, first gap phase; R, restriction point; S, DNA synthesis phase; G2, second gap phase; M, mitosis phase.

Figure 1.

Schematic illustration of the involvement of cell cycle regulatory proteins in cell division. During the cell division cycle, expression and activity of Cdks and cyclins, the positive regulatory subunits of Cdks, are regulated in a phase-dependent manner. The activity of cyclin–Cdk complexes is negatively controlled by inhibitors of the Ink4 family (p15Ink4b, p16Ink4a, p18Ink4c, p19Ink4d) and of the Cip/Kip family (p21Waf1/Cip1, p27Kip1, p57Kip2). G0, stationary phase; G1, first gap phase; R, restriction point; S, DNA synthesis phase; G2, second gap phase; M, mitosis phase.

Materials and Methods

Animals

Brains were obtained from 6 adult NMRI mice. In addition, 3 mouse embryonic brains (embryonal day 14, E14) were used for immunoprecipitation-based kinase assays. The animals were strictly treated following the guidelines set by the Panel on Euthanasia and the Guide for the Care and Use of Laboratory Animals. Protocols were approved by the Ethical Committee of Leipzig University. We made all efforts to minimize the number of animals used and their suffering.

Tissue Preparation and Immunocytochemistry

Mice were overdosed with carbon dioxide and perfused transcardially with ice-cold saline. Animals were then fixed by perfusion with 0.1 M phosphate-buffered saline containing 4% formaldehyde (pH 7.4). The removed brains were postfixed in the same solution for 3 days at 4 °C and cryoprotected in 30% saccharose. Blocks of mouse brain were cut in the coronal plane at 30 μm on a freezing microtome. Sections were incubated in 0.1 M Tris-buffered saline (TBS, pH 7.4) containing 1% H2O2 (30 min) to quench endogen peroxidase activity. For antigen retrieval, sections were pretreated with citrate buffer (pH 6.0) for 10 min in a microwave oven. Nonspecific binding sites were masked by incubation with blocking solution containing 0.3% fat-free dried milk and 0.1% gelatine. Subsequently, tissue was immunoreacted with one of the primary antisera listed in Table 1 overnight at 4 °C. Section-bound antibodies were revealed with biotinylated donkey anti-rabbit antiserum (1:1000, 1 h, Amersham; Buckinghamshire, UK) or donkey anti-goat antiserum (1:1000, 1 h, Jackson, Suffolk, UK), ExtrAvidin®-peroxidase conjugate (1:1000, 1 h, Sigma, Munich, Germany) and 3,3′-diaminobenzidine (DAB)/NiNH4SO4 as chromogen.

Table 1

List of primary antisera used in this study

Antibody specificity Dilution Antibody specificity Dilution 
Cyclin A (H-432) 1:800 Cdk2 (M2) 1:500 
Cyclin A (C-19) 1:800 Cdk4 (H-303) 1:800 
Cyclin B1 (H-433) 1:800 Cdk4 (C-19) 1:800 
Cyclin B1 (H-20) 1:800 p15Ink4b (C-20) 1:500 
Cyclin D3 (H-292) 1:500 p16Ink4a (M-156) 1:500 
Cyclin D3 (C-16) 1:500 p18Ink4c (C-19) 1:500 
Cyclin E (M-20) 1:1000 p19Ink4d (M-20) 1:500 
Cyclin E (H-145) 1:1000 p21Waf1/Cip1 (M-19) 1:1000 
Cdk1 (H-297) 1:500 p27Kip1 (C-19) 1:1000 
Cdk1 (C-19) 1:500 p57Kip2 (C-19) 1:500 
Cdk2 (H-298) 1:500   
Antibody specificity Dilution Antibody specificity Dilution 
Cyclin A (H-432) 1:800 Cdk2 (M2) 1:500 
Cyclin A (C-19) 1:800 Cdk4 (H-303) 1:800 
Cyclin B1 (H-433) 1:800 Cdk4 (C-19) 1:800 
Cyclin B1 (H-20) 1:800 p15Ink4b (C-20) 1:500 
Cyclin D3 (H-292) 1:500 p16Ink4a (M-156) 1:500 
Cyclin D3 (C-16) 1:500 p18Ink4c (C-19) 1:500 
Cyclin E (M-20) 1:1000 p19Ink4d (M-20) 1:500 
Cyclin E (H-145) 1:1000 p21Waf1/Cip1 (M-19) 1:1000 
Cdk1 (H-297) 1:500 p27Kip1 (C-19) 1:1000 
Cdk1 (C-19) 1:500 p57Kip2 (C-19) 1:500 
Cdk2 (H-298) 1:500   

Note: Host species of all antisera is rabbit, except p18Ink4c (C19) and p57Kip2 (C-19), which are from goat. All antisera were obtained from Santa Cruz Biotechnology, Inc., Heidelberg, Germany.

All incubation steps were separated by intense washing with TBS. For double-fluorescence immunostaining, sections were reacted first with anti-Cdk antisera, followed by visualization with Cy2-tagged donkey anti-rabbit antiserum (1:500, 1 h, Jackson ImmunoResearch Inc.). In a second step, after reapplying blocking, tissue was incubated with anti-cyclin antisera, and fluorescent detection was performed by using Cy3-conjugated donkey anti-rabbit antiserum (1:500, 1 h, Jackson ImmunoResearch Inc.). The specificity of labeling was tested by omitting primary antisera. After such incubation, tissue was devoid of immunoreactivity as expected (Fig. 4). Finally, the sections were coverslipped with Entellan® (Merck, Darmstadt, Germany). Images were captured with the digital microscope camera AxioCamHRC running on the AxioVision 3.1 Software (both Carl Zeiss Vision) and processed with Adobe® Photoshop® 7.0 (Adobe Systems, Mountain View, CA).

Electrophoresis and Immuno–Western Blotting

The total protein fraction (50 μg per lane, Bradford assay) of neocortical homogenates was separated by 12% SDS-PAGE (sodium dodecyl sulfate–polyacrylamide gel electrophoresis) and subsequently transferred onto polyvinylidene fluoride membrane (Polyscreen, DuPont-New England Nuclear, Boston, MA), using a semidry blot system (TransBlot™, BioRad, Hercules, Canada). Equal amount of the protein loaded on the gel was controlled by Coomassie staining. For immunodetection of cyclins, Cdks, and Cdkis, membranes were incubated in 2% bovine serum albumin (in TBS) and probed with primary antisera (Table 1; 1 h, dilution 1:500) at room temperature. After washing in TBS/0.1% Tween-20, blots were incubated with biotinylated donkey anti-rabbit antiserum (1 h, 1:1000, Amersham) or anti-goat antiserum (1 h, 1:1000, Jackson), respectively. Immunodetection was visualized with ExtrAvidin®-peroxidase conjugate (1 h, 1:1000, Sigma) and DAB/NiCl2/0.015% H2O2.

RNA Isolation and Reverse Transcription

Single pyramidal neurons of layer V (200 cells per trial) were dissected from freshly prepared Nissl-stained frozen sections (30 μm) of adult mouse somatosensory cortex (Fig. 2) using laser microdissection and pressure catapulting technology (PALM® MicroBeam system, P.A.L.M. Microlaser Technologies AG, Bernried, Germany). RNA of collected cells was extracted with RNeasy™ Mini Kit (Quiagen, Hilden, Germany) according to the manufacturer's instructions.

Figure 2.

Photomicrographs of a coronal frozen Nissl-stained section before (A) and after (B) laser microdissection of single layer V pyramidal neurons. Corresponding cell locations are indicated by arrow heads. Bar in (B) (also refers to A): 50 μm.

Figure 2.

Photomicrographs of a coronal frozen Nissl-stained section before (A) and after (B) laser microdissection of single layer V pyramidal neurons. Corresponding cell locations are indicated by arrow heads. Bar in (B) (also refers to A): 50 μm.

First strand synthesis was conducted by incubating 8 μL RNA, 1 μL Random Hexamere, and 1 μL 2′-deoxynucleoside 5′-triphosphate for 5 min at 65 °C followed by rapid cooling on ice. To each mixture, the following was added: 2 μL 10× reverse transcriptase (RT) buffer, 1 μL 25 mM MgCl2, 2 μL 0.1 M dithiothreitol (DTT), and 1 μL RNase inhibitor. This cocktail was incubated for 2 min at 25 °C before 1 μL SuperScript II RT was added. The mixture was then incubated for 10 min at 25 °C and subsequently heated for a further 50 min at 42 °C. The reaction was stopped by heating at 70 °C for 15 min and terminated by incubation with 1 μL RNase H for 20 min at 37 °C. All cDNA samples were stored at −20 °C until analysis.

Real-Time RT-PCR

Real-time RT-PCR was performed on Rotor-Gene™ 2000 (Corbett Research, Sydney, Australia). For each marker, 3 independent experiments were performed. In each experiment, duplicates of a standard dilution series of specific polymerase chain reaction (PCR) fragments for each cell cycle protein and cDNA (total RNA equivalent) of unknown samples were amplified in a 25-μL reaction mixture containing AccuPrime™ Taq Polymerase (Invitrogen™ Life Technologies, Karlsruhe, Germany) in 1× PCR buffer, 50 pM forward and reverse primers (sequences of primers are given in Table 2), SYBR® Green I nucleic acid stain (1:2000; Cambrex Bio Science Rockland, Inc., Verviers, Belgium), and nuclease-free water. The thermal profile consisted of 1 cycle at 95 °C for 3 min followed by 45 cycles at 95 °C for 30 s then 60–64 °C for 1 min. Product specificity was confirmed in initial experiments by agarose gel electrophoresis and routinely by melting curve analysis.

Table 2

List of primers used for real-time RT-PCR

Transcripts to be detected Primer forward Primer reverse Size (bp) 
Cyclin D3 5′gctccaaccttctcagttgc3′ 5′agctaagcagcaagcaaagc3′ 208 
Cyclin A 5′acctgccttcactcattgct3′ 5′ttgactgttgggcatgttgt3′ 176 
Cyclin B 5′cagttgtgtgcccaagaaga3′ 5′ctacggaggaagtgcagagg3′ 216 
Cyclin E 5′caccactgagtgctccagaa3′ 5′ccacatttgctcacaaccac3′ 176 
Cdk1 5′ctcggctcgttactccactc3′ 5′tccacttgggaaaggtgttc3′ 203 
Cdk4 5′ctggtaccgagctcctgaag3′ 5′ttgtgcaggtaggagtgctg3′ 357 
Neurofilament H 5′agcccaaggactctacagca3′ 5′gccttggtgtcttctgcttc3′ 176 
Glial fibrillary acidic protein 5′agaaaaccgcatcaccattc3′ 5′tcacatcaccacgtccttgt3′ 184 
Transcripts to be detected Primer forward Primer reverse Size (bp) 
Cyclin D3 5′gctccaaccttctcagttgc3′ 5′agctaagcagcaagcaaagc3′ 208 
Cyclin A 5′acctgccttcactcattgct3′ 5′ttgactgttgggcatgttgt3′ 176 
Cyclin B 5′cagttgtgtgcccaagaaga3′ 5′ctacggaggaagtgcagagg3′ 216 
Cyclin E 5′caccactgagtgctccagaa3′ 5′ccacatttgctcacaaccac3′ 176 
Cdk1 5′ctcggctcgttactccactc3′ 5′tccacttgggaaaggtgttc3′ 203 
Cdk4 5′ctggtaccgagctcctgaag3′ 5′ttgtgcaggtaggagtgctg3′ 357 
Neurofilament H 5′agcccaaggactctacagca3′ 5′gccttggtgtcttctgcttc3′ 176 
Glial fibrillary acidic protein 5′agaaaaccgcatcaccattc3′ 5′tcacatcaccacgtccttgt3′ 184 

For each run, data acquisition and analysis were done by Rotor-Gene™ 2000 system software. The relative number of molecules of each transcript was determined by interpolating the cycle threshold values of the unknown samples to each standard curve.

PCR products were separated by flatbed electrophoresis in 2% agarose gels (100 V for 30–40 min), stained with ethidium bromide, and visualized under an UV transilluminator. Gel images were captured using Phoretix™ Grabber software version 2.0 (NonLinear Dynamics, Newcastle upon Tyne, UK).

Preparation of Cell Extracts and Immunoprecipitation

Freshly prepared neocortical tissue was homogenized in NP-40 lysis buffer (0.5% Nonidet P-40 in 20 mM Tris-HCL, pH 7.2, containing 100 mM NaCl, 2 mM MgCl2, 5 mM NaF, 1 mM Na3VO4, 1 mM DTT, and 100 μg/mL phenylmethylsulphonylfluoride [PMSF] and 2 μg/mL Leupeptin). After a 1-h incubation at 4 °C, lysates were cleared by centrifugation at 15 000 × g for 30 min and the supernatant was frozen.

For immunoprecipitation, undiluted primary antisera (anti-Cyclin D3, -Cyclin A, -Cyclin B, and -Cyclin E; anti-Cdk1, -Cdk2, and -Cdk4) or normal rabbit antiserum (control) were preincubated for 1 h with 10 μL Dynabeads® protein A solution (Dynal, Hamburg, Germany) at 4 °C. Dynabeads® protein A–antibody complexes were washed 3 times with bead buffer (20 mM Tris-HCL, pH 7.2, 2 mM MgCl2, 0.5% NP-40, 0.15 M NaCl, 1 mM DTT, 100 μg/mL PMSF, 2 μg/mL Leupeptin) and resuspended in bead buffer. Aliquots of NP-40 extracted proteins were incubated with Dynabeads® protein A–antibody complexes and shaken gently overnight at 4 °C. Immunoprecipitates (IPs) were washed 3 times with bead buffer.

To test for coimmunoprecipitation, the precipitated pellets were separated by SDS-PAGE and immunoblotted using antisera against relevant binding partners.

Immunoprecipitation-Based In Vitro Kinase Assays

IPs (anti-Cyclin D3, -Cyclin A, -Cyclin B, -Cyclin E) were washed in kinase buffer (20 mM Tris-HCL, pH 7.2, 10 mM MgCl2, 1 mM DTT, 60 mM β-Glycerophosphate, and 100 μg/mL PMSF and 2 μg/mL Leupeptin) and resuspended in 50 mL kinase buffer containing 0.5 mg of histone H1, 10 μCi of [γ-32P]-ATP, and 20 μM ATP. All reaction mixtures were incubated for 1 h at 30 °C and stopped by boiling for 5 min in 4× Laemmli sample buffer. Then, equal amounts of protein (10 μg per lane) were resolved on 12% SDS gels. Histone H1 was separated from free [γ-32P]-ATP on 12% polyacrylamide gels. Phosphorylated histone H1 was detected by autoradiography (Kodak X-Omat film, Rochester, NY). Control incubations were performed in the absence of histone. In addition, IPs from incubation with normal rabbit serum (NRS) were used as a further control.

Results

Neuronal expression of cell cycle regulatory proteins in the neocortex of adult mice were analyzed both at the protein and mRNA level. Immunocytochemical detection of cell cycle markers was verified by single-cell RT-PCR applied to individual microscopically identified neurons captured with laser dissection. Immunoprecipitation and in vitro kinase assays were used to analyze whether cyclin-dependent kinases are properly complexed to cyclins and exhibit kinase activity.

Western Blotting and Immunocytochemistry

A panel of antibodies was used both on western blots and immunocytochemical preparations to detect Cdks1, 2, and 4 and their binding partners such as cyclins D, A, B, and E as well as the inhibitors p15Ink4b, p16Ink4a, p18Ink4c, p19Ink4d, p21Waf1/Cip1, p27Kip1, and p57Kip2 (Figs 3 and 5). On western blots, signals at the appropriate molecular weight were obtained with at least 2 different antibodies for each protein (Fig. 3).

Figure 3.

Detection of cell cycle–related proteins by western blot. Crude homogenate of neocortical tissue was separated by 12% SDS-PAGE, transferred to polyvinylidene fluoride membrane, and probed with the primary antisera listed in Table 1. Noncropped western blots of cyclins B and E are provided to evaluate significance of dendritic staining. Control incubations in the absence of primary antisera show no labeling (at the right bottom).

Figure 3.

Detection of cell cycle–related proteins by western blot. Crude homogenate of neocortical tissue was separated by 12% SDS-PAGE, transferred to polyvinylidene fluoride membrane, and probed with the primary antisera listed in Table 1. Noncropped western blots of cyclins B and E are provided to evaluate significance of dendritic staining. Control incubations in the absence of primary antisera show no labeling (at the right bottom).

Immunocytochemical detection of each protein was performed with at least 2 different antisera that gave rise to identical staining patterns. Control sections that were not incubated with primary antibody remained unstained (Fig. 4). In general, there was no definite evidence for glial expression of any of the analyzed cell cycle–related proteins (Fig. 5). A synopsis of characteristics of neuronal immunostaining is given in Table 3. Immunoreactivity for cyclins D, A, B, and E was clearly detectable in neocortical neurons. It was most prominent in pyramidal cells that were most intensely stained in layer V. Apart from nuclear localization, cyclins D and A were also present in the perinuclear cytoplasm and in dendrites of these neurons. In contrast to this, immunostaining of cyclins E and B was more pronounced in dendrites but present in nuclei to a lesser extent (Fig. 5).

Figure 4.

Control sections of adult brain incubated in the absence of primary antisera showed no immunostaining. (A) anti-rabbit antiserum, (B) anti-goat antiserum. Bar in (B) (also refers to A): 50 μm.

Figure 4.

Control sections of adult brain incubated in the absence of primary antisera showed no immunostaining. (A) anti-rabbit antiserum, (B) anti-goat antiserum. Bar in (B) (also refers to A): 50 μm.

Figure 5.

Immunohistochemical localization of cyclins, Cdks, and Cdkis in the somatosensory cortex of adult mouse brain at 2 different magnifications thereby zooming in on layer V neurons. Bar at bottom of third column (also refers to first column): 200 μm. Bar at bottom of fourth column (also refers to second column): 25 μm.

Figure 5.

Immunohistochemical localization of cyclins, Cdks, and Cdkis in the somatosensory cortex of adult mouse brain at 2 different magnifications thereby zooming in on layer V neurons. Bar at bottom of third column (also refers to first column): 200 μm. Bar at bottom of fourth column (also refers to second column): 25 μm.

Table 3

Synopsis of subcellular distribution of cell cycle–related proteins in layer V neurons

Marker Localization 
 Nuc Cyt Dendrites 
CycD ++ ++ 
CycE +++ +++ 
CycA +++ 
CycB ++ +++ +++ 
Cdk1 ++ 
Cdk2 ++ − 
Cdk4 +++ − 
p15 − ++ 
p16 ++ ++ ++ 
p18 − +++ +++ 
p19 ++ ++ +++ 
p21 ++ 
p27 +++ ++ +++ 
p57 − − 
Marker Localization 
 Nuc Cyt Dendrites 
CycD ++ ++ 
CycE +++ +++ 
CycA +++ 
CycB ++ +++ +++ 
Cdk1 ++ 
Cdk2 ++ − 
Cdk4 +++ − 
p15 − ++ 
p16 ++ ++ ++ 
p18 − +++ +++ 
p19 ++ ++ +++ 
p21 ++ 
p27 +++ ++ +++ 
p57 − − 

Note: The number of plus symbols indicates grading of staining intensity: (+++) > (++) > (+). Minus symbol denotes negligible staining. nuc, nucleus; cyt, cytoplasm.

Similar to cyclins, immunoreactivity for Cdk1 and Cdk4 is found in pyramidal neurons within layers II/III and V (Fig. 5). The expression of these proteins is preferentially detected in the nuclear compartment. In contrast to these kinases, Cdk2 is present only in the perinuclear cytoplasm of neurons (Fig. 5). Cdks and their corresponding cyclins are colocalized in neurons (Fig. 6).

Figure 6.

Double-fluorescence immunolabeling showing the cellular colocalization of cyclin D-Cdk4 (H-292, H-303), cyclin A-Cdk2 (H-432, H-298), cyclin B-Cdk1 (H-433, H-297), and cyclin E-Cdk2 (M-20, H-298). Corresponding images are arranged in columns. Bar at bottom of fourth column: 20 μm.

Figure 6.

Double-fluorescence immunolabeling showing the cellular colocalization of cyclin D-Cdk4 (H-292, H-303), cyclin A-Cdk2 (H-432, H-298), cyclin B-Cdk1 (H-433, H-297), and cyclin E-Cdk2 (M-20, H-298). Corresponding images are arranged in columns. Bar at bottom of fourth column: 20 μm.

The expression of Cdk inhibitors is distributed equally throughout cortical layers. The Ink4 inhibitors p15Ink4b and p18Ink4c are present in dendrites but not in nuclei. P16Ink4a immunoreactivity, on the other hand, is found only in neuronal nuclei (Fig. 5). Staining for p21Waf1/Cip1 and p27Kip1 proteins is present both in the nuclear and in the cytoplasmic compartment. Moreover, p21Waf1/Cip1 immunoreactivity is also detectable in pyramidal cell dendrites. The inhibitor p57Kip2 is exclusively seen in the cytoplasmic compartment of pyramidal cells (Fig. 5).

Single-Cell mRNA Analysis by Laser Microdissection and Real-Time RT-PCR

Immunohistochemical findings indicate the occurrence of a variety of cell cycle markers in layer V pyramidal cells of adult mice. To rule out any false-positive results arising through potential cross-reactivity of antibodies, we verified these findings with an additional independent method and analyzed the expression of corresponding transcripts at the single-cell level by PCR after laser microdissection of individual neurons identified under the microscope.

We were able to obtain PCR products specific for cyclins D3, A, B, and E and Cdks 1 and 4 as well as p27Kip1, amplified from cDNA templates prepared from individual layer V neurons. Simultaneous detection of neurofilament H message but not of glial fibrillary acidic protein mRNA ensured that only neurons but not glial cells were included in the analysis. The presence of single products of the expected size was verified by gel electrophoresis (Fig. 7).

Figure 7.

Visualization of PCR products in 2% agarose gel after staining with ethidium bromide verifies the correct target sequence amplification. Simultaneous detection of neurofilament H (NF-H) message but not of gilal fibrillary acidic protein (GFAP) mRNA ensured that only neuronal cells were included in the analysis. Arrow heads point to unspecific primer dimers.

Figure 7.

Visualization of PCR products in 2% agarose gel after staining with ethidium bromide verifies the correct target sequence amplification. Simultaneous detection of neurofilament H (NF-H) message but not of gilal fibrillary acidic protein (GFAP) mRNA ensured that only neuronal cells were included in the analysis. Arrow heads point to unspecific primer dimers.

Physical and Functional Interactions between Cyclins and Cdks

The pattern of immunohistochemical labeling (see Figs 5 and 6) suggests the neuronal coexpression of cell cycle–related proteins. In order to determine whether Cdks and corresponding cyclins interact physically, IPs of cyclin D3, cyclin A, cyclin B, and E as well as Cdk1, Cdk2, and Cdk4 were immunoblotted with antisera to the physiologically relevant binding partners. The following proteins have been shown to be reciprocally coimmunoprecipitated, strongly indicating their physical association: cyclin D3 with Cdk4, cyclins A and E with Cdk2, and cyclin B with Cdk1 (Fig. 8).

Figure 8.

Physical interactions between Cdks and cyclins. Extracted proteins from the neocortex were subjected to immunoprecipitation with antisera to either Cyclin D3, Cylin A, Cyclin B, or Cyclin E or with NRS (control, on the right). Precipitates were probed for the presence of Cdks1, 2, and 4 by western blot analysis. The mobility of molecular mass markers (M) is indicated (in kDa).

Figure 8.

Physical interactions between Cdks and cyclins. Extracted proteins from the neocortex were subjected to immunoprecipitation with antisera to either Cyclin D3, Cylin A, Cyclin B, or Cyclin E or with NRS (control, on the right). Precipitates were probed for the presence of Cdks1, 2, and 4 by western blot analysis. The mobility of molecular mass markers (M) is indicated (in kDa).

Beyond the characterization of physical interactions, the functional relevance of cyclin–Cdk complexes at different developmental stages was tested by an immunoprecipitation-based in vitro kinase assay. Incubation of histone H1 with anti-Cyclin D3, -Cyclin A, -Cyclin B, or -Cyclin E IPs clearly resulted in phosphorylation of the substrate, although to a lesser extent compared with incubation with IPs obtained from embryonic lysates. No activity was found when NRS IPs were assayed (Fig. 9).

Figure 9.

Immunoprecipitation-linked in vitro kinase assays to characterize the functional relevance of cyclin–Cdk complexes. IPs (please refer to Fig. 8) obtained from embryonic (E14) and adult (ad) lysates were assayed for kinase activity towards histone H1. Data demonstrate the functional association of cyclins with Cdks and suggest a persistent Cdk activity in the adult neocortex. Control incubations were performed in the absence of histone (co) or with IPs obtained with NRS (right).

Figure 9.

Immunoprecipitation-linked in vitro kinase assays to characterize the functional relevance of cyclin–Cdk complexes. IPs (please refer to Fig. 8) obtained from embryonic (E14) and adult (ad) lysates were assayed for kinase activity towards histone H1. Data demonstrate the functional association of cyclins with Cdks and suggest a persistent Cdk activity in the adult neocortex. Control incubations were performed in the absence of histone (co) or with IPs obtained with NRS (right).

Discussion

The findings of the present study demonstrate the constitutive neuronal expression of numerous cell cycle–related proteins in the adult mouse neocortex. Cell cycle regulators were found in the perikaryal cytoplasm, in dendrites, and also in nuclei of differentiated neurons. As a potential cross-reactivity of antisera with other proteins cannot entirely be ruled out, neuronal expression, detected on immunohistochemical preparations and western blot, for a selected number of cell cycle regulators was verified at the single-cell mRNA level. In addition, biochemical data demonstrate that cyclins are adequately complexed with Cdks, resulting in catalytic kinase activity. Because immunhistochemical data do not suggest the presence of significant cyclin and Cdk levels in the glial population, biochemical activity is likely attributed to neurons.

Present data provide direct evidence for the constitutive expression of cyclins D, A, B, and E in postmitotic neurons within the cerebral cortex suggesting a function for these proteins beyond the regulation of activation and progression of the cell cycle. These observations are consistent with previous evidence from several groups, including our own, to indicate that cyclins D, A, B, and E in particular are expressed in mature neurons of the neocortex and hippocampus under physiological conditions (Tamaru et al. 1993; Miyajima et al. 1995; Oka et al. 1996; Van Lookeren Campagne and Gill 1998a; Small et al. 1999, 2001; Timsit et al. 1999; Matsunaga 2000; Hoozemans et al. 2002; Gärtner et al. 2003; De Falco et al. 2004; Schmetsdorf et al. 2005). This constitutive expression of cyclins in differentiated neurons, however, has not been investigated systematically, and their functional binding to cyclin-dependent kinases had not been reported previously. In proliferative cells, cyclins localized to the cytoplasm are proteolytically degraded by ubiquination and destruction in proteasomes (Sudakin et al. 1995; Clurman et al. 1996; Klotzbucher et al. 1996; Udvardy 1996; Diehl et al. 1997, 1998). However, cytoplasmic sequestration of cyclins, for example, of cylin E and cyclin D1, might be characteristic for postmitotic neurons and may be associated with a physiological role other than regulation of the cell cycle (Matsunaga 2000; Sumrejkanchanakij et al. 2003; De Falco et al. 2004). As has been shown for cyclin D1, cytoplasmic compartmentalization is determined by interaction with proteins such as glycogen synthase kinase-3β and specific exportins (Diehl et al. 1998). It is thus tempting to speculate that in differentiated neurons, cyclins might have alternative binding partners that prevent degradation and assist in mediating non-cell cycle–related functions.

In addition to cyclin expression, present results also clearly showed the presence of Cdks 1, 2, and 4 in postmitotic neurons of the neocortex. Immunohistochemical findings illustrate the localization of Cdks both in the cytoplasmic compartment and in the nuclei of neurons, so extending recent data on mouse hippocampus (Schmetsdorf et al. 2005). In addition to immunohistochemical detection, we also provide evidence for expression of Cdk1 and Cdk4 at the single-cell mRNA level of identified neurons and demonstrate a physical interaction between Cdks 1, 2, and 4 and the relevant cyclins, which results in adequate levels of kinase activity to suggest a catalytic function. Expression of cyclin-dependent kinases has previously been observed in a variety of differentiated neurons. In postmitotic sympathetic neurons of cervical ganglia, for example, mRNAs encoding for Cdk4 and Cdk5 have been detected (Freeman et al. 1994), whereas other studies have described expression of Cdks 1 and 2 in postmitotic differentiating cells, including neocortical neurons (Okano et al. 1993; Wood and Zinsmeister 1993; Delalle et al. 1999; Watanabe et al. 1999). Constitutive expression of Cdk2 and Cdk4 has also been found in differentiated muscle and PC12 cells (Jahn et al. 1994; Dobashi et al. 1996).

Cellular functions of active cyclin–Cdk complexes have previously been attributed to additional physiological effects, such as metabolic regulation or basal transcription (Kaffman et al. 1994; Roy et al. 1994; Rickert et al. 1996). If the dendritic localization of cyclins is considered, the expression of Cdks and cyclins in differentiated neurons may reflect a function in network stabilization and/or neuroplastic mechanisms. In neurons, Cdk1 phosphorylates microtubule-associated proteins, including tau protein, and neurofilaments (Hisanaga et al. 1991; Mawal-Dewan et al. 1992; Scott et al. 1993). Very recently, it was found that Cdk2 can be activated by neuregulin, and knockdown or inhibition of Cdk2 prevents neuregulin-induced differentiation and expression of the acetylcholine receptor ϵ subunit in myotubes (Lu et al. 2005). Thus, we speculate that Cdk activity might be associated with the regulation of synaptogenesis and cytoskelatal dynamics during neuronal morphogenesis and differentiation in the adult brain.

The present immunohistochemical analysis further demonstrates the expression of Ink4 and Cip/Kip inhibitors of cyclin-dependent kinases in mature cortical neurons, which confirms and extents previous findings on mouse hippocampal neurons (Schmetsdorf et al. 2005). Neuronal expression of Cdk inhibitors may indirectly indicate the presence of cyclins/Cdks and might be involved in establishing and maintaining the differentiated state of neurons and prevents them from cell cycle reentry.

The intensity of p19Ink4d expression, for example, increases during neural ascent from the ventricular zone to the cortical plate along with progressive differentiation of neurons. Therefore, this inhibitor has been suggested to play a role in maintaining neurons in the postmitotic state (Zindy et al. 1999). P19Ink4d cooperates with the Cip/Kip inhibitor p27Kip1, and both are required to control cell cycle exit and to repress neuronal proliferation (Lee et al. 1996; Zindy et al. 1997, 1999; Löwenheim et al. 1999; Miyazawa et al. 2000). Accordingly, p27Kip1 expression is high in cells exiting the proliferative phase (Lee et al. 1996; Van Lookeren Campagne and Gill 1998b; Delalle et al. 1999). Cortical postmitotic neurons accumulate high levels of p27Kip1 to bind and inactivate cyclin A/E-Cdk2 and cyclin D-Cdk4 complexes (Lee et al. 1996; Cunningham and Roussel 2001; Sumrejkanchanakij et al. 2003). Suppression of Cdk activity by p27Kip1 is regarded as a key determinant for neuronal differentiation and stability (Kranenburg et al. 1995; Cunningham and Roussel 2001).

Recently, hypoxia-ischemia–induced DNA synthesis preceding neuronal cell death was shown to be associated with a reduction in p27Kip1 and p16Ink4a levels and, in parallel, with an increase in Cdk2 activity (Kuan et al. 2004).

Also p21Waf1/Cip1 is induced during neuronal differentiation and occurs in fully differentiated neurons (Van Grunsven et al. 1996; Xiong et al. 1997; Van Lookeren Campagne and Gill 1998b). Whether p21Waf1/Cip1 might be necessary per se for neuronal differentiation and quiescence or not is controversial (Parker et al. 1995; Van Grunsven et al. 1996). However, there is increasing evidence that at least some Cip/Kip inhibitors may operate in postmitotic neurons to support differentiation and specification of distinct neuron types by regulating nuclear transport, cell motility, and transcriptional activation (LaBaer et al. 1997; Ohnuma et al. 1999, 2001; Dyer and Cepko 2000; Coqueret 2003).

The present results on a constitutive expression of cell cycle regulators in the healthy adult brain do not negate their presumed pathogenetic role in Alzheimer's disease. Comparing Alzheimer's disease brains with age-matched normal brain, a variety of cell cycle proteins has been found at higher expression levels, which has been conceptually linked to cell death (Arendt et al. 1996; Vincent et al. 1996; Nagy et al. 1997). Of note, cell cycle proteins might show alterations in their subcellular distribution in Alzheimer's disease where they are found predominantly associated with neurofibrillary degeneration. Differences in compartmentation and segregation through binding to other proteins might not only affect their function but also modify their degradation. Potential differential effects through postmortem autolysis, therefore, need to be evaluated.

Conclusions

Complex wiring of the mature nervous system, which in general does not allow the effective integration of new neurons, and the extreme morphological polarity of nerve cells themselves may be contributing factors regarding the withdrawal of differentiated neurons from cell cycle activity. On the other hand, neurons are very able to undergo functional and morphological adaptations in response to changes in network activity. The concomitance of both irreversible withdrawal from cell cycle and a high potential for plasticity is unique to neurons in comparison with all other cell populations. It has therefore been hypothesized that proteins normally involved in cell cycle machinery may assume functions in neuronal plasticity (Arendt 2003). Interestingly, in Alzheimer's disease, suggested to be a neuroplastic disorder, several cell cycle–related proteins have been found to be ectopically expressed in neocortical and hippocampal pyramidal neurons: populations with a high degree of neuroplastic capacity (Arendt, Holzer, and Gärtner 1998; Nagy and Esiri 1998; Herrup and Arendt 2002). These facts support the idea that the constitutive expression of cell cycle proteins occurring predominantly in cortical pyramidal neurons might be related to mechanisms of neuroplasticity and/or to processes that maintain neuronal stability.

Taken together, a complex pattern of cyclins, Cdks, and Cdkis is constitutively expressed in postmitotic neurons where it results in functionally active Cdk–cyclin complexes suggesting a noncanonical function of these cell cycle regulators.

This work was supported by the Interdisziplinäres Zentrum für Klinische Forschung Leipzig at the Faculty of Medicine of the Universität Leipzig (C1). We thank Dr Cuong Hoang-Vu and Mrs Kathrin Hammje (Experimental and Oncological Surgery Research Group, University Department of General, Visceral, and Vascular Surgery, Martin-Luther-University, Halle, Germany) for the opportunity to use the PALM® laser microdissection and pressure catapulting system and for excellent technical support. The authors also wish to thank Dr Zoe McIvor for linguistic revision of the manuscript. Conflict of Interest: None declared.

References

Arendt
T
Synaptic plasticity and cell cycle activation in neurons are alternative effector pathways: the ‘Dr. Jekyll and Mr. Hyde concept’ of Alzheimer's disease or the yin and yang of neuroplasticity
Prog Neurobiol
 , 
2003
, vol. 
71
 (pg. 
83
-
248
)
Arendt
T
Holzer
M
Gärtner
U
Neuronal expression of cycline dependent kinase inhibitors of the INK4 family in Alzheimer's disease
J Neural Transm
 , 
1998
, vol. 
105
 (pg. 
949
-
960
)
Arendt
T
Holzer
M
Gärtner
U
Brückner
MK
Aberrancies in signal transduction and cell cycle related events in Alzheimer's disease
J Neural Transm Suppl
 , 
1998
, vol. 
54
 (pg. 
147
-
158
)
Arendt
T
Rödel
L
Gärtner
U
Holzer
M
Expression of the cyclin-dependent kinase inhibitor p16 in Alzheimer's disease
Neuroreport
 , 
1996
, vol. 
7
 (pg. 
3047
-
3049
)
Becker
EB
Bonni
A
Cell cycle regulation of neuronal apoptosis in development and disease
Prog Neurobiol
 , 
2004
, vol. 
72
 (pg. 
1
-
25
)
Becker
EB
Bonni
A
Beyond proliferation—cell cycle control of neuronal survival and differentiation in the developing mammalian brain
Semin Cell Dev Biol
 , 
2005
, vol. 
16
 (pg. 
439
-
448
)
Busser
J
Geldmacher
DS
Herrup
K
Ectopic cell cycle proteins predict the sites of neuronal cell death in Alzheimer's disease brain
J Neurosci
 , 
1998
, vol. 
18
 (pg. 
2801
-
2807
)
Clurman
BE
Sheaff
RJ
Thress
K
Groudine
M
Roberts
JM
Turnover of cyclin E by the ubiquitin-proteasome pathway is regulated by cdk2 binding and cyclin phosphorylation
Genes Dev
 , 
1996
, vol. 
10
 (pg. 
1979
-
1990
)
Coqueret
O
New roles for p21 and p27 cell-cycle inhibitors: a function for each cell compartment?
Trends Cell Biol
 , 
2003
, vol. 
13
 (pg. 
65
-
70
[review]
Cunningham
JJ
Roussel
MF
Cyclin-dependent kinase inhibitors in the development of the central nervous system
Cell Growth Differ
 , 
2001
, vol. 
12
 (pg. 
387
-
396
[review]
De Falco
M
Fedele
V
De Luca
L
Penta
R
Cottone
G
Cavallotti
I
Laforgia
V
De Luca
A
Evaluation of cyclin D1 expression and its subcellular distribution in mouse tissues
J Anat
 , 
2004
, vol. 
205
 (pg. 
405
-
412
)
Delalle
I
Takahashi
T
Nowakowski
RS
Tsai
LH
Caviness
VS
Jr
Cyclin E-p27 opposition and regulation of the G1 phase of the cell cycle in the murine neocortical PVE: a quantitative analysis of mRNA in situ hybridization
Cereb Cortex
 , 
1999
, vol. 
9
 (pg. 
824
-
832
)
Diehl
JA
Cheng
M
Roussel
MF
Sherr
CJ
Glycogen synthase kinase-3beta regulates cyclin D1 proteolysis and subcellular localization
Genes Dev
 , 
1998
, vol. 
12
 (pg. 
3499
-
3511
)
Diehl
JA
Zindy
F
Sherr
CJ
Inhibition of cyclin D1 phosphorylation on threonine-286 prevents its rapid degradation via the ubiquitin-proteasome pathway
Genes Dev
 , 
1997
, vol. 
11
 (pg. 
957
-
972
)
Dobashi
Y
Kudoh
T
Toyoshima
K
Akiyama
T
Persistent activation of CDK4 during neuronal differentiation of rat pheochromaocytoma PC12 cells
Biochem Biophys Res Commun
 , 
1996
, vol. 
221
 (pg. 
351
-
355
)
Dyer
MA
Cepko
CL
p57(Kip2) regulates progenitor cell proliferation and amacrine interneuron development in the mouse retina
Development
 , 
2000
, vol. 
127
 (pg. 
3593
-
3605
)
Fischer
SJ
McDonald
ES
Gross
L
Windebank
AJ
Alterations in cell cycle regulation underlie cisplatin induced apoptosis of dorsal root ganglion neurons in vivo
Neurobiol Dis
 , 
2001
, vol. 
8
 (pg. 
1027
-
1035
)
Freeman
RS
Estus
S
Jr
Johnson EM
Analysis of cell cycle-related gene expression in postmitotic neurons: selective induction of cyclin D1 during programmed cell death
Neuron
 , 
1994
, vol. 
12
 (pg. 
343
-
355
)
Gärtner
U
Brückner
MK
Krug
S
Schmetsdorf
S
Staufenbiel
M
Arendt
T
Amyloid deposition in APP23 mice is associated with the expression of cyclins in astrocytes but not in neurons
Acta Neuropathol
 , 
2003
, vol. 
106
 (pg. 
535
-
544
)
Herrup
K
Arendt
T
Re-expression of cell cycle proteins induces neuronal cell death during Alzheimer's disease
J Alzheimers Dis
 , 
2002
, vol. 
4
 (pg. 
243
-
247
)
Hisanaga
S
Kusubata
M
Okumura
E
Kishimoto
T
Phosphorylation of neurofilament H subunit at the tail domain by CDC2 kinase dissociates the association to microtubules
J Biol Chem
 , 
1991
, vol. 
15
 (pg. 
21798
-
21803
)
Hoozemans
JJ
Brückner
MK
Rozemuller
AJ
Veerhuis
R
Eikelenboom
P
Arendt
T
Cyclin D1 and cyclin E are co-localized with cyclo-oxygenase 2 (COX-2) in pyramidal neurons in Alzheimer disease temporal cortex
J Neuropathol Exp Neurol
 , 
2002
, vol. 
61
 (pg. 
678
-
688
)
Huard
JM
Forster
CC
Carter
ML
Sicinski
P
Ross
ME
Cerebellar histogenesis is disturbed in mice lacking cyclin D2
Development
 , 
1999
, vol. 
126
 (pg. 
1927
-
1935
)
Ino
H
Chiba
T
Cyclin-dependent kinase 4 and cyclin D1 are required for excitotoxin-induced neuronal cell death in vivo
J Neurosci
 , 
2001
, vol. 
21
 (pg. 
6086
-
6094
)
Jahn
L
Sadoshima
J
Izumo
S
Cyclins and cyclin-dependent kinases are differentially regulated during terminal differentiation of C2C12 muscle cells
Exp Cell Res
 , 
1994
, vol. 
212
 (pg. 
297
-
307
)
Jordan-Sciutto
KL
Morgan
K
Bowser
R
Increased cyclin G1 immunoreactivity during Alzheimer's disease
J Alzheimers Dis
 , 
1999
, vol. 
1
 (pg. 
409
-
417
)
Kaffman
A
Herskowitz
I
Tjian
R
O'Shea
EK
Phosphorylation of the transcription factor PHO4 by a cyclin-CDK complex, PHO80-PHO85
Science
 , 
1994
, vol. 
263
 (pg. 
1153
-
1156
)
Katchanov
J
Harms
C
Gertz
H
Hauck
L
Waeber
C
Hirt
L
Priller
J
von Harsdorf
R
Bruck
W
Hortnagel
H
, et al.  . 
Mild cerebral ischemia induces loss of cyclin-dependent kinase inhibitors and activation of cell cycle machinery before delayed neuronal cell death
J Neurosci
 , 
2001
, vol. 
21
 (pg. 
5045
-
5053
)
Klotzbucher
A
Stewart
E
Harrison
D
Hunt
T
The ‘destruction box’ of cyclin A allows B-type cyclins to be ubiquitinated, but not efficiently destroyed
EMBO J
 , 
1996
, vol. 
15
 (pg. 
3053
-
3064
)
Kranenburg
O
Scharnhorst
V
van der Eb
AJ
Zantema
A
Inhibiton of cyclin-dependent kinase activity triggers neuronal differentiation of mouse neuroblastoma cells
J Cell Biol
 , 
1995
, vol. 
131
 (pg. 
227
-
234
)
Kuan
CY
Schloemer
AJ
Lu
A
Burns
KA
Weng
WL
Williams
MT
Strauss
KI
Vorhees
CV
Flavell
RA
Davis
RJ
, et al.  . 
Hypoxia-ischemia induces DNA synthesis without cell proliferation in dying neurons in adult rodent brain
J Neurosci
 , 
2004
, vol. 
24
 (pg. 
10763
-
10772
)
LaBaer
J
Garrett
MD
Stevenson
LF
Slingerland
JM
Sandhu
C
Chou
HS
Fattaey
A
Harlow
E
New functional activities for the p21 family of CDK inhibitors
Genes Dev
 , 
1997
, vol. 
11
 (pg. 
847
-
862
)
Lee
MH
Nikolic
M
Baptista
CA
Lai
E
Tsai
LH
Massague
J
The brain-specific activator p35 allows Cdk5 to escape inhibition by p27Kip1 in neurons
Proc Natl Acad Sci USA
 , 
1996
, vol. 
93
 (pg. 
3259
-
3263
)
Li
J
Meyer
AN
Donoghue
DJ
Nuclear localization of cyclin B1 mediates its biological activity and is regulated by phosphorylation
Proc Natl Acad Sci USA
 , 
1997
, vol. 
94
 (pg. 
502
-
507
)
Li
Y
Chopp
M
Powers
C
Granule cell apoptosis and protein expression in hippocampal dentate gyrus after forebrain ischemia in the rat
J Neurol Sci
 , 
1997
, vol. 
150
 (pg. 
93
-
102
)
Liu
DX
Greene
LA
Neuronal apoptosis at the G1/S cell cycle checkpoint
Cell Tissue Res
 , 
2001
, vol. 
305
 (pg. 
217
-
228
)
Löwenheim
H
Furness
DN
Kil
J
Zinn
C
Gultig
K
Fero
ML
Frost
D
Gummer
AW
Roberts
JM
Rubel
EW
, et al.  . 
Gene disruption of p27(Kip1) allows cell proliferation in the postnatal and adult organ of corti
Proc Natl Acad Sci USA
 , 
1999
, vol. 
96
 (pg. 
4084
-
4088
)
Lu
G
Seta
KA
Millhorn
DE
Novel role for cyclin-dependent kinase 2 in neuregulin-induced acetylcholine receptor epsilon subunit expression in differentiated myotubes
J Biol Chem
 , 
2005
, vol. 
280
 (pg. 
21731
-
21738
)
Matsunaga
Y
Expression of cyclin E in postmitotic cells in the central nervous system
Kokubyo Gakkai Zasshi
 , 
2000
, vol. 
67
 (pg. 
169
-
181
)
Mawal-Dewan
M
Sen
PC
Abdel-Ghany
M
Shalloway
D
Racker
E
Phosphorylation of tau protein by purified p34cdc28 and a related protein kinase from neurofilaments
J Biol Chem
 , 
1992
, vol. 
267
 (pg. 
19705
-
19709
)
McShea
A
Harris
PL
Webster
KR
Wahl
AF
Smith
MA
Abnormal expression of the cell cycle regulators P16 and CDK4 in Alzheimer's disease
Am J Pathol
 , 
1997
, vol. 
150
 (pg. 
1933
-
1939
)
Miyajima
M
Nornes
HO
Neuman
T
Cyclin E is expressed in neurons and forms complexes with cdk5
Neuroreport
 , 
1995
, vol. 
6
 (pg. 
1130
-
1132
)
Miyazawa
K
Himi
T
Garcia
V
Yamagishi
H
Sato
S
Ishizaki
Y
A role for p27/Kip1 in the control of cerebellar granule cell precursor proliferation
J Neurosci
 , 
2000
, vol. 
20
 (pg. 
5756
-
5763
)
Nagy
Z
Esiri
MM
Neuronal cyclin expression in the hippocampus in temporal lobe epilepsy
Exp Neurol
 , 
1998
, vol. 
150
 (pg. 
240
-
247
)
Nagy
Z
Esiri
MM
Cato
AM
Smith
AD
Cell cycle markers in the hippocampus in Alzheimer's disease
Acta Neuropathol
 , 
1997
, vol. 
94
 (pg. 
6
-
15
)
Ohnuma
S
Philpott
A
Harris
WA
Cell cycle and cell fate in the nervous system
Curr Opin Neurobiol
 , 
2001
, vol. 
11
 (pg. 
66
-
73
[review]
Ohnuma
S
Philpott
A
Wang
K
Holt
CE
Harris
WA
p27Xic1, a Cdk inhibitor, promotes the determination of glial cells in Xenopus retina
Cell
 , 
1999
, vol. 
99
 (pg. 
499
-
510
)
Oka
T
Kubo
T
Enokido
Y
Hatanaka
H
Expression of cyclin A decreases during neuronal apoptosis in cultured rat cerebellar granule neurons
Brain Res Dev Brain Res
 , 
1996
, vol. 
97
 (pg. 
96
-
106
)
Okano
HJ
Pfaff
DW
Gibbs
RB
RB and Cdc2 expression in brain: correlations with 3H-thymidine incorporation and neurogenesis
J Neurosci
 , 
1993
, vol. 
13
 (pg. 
2930
-
2938
)
Parker
SB
Eichele
G
Zhang
P
Rawls
A
Sands
AT
Bradley
A
Olson
EN
Harper
JW
Elledge
SJ
p53-independent expression of p21Cip1 in muscle and other terminally differentiating cells
Science
 , 
1995
, vol. 
267
 (pg. 
1024
-
1027
)
Richter
JD
Think globally, translate locally: what mitotic spindles and neuronal synapses have in common
Proc Natl Acad Sci USA
 , 
2001
, vol. 
98
 (pg. 
7069
-
7071
)
Rickert
P
Seghezzi
W
Shanahan
F
Cho
H
Lees
E
Cyclin C/CDK8 is a novel CTD kinase associated with RNA polymerase II
Oncogene
 , 
1996
, vol. 
12
 (pg. 
2631
-
2640
)
Ross
ME
Carter
ML
Lee
JH
MN20, a D2 cyclin, is transiently expressed in selected neural populations during embryogenesis
J Neurosci
 , 
1996
, vol. 
16
 (pg. 
210
-
219
)
Ross
ME
Risken
M
MN20, a D2 cyclin found in brain, is implicated in neural differentiation
J Neurosci
 , 
1994
, vol. 
14
 (pg. 
6384
-
6391
)
Roy
R
Adamczewski
JP
Seroz
T
Vermeulen
W
Tassan
JP
Schaeffer
L
Nigg
EA
Hoeijmakers
JH
Egly
JM
The MO15 cell cycle kinase is associated with the TFIIH transcription-DNA repair factor
Cell
 , 
1994
, vol. 
79
 (pg. 
1093
-
1101
)
Schmetsdorf
S
Gärtner
U
Arendt
T
Expression of cell cycle-related proteins in developing and adult mouse hippocampus
Int J Dev Neurosci
 , 
2005
, vol. 
23
 (pg. 
101
-
112
)
Scott
CW
Vulliet
PR
Caputo
CB
Phosphorylation of tau by proline-directed protein kinase (p34cdc2/p58cyclinA) decreases tau-induced microtubule assembly and antibody SMI33 reactivity
Brain Res
 , 
1993
, vol. 
21
 (pg. 
237
-
242
)
Shirvan
A
Ziv
I
Barzilai
A
Djaldeti
R
Zilkh-Falb
R
Michlin
T
Melamed
E
Induction of mitosis-related genes during dopamine-triggered apoptosis in sympathetic neurons
J Neural Transm Suppl
 , 
1997
, vol. 
50
 (pg. 
67
-
78
)
Shirvan
A
Ziv
I
Machlin
T
Zilkha-Falb
R
Melamed
E
Barzilai
A
Two waves of cyclin B and proliferating cell nuclear antigen expression during dopamine-triggered neuronal apoptosis
J Neurochem
 , 
1997
, vol. 
69
 (pg. 
539
-
549
)
Small
DL
Monette
R
Comas
T
Fournier
MC
Morley
P
Loss of cyclin D1 in necrotic and apoptotic models of cortical neuronal degeneration
Brain Res
 , 
1999
, vol. 
842
 (pg. 
376
-
383
)
Small
DL
Monette
R
Fournier
MC
Zurakowski
B
Fiander
H
Morley
P
Characterization of cyclin D1 expression in a rat global model of cerebral ischemia
Brain Res
 , 
2001
, vol. 
900
 (pg. 
26
-
37
)
Sudakin
V
Ganoth
D
Dahan
A
Heller
H
Hershko
J
Luca
FC
Ruderman
JV
Hershko
A
The cyclosome, a large complex containing cyclin-selective ubiquitin ligase activity, targets cyclins for destruction at the end of mitosis
Mol Biol Cell
 , 
1995
, vol. 
6
 (pg. 
185
-
197
)
Sumrejkanchanakij
P
Tamamori-Adachi
M
Matsunaga
Y
Eto
K
Ikeda
MA
Role of cyclin D1 cytoplasmic sequestration in the survival of postmitotic neurons
Oncogene
 , 
2003
, vol. 
22
 (pg. 
8723
-
8730
)
Tamaru
T
Trigun
SK
Okada
M
Nakagawa
H
Identification of cells expressing a D type G1 cyclin in matured brain: implication for its role in neuronal function
Neurosci Lett
 , 
1993
, vol. 
153
 (pg. 
169
-
172
)
Timsit
S
Rivera
S
Ouaghi
P
Guischard
F
Tremblay
E
Ben Ari
Y
Khrestchatisk
M
Increased cyclin D1 in vulnerable neurons in the hippocampus after ischemia and epilepsy: a modulator of in vivo programmed cell death?
Eur J Neurosci
 , 
1999
, vol. 
11
 (pg. 
263
-
278
)
Udvardy
A
The role of controlled proteolysis in cell-cycle regulation
Eur J Biochem
 , 
1996
, vol. 
240
 (pg. 
307
-
313
)
Van Grunsven
LA
Billon
N
Savatier
P
Thomas
A
Urdiales
JL
Rudkin
BB
Effect of nerve growth factor on the expression of cell cycle regulatory proteins in PC12 cells: dissection of the neurotrophic response from the anti-mitogenic response
Oncogene
 , 
1996
, vol. 
12
 (pg. 
1347
-
1356
)
Van Lookeren Campagne
M
Gill
R
Cell cycle-related gene expression in the adult rat brain: selective induction of cyclin G1 and p21 Waf1/Cip1 in neurons following focal cerebral ischemia
Neuroscience
 , 
1998
, vol. 
84
 (pg. 
1097
-
1112
)
Van Lookeren Campagne
M
Gill
R
Tumor-suppressor p53 is expressed in proliferating and newly formed neurons of the embryonic and postnatal rat brain: comparison with expression of the cell cycle regulators p21Waf1/Cip1, p27Kip1, p57Kip2, p16Ink4a, cyclin G1, and the proto-oncogene Bax
J Comp Neurol
 , 
1998
, vol. 
397
 (pg. 
181
-
198
)
Vincent
I
Rosado
M
Davies
P
Mitotic mechanisms in Alzheimer's disease?
J Cell Biol
 , 
1996
, vol. 
132
 (pg. 
413
-
425
)
Watanabe
Y
Watanabe
T
Kitagawa
M
Taya
Y
Nakayama
K
Motoyama
N
pRb phosphorylation is regulated differentially by cyclin-dependent kinase (Cdk) 2 and Cdk4 in retinoic acid-induced neuronal differentiation of P19 cells
Brain Res
 , 
1999
, vol. 
842
 (pg. 
342
-
350
)
Wood
JG
Zinsmeister
P
Demonstration of cdc2 kinase in mature neuronal nuclei
Neuroreport
 , 
1993
, vol. 
4
 (pg. 
599
-
601
)
Xiong
W
Pestell
R
Rosner
MR
Role of cyclins in neuronal differentiation of immortalized hippocampal cells
Mol Cell Biol
 , 
1997
, vol. 
17
 (pg. 
6585
-
6597
)
Yan
GZ
Ziff
EB
NGF regulates the PC12 cell cycle machinery through specific inhibition of the Cdk kinases and induction of cyclin D1
J Neurosci
 , 
1995
, vol. 
15
 (pg. 
6200
-
6212
)
Zindy
F
Cunningham
JJ
Sherr
CJ
Jogal
S
Smeyne
RJ
Roussel
MF
Postnatal neuronal proliferation in mice lacking Ink4d and Kip1 inhibitors of cyclin-dependent kinases
Proc Natl Acad Sci USA
 , 
1999
, vol. 
96
 (pg. 
13462
-
13467
)
Zindy
F
Soares
H
Herzog
KH
Morgan
J
Sherr
CJ
Roussel
MF
Expression of INK4 inhibitors of cyclin D-dependent kinases during mouse brain development
Cell Growth Differ
 , 
1997
, vol. 
8
 (pg. 
1139
-
1150
)

Author notes

Stefanie Schmetsdorf and Ulrich Gärtner contributed equally to this work