Abstract

We investigated the postnatal effects of embryonic knockdown and overexpression of the candidate dyslexia gene homolog Kiaa0319. We used in utero electroporation to transfect cells in E15/16 rat neocortical ventricular zone with either 1) small hairpin RNA (shRNA) vectors targeting Kiaa0319, 2) a KIAA0319 expression construct, 3) Kiaa0319 shRNA along with KIAA0319 expression construct (“rescue”), or 4) a scrambled version of Kiaa0319 shRNA. Knockdown, but not overexpression, of Kiaa0319 resulted in periventricular heterotopias that contained large numbers of both transfected and non–transfected neurons. This suggested that Kiaa0319 shRNA disrupts neuronal migration by cell autonomous as well as non–cell autonomous mechanisms. Of the Kiaa0319 shRNA–transfected neurons that migrated into the cortical plate, most migrated to their appropriate lamina. In contrast, neurons transfected with the KIAA0319 expression vector attained laminar positions subjacent to their expected positions. Neurons transfected with Kiaa0319 shRNA exhibited apical, but not basal, dendrite hypertrophy, which was rescued by overexpression of KIAA0319. The results provide additional supportive evidence linking candidate dyslexia susceptibility genes to migrational disturbances during brain development, and extends the role of Kiaa0319 to include growth and differentiation of dendrites.

Introduction

Developmental dyslexia is a language–based learning disability that affects between 4% and 10% of the population, and has a strong genetic component (Fisher and Francks 2006). Post mortem examination of the brains of developmental dyslexics demonstrated the presence of neuronal migration anomalies, including molecular layer ectopias, laminar dysplasia, and occasional focal microgyria (Galaburda and Kemper 1979; Galaburda et al. 1985; Humphreys et al. 1990). More recently, an association between periventricular nodular heterotopias and developmental dyslexia has been reported (Chang et al. 2005; Sokol et al. 2006).

Recent reports proposing candidate dyslexia susceptibility genes have opened up new lines of investigation into the genetic modulation of this disorder. A number of these genes, in specific—DCDC2 and KIAA0319 on Chr 6 (Francks et al. 2004; Cope et al. 2005; Meng et al. 2005; Harold et al. 2006; Paracchini et al. 2006; Schumacher et al. 2006; Luciano et al. 2007; Paracchini et al. 2008), and DYX1C1 on Chr 15 (Taipale et al. 2003; Brkanac et al. 2007; Marino et al. 2007)—have been shown to have roles in neuronal migration. Thus, we have previously demonstrated that in utero electroporation of shRNA targeted against rat homologs of DCDC2, KIAA0319, or DYX1C1 in the rat disrupts the process of neuronal migration to the cerebral cortex as assessed during the prenatal period (Meng et al. 2005; Paracchini et al. 2006; Wang et al. 2006). Further evaluation of the postnatal consequences of embryonic knockdown of Dyx1c1 and Dcdc2 function in rats revealed the presence of a variety of neocortical malformations, including molecular layer ectopias and periventricular heterotopias (PVHs) (Rosen et al. 2007; Burbridge et al. 2008). In addition to these frank neuronal migration anomalies, we found evidence of more subtle disruptions, with some transfected neurons migrating to the cortical plate (CP), albeit past their expected laminar locations (Rosen et al. 2007; Burbridge et al. 2008).

As mentioned above, embryonic knockdown of Kiaa0319 disrupted neuronal migration when assessed 4–7 days after transfection (Paracchini et al. 2006). Unknown were the long-term effects, both in terms of neuronal migration and subsequent neuronal morphology, of embryonic knockdown or overexpression of this candidate dyslexia susceptibility gene. In the current report, therefore, we examined the brains of postnatal rats that were embryonically transfected by in utero electroporation with plasmids containing 1) shRNA targeted against Kiaa0319 (knockdown), 2) a construct expressing KIAA0319 protein (overexpression), or 3) a combination of the shRNA and expression constructs (rescue). We qualitatively assessed these brains for the presence or absence of neuronal migration anomalies and the laminar disposition of transfected and non–transfected neurons. In addition, we quantified migration distances and neuronal morphology of the transfected cells.

Experimental Procedures

In Situ Hybridization

In order to better interpret the knockdown and overexpression findings, we first determined the expression of Kiaa0319 in the prenatal brain by in situ hybridization. We obtained time-mated pregnant females (Charles River Laboratory, Wilmington, MA) and sacrificed the litters on E14/15, E16/17, or E19/20. Three embryos from each litter were immediately frozen and they were cut in either the horizontal, sagittal, or coronal plane on a cryostat at 18 μm, and the slides were processed for in situ hybridization of Kiaa0319 as described below.

The cDNAs prepared from frontal, parietal, and occipital lobes of human embryonic brain (20 weeks, Biochain Institute, Hayward, CA) were used as template to amplify the full-length coding sequence of Kiaa0319 using forward (5′ATGGCGCCCCCCACAGGTGTG3′) and reverse (5′ TTATCTGTCCTTTGAGCAATAACTG 3′) primers. All fragments were then cloned into pGEMT-Easy vector (Promega, Madison, WI). Rat embryonic (E14) brain cDNA was synthesized from total RNA using SuperScript III Reverse Transcriptase enzyme (Invitrogen, CA). Full-length coding sequence of Kiaa0319 was amplified from E14 cDNA using forward primer (5′ ATGGTGTCCCCACCAGGAGTAC 3′) and reverse primer (5′ TTATCTGTCCTTTGAGTAATAACCA 3′). The amplified product was cloned into pGEMT-Easy vector. All the plasmids generated by PCR were sequenced at WM Keck sequencing facility. Nonradioactive in situ hybridizations were done by UB-In Situ (Natick, MA), as previously described (Berger and Hediger 2001) using a digoxigenin-labeled cRNA probe. The antisense and sense probes were generated by using T7 and SP6 promoters flanking pGEMT-Easy-Kiaa0319 of human and rat plasmids.

In Utero Electroporation

In utero electroporations of litters designated for postnatal analysis were performed at the Beth Israel Deaconess Medical Center. One litter that was analyzed in the prenatal period was transfected at the University of Connecticut. The Institutional Animal Care and Use Committees of these institutions approved all procedures.

A total of 11 pregnant Wistar rats were obtained (Charles River Laboratory) and each litter was assigned to 1 of 3 groups: Kiaa0319 shRNA, KIAA0319 Overexpression, and Rescue. Within each litter, pups were randomly assigned to receive 1 of 2 treatments (see Table 1). This balanced design was essential for the analysis of migrational distance as it controlled for between–litter variation in gestational age. In utero electroporation of plasmid DNA was performed at E15/16 as described previously (Bai et al. 2003; Rosen et al. 2007; Burbridge et al. 2008). The concentration of enhanced green fluorescent protein (eGFP) and monomeric red fluorescent protein (mRFP) plasmids was 0.75 μg/μL, the shRNA was 1.5 μg/μL, and expression plasmids were 1.5 μg/μL.

Table 1

Summary of treatments (N)

Group Treatment 1 Treatment 2 
Kiaa0319 shRNA pU6shRNA-Kiaa0319 + pCAGGS-eGFP (12) pU6shRNA-Kiaa0319 scram + pCAGGS-mRFP + pCAGGS-eGFP (11) 
KIAA0319, overexpression pU6shRNA-Kiaa0319 + pCAGGS-eGFP (8) pCAG-KIAA0319-IRES-eGFP + pCAGGS-mRFP (7) 
Rescue pU6shRNA-Kiaa0319 + pCAGGS-eGFP (9) pU6shRNA-Kiaa0319 + pCAG-KIAA0319-IRES-eGFP + pCAGGS-mRFP (10) 
Group Treatment 1 Treatment 2 
Kiaa0319 shRNA pU6shRNA-Kiaa0319 + pCAGGS-eGFP (12) pU6shRNA-Kiaa0319 scram + pCAGGS-mRFP + pCAGGS-eGFP (11) 
KIAA0319, overexpression pU6shRNA-Kiaa0319 + pCAGGS-eGFP (8) pCAG-KIAA0319-IRES-eGFP + pCAGGS-mRFP (7) 
Rescue pU6shRNA-Kiaa0319 + pCAGGS-eGFP (9) pU6shRNA-Kiaa0319 + pCAG-KIAA0319-IRES-eGFP + pCAGGS-mRFP (10) 

Plasmids

For the Kiaa0319 shRNA condition, plasmids encoding shRNA (pU6shRNA-Kiaa0319) and plasmids encoding eGFP (pCAGGS-eGFP) were cotransfected into the ventricular zone (VZ). We have previously demonstrated that cotransfection is highly efficient, as virtually all neurons cotransfected with eGFP and mRFP were colabeled when sacrificed 4 days post-transfection (Rosen et al. 2007). Littermates were cotransfected with plasmids encoding a scrambled version of the shRNA (pU6shRNA-Kiaa0319 scram) along with plasmids encoding mRFP (pCAGGS-mRFP) and plasmid encoding eGFP. Pups in the KIAA0319 overexpression group were cotransfected with an IRES construct coding both for the human KIAA0319 protein and eGFP (pCAG-KIAA0319-IRES-eGFP) and pCAGGS-mRFP, whereas their littermates were transfected with pU6shRNA-Kiaa0319 + pCAGGS-eGFP. In the Rescue condition, subjects were cotransfected with pU6shRNA-Kiaa0319, pCAGGS-KIAA0319-eGFP, and pCAGGS-mRFP. Littermates were transfected with pU6shRNA-Kiaa0319 + pCAGGS-eGFP. The effectiveness of these plasmids in knocking down exogenous Kiaa0319 function was validated by Western blot (Supplemental Fig. 1).

BrdU Injection

Pregnant dams at E18/19 were anesthetized with isoflurane (5%) and intraperitoneally injected with 50 mg/kg of 5-bromo-2′-deoxyuridine (Sigma Aldrich, St. Louis, MO, 10 mg/mL solution).

Histology

One litter transfected with Kiaa0319 shRNA was sacrificed 4 hours after BrdU, whereas the remaining litters were sacrificed at P21. Animals were deeply anesthetized (Ketamine/Xylazine 10:1, 100 mg/mL) and sacrificed by transcardial perfusion with 0.9% saline followed by 4% paraformaldehyde. The brains were removed from the skull and postfixed for 24 h before being cryoprotected in 10% and then 30% sucrose phosphate buffer. The brains were sectioned coronally at 40 μm on a freezing microtome. Sections were then mounted and coverslipped with VECTASHIELD Mounting Medium (Vector Labs, Burlingame, CA) and visualized under fluorescence for the presence of eGFP and/or mRFP. One series of every tenth section was stained for Nissl substance using Thionin. One adjacent series of free-floating sections was processed for immunohistochemical detection of eGFP (Chemicon, 1:200) using ABC protocols.

Immunohistochemistry

Adjacent series of sections were processed for immunofluorescence detection of laminar markers. These included Cux1 (CDP (M-222), Santa Cruz Biotechnology, Santa Cruz, CA, 1:1000) and FoxP2 (FoxP2 (N–16), Santa Cruz Biotechnology, 1:50). Cux1 is a transcription factor that predominantly labels layer 2–4 neurons, especially in the in parietal cortex (Nieto et al. 2004), whereas FoxP2 labels neurons in layer 6 throughout the cortex (e.g., Keays et al. 2007). An antibody for the connective tissue growth factor Ctgf (Heuer et al. 2003), (L-20 Santa Cruz Biotechnology, 1:50) was used to label neurons in layer 6b (Molyneaux et al. 2007), and cells that contained BrdU were labeled with Anti-BrdU (BD Bioscences, San Jose, CA, 1:100). Primary antibodies were detected with one of the following secondary antibodies: Alexa Fluor 555, Alexa Fluor 594 (Invitrogen, Carlsbad, CA, 1:200), or Cy5 (Jackson ImmunoResearch, West Grove, PA, 1:50).

Additional sections were stained for gamma-aminobutyric acid-ergic (GABAergic) antibodies Calretinin (MAB1468, Milipore Corp., Billerica, MA, 1:1000) and Parvalbumin (MAB353, Millipore, 1:200). The presence of progenitor cells was assessed by staining for Nestin (MAB1572, Millipore, 1:1000).

Analysis

In Situ Quantification

Individual sense and antisense sections from horizontally prepared brains (1 each from E14/15, E16/17, and E19/20 rats) were imaged with monochrome digital camera (Insight, Diagnostic Instruments, Sterling Heights, MI) on a light box (Aristo Grid Lamp Products, Waterbury, CT) and interfaced via firewire to Macintosh G4 computer (Apple Computer, Cupertino, CA). Each antisense section image and its corresponding sense section were captured using SPOT software (Diagnostic Instruments) with common exposure settings. Using ImageJ <http://rsb.info.nih.gov/ij/>;, optical density values were measured for the combined CP and VZ. A total of 9–13 sections were measured for each brain. The average difference in optical density between sense and antisense images were computed and expressed as a percent of sense density.

Postnatal Assessment of Pathology

All analyses of postnatal brains were performed blind with respect to condition. Nissl-stained sections were surveyed for the presence of neocortical and/or hippocampal malformations, and their location noted.

Migration Analysis

Quantitative analysis of migrational distance was conducted using a custom Matlab (Mathworks, Natick, MA) program. The location of eGFP+ cells was charted in 4 randomly chosen immunohistochemically stained series using Neurolucida (MBF Biosciences, Williston, VT). The program then determined the location of each cell in a user–defined region of interest as the percentage of cortical depth, with 0% being the white matter/subplate border and 100% being the pial surface. Frequency distributions were determined for each animal, and the mean value across all animals within each condition was determined (Supplemental Fig. 2). Differences in the distribution of migrated neurons were assessed using ANOVA. Initial analysis determined that there were no differences among the Kiaa0319 shRNA-transfected groups (F2,24 = 1.4, NS), and so their data were pooled for all analyses.

Neuronal Morphology

Five neurons from each brain were randomly selected from all laminar locations for morphological analysis. The cell body and the extent of each apical and basal dendrite were traced with Neurolucida (MBF Biosciences). Using Neurolucida Explorer (MBF Biosciences), Sholl analysis and branch analysis (dendritic length and numbers of nodes, ends, and dendrites) were then performed, and a single measure derived for each animal (mean value from 5 neurons for each of the dependent measures). Statistical differences were determined by single factor and repeated measures ANOVA. Initial analysis determined that there were no differences among the Kiaa0319 shRNA–transfected groups (F2,27 < 1, NS) and so their data were pooled for all analyses.

Image Processing

Fluorescent images were obtained on a confocal microscope (Zeiss LSM 510 Meta, Carl Zeiss, Inc., Thornwood, NY). Photomicrographs were adjusted for exposure and sharpened (unsharp mask filter) using Adobe Photoshop (Adobe Inc., San Jose, CA). Some brightfield images were acquired using the Virtual Slice Module of Neurolucida. Image montages were created in Canvas X (ACD Systems, Miami, FL).

Results

Kiaa0319 is Highly Expressed in a Regionally Distinct Manner

In situ hybridization revealed that Kiaa0319 was expressed in a regionally distinct manner (Fig. 1). At all ages examined, there was increased expression in the VZ, intermediate zone (IZ), CP, striatum, hippocampus, and brain stem. Expression in the CP increased over time, and there was evidence of Kiaa0319 expression in migrating neurons (Fig. 1). Quantitatively, differences in optical density between the antisense and sense probes ranged from 0.5-fold (brain stem) to 1.2-fold (striatum). In addition, there was increased expression in the mitral cell layer of the olfactory bulb at E18/19. In situ hybridizations performed on E14.5 mouse embryos by GenePaint (www.genepaint.org, GeneID = D130043K22Rik) and in adult mice by the Allen Brain Atlas (www.brain-map.org, GeneID = D130043K22Rik) confirmed this, although expression in the adult striatum was diminished compared that of the embryo.

Figure 1.

In situ hybridization of Kiaa0319 in embryonic rat brains. Photomontages of in situ hybridization of Kiaa0319 antisense probes in E14/15 (A,D), E16/17 (B,E), and E19/20 (C,F) rat embryos. (G) High power photomicrographs of developing cerebral cortex indicating CP, subventricular zone (SVZ) and VZ/IZ. Kiaa0319 is expressed highly in the CP, striatum, and hippocampus at all ages. There is increased expression in the mitral cell layer of the olfactory bulb at E19/20, and generalized moderate expression in the brain stem at all ages. Bar in panels A–F = 1 mm. Bar in panel G = 100 μm.

Figure 1.

In situ hybridization of Kiaa0319 in embryonic rat brains. Photomontages of in situ hybridization of Kiaa0319 antisense probes in E14/15 (A,D), E16/17 (B,E), and E19/20 (C,F) rat embryos. (G) High power photomicrographs of developing cerebral cortex indicating CP, subventricular zone (SVZ) and VZ/IZ. Kiaa0319 is expressed highly in the CP, striatum, and hippocampus at all ages. There is increased expression in the mitral cell layer of the olfactory bulb at E19/20, and generalized moderate expression in the brain stem at all ages. Bar in panels A–F = 1 mm. Bar in panel G = 100 μm.

There are PVHs in Kiaa0319 shRNA–Transfected Subjects

Nissl- and eGFP-stained sections from each of the 57 animals were examined for the presence of neuronal migration anomalies, including molecular layer ectopias, hippocampal dysplasias, and PVHs. There were molecular layer ectopias associated with the embryonic injection site in half of the animals in all conditions, but there was no evidence of separate molecular layer malformations that suggested a migrational disorder. There were hippocampal dysplasias in 3 of the 29 animals transfected with Kiaa0319 shRNA (Treatment 1 in Table 1), which were identical to those previously reported (Rosen et al. 2007; Burbridge et al. 2008).

All of the Kiaa0319 shRNA–transfected animals had evidence of disruption of neuronal migration to the neocortex (Fig. 2A). Transfected neurons were seen throughout the neocortex, with the highest concentrations at the border with the white matter and in layer 2/3. In approximately 75% of the cases, there were PVHs (Fig. 2E–H) that were visible for much of the rostral–caudal extent of the brain. In contrast, there were few unmigrated neurons in the Kiaa0319 scram and KIAA0319 overexpression conditions (Fig. 2B, C). One animal in the scram condition did have a small collection of neurons at the white matter border that resembled a PVH, but the frequency and severity of these malformations were significantly greater in the Kiaa0319 shRNA condition (χ2 = 91.2, df =1, P < 0.001). There were no malformations in the brains of any animals in the KIAA0319 overexpression condition.

Figure 2.

Neuronal migration following embryonic knockdown or overexpression of Kiaa0319. (AD) Position of transfected neurons in 2 representative sections from brains embryonically transfected with plasmids containing Kiaa0319 shRNA (A), scrambled Kiaa0319 shRNA (B), KIAA0319 protein (C), or Kiaa0319 shRNA along with KIAA0319 protein (D). (E) Photomicrograph of cerebral cortex of Nissl-stained section illustrating region of PVH (arrows). This animal was embryonically transfected with Kiaa0319 shRNA + eGFP. Bar = 250 μm. (F) Photomicrograph of section adjacent to Panel E immunohistochemically stained for eGFP. Transfected neurons are located within the PVH. Bar = 250 μm. (G and H) High-power photomicrograph of PVH (arrows) illustrated in panels (E) and (F). Bar = 125 μm.

Figure 2.

Neuronal migration following embryonic knockdown or overexpression of Kiaa0319. (AD) Position of transfected neurons in 2 representative sections from brains embryonically transfected with plasmids containing Kiaa0319 shRNA (A), scrambled Kiaa0319 shRNA (B), KIAA0319 protein (C), or Kiaa0319 shRNA along with KIAA0319 protein (D). (E) Photomicrograph of cerebral cortex of Nissl-stained section illustrating region of PVH (arrows). This animal was embryonically transfected with Kiaa0319 shRNA + eGFP. Bar = 250 μm. (F) Photomicrograph of section adjacent to Panel E immunohistochemically stained for eGFP. Transfected neurons are located within the PVH. Bar = 250 μm. (G and H) High-power photomicrograph of PVH (arrows) illustrated in panels (E) and (F). Bar = 125 μm.

In order to determine the specificity of the shRNA for Kiaa0319 we cotransfected animals with a plasmid encoding human KIAA0319 along with the Kiaa0319 shRNA plasmid. Human KIAA0319 nucleotide sequence does not match rat Kiaa0319 sequence in the region targeted by the Kiaa0319 shRNA, and therefore it is not susceptible to RNAi. Of the rats simultaneously transfected with Kiaa0319 shRNA and the human KIAA0319 expression construct, 4 out of 10 had small, focal regions of PVHs, which were not as extensive as those seen in the Kiaa0319 shRNA treatment condition (Fig. 2D). The remainder had no obvious malformations (Fig. 2C, D). There was a significant difference in the number of PVHs (χ2 = 4.3, df = 1, P < 0.05), which suggests that overexpressing the human KIAA0319 protein in Kiaa0319 shRNA-treated rats at least partially rescued this phenotype, and indicates that the effects of the RNAi are not due to off-target effects.

We assessed the PVH for the presence of Nestin-positive progenitor cells. There was no evidence of progenitor cells within the PVH, but there was a marked increase of Nestin-positive fibers (Fig. 3). Thus, although there were sparse Nestin-positive fibers contained within homologous regions of the nontransfected hemisphere (Fig. 3E), there were dense collections of these fibers within the PVH (Fig. 3D) that resembled radial glial fibers. Some of fibers could be seen to invade the upper layers of the cerebral cortex. These results suggest that there is an undue preservation of radial glial-like morphology within the PVH.

Figure 3.

Nestin-positive fibers located in PVH in the brain of a rat embryonically transfected with Kiaa0319 shRNA. (A) Brightfield photomontage of Nissl-stained section showing PVH (small arrows). This section also has an ectopic collection of neurons in the molecular layer, which is an artifact of the injection (large arrow). Bar = 500 μm. (B) Brightfield photomontage of section adjacent to (A) immunohistochemically stained for GFP illustrating PVH (arrows). Bar = 250 μm. (C) Brightfield photomontage of section adjacent to (B) (arrows for orientation with B) immunohistochemically stained for Nestin. Nestin stains fibers in the PVH as well as blood vessels throughout the brain. Box indicates region illustrated in (D). Bar = 250 μm. (D) High-power brightfield photomicrograph of region denoted in (C) illustrating dense plexus of Nestin-positive fibers (arrows). Bar = 25 μm. (E) High-power brightfield photomicrograph of region homologous to that in (D). Compared with (D), there are far fewer Nestin-positive fibers (arrows). (F) (Mall arrows), blood vessels (large arrows), and eGFP-positive neurons (arrowheads) present. There are no cells that are colabeled. Bar = 100 μm.

Figure 3.

Nestin-positive fibers located in PVH in the brain of a rat embryonically transfected with Kiaa0319 shRNA. (A) Brightfield photomontage of Nissl-stained section showing PVH (small arrows). This section also has an ectopic collection of neurons in the molecular layer, which is an artifact of the injection (large arrow). Bar = 500 μm. (B) Brightfield photomontage of section adjacent to (A) immunohistochemically stained for GFP illustrating PVH (arrows). Bar = 250 μm. (C) Brightfield photomontage of section adjacent to (B) (arrows for orientation with B) immunohistochemically stained for Nestin. Nestin stains fibers in the PVH as well as blood vessels throughout the brain. Box indicates region illustrated in (D). Bar = 250 μm. (D) High-power brightfield photomicrograph of region denoted in (C) illustrating dense plexus of Nestin-positive fibers (arrows). Bar = 25 μm. (E) High-power brightfield photomicrograph of region homologous to that in (D). Compared with (D), there are far fewer Nestin-positive fibers (arrows). (F) (Mall arrows), blood vessels (large arrows), and eGFP-positive neurons (arrowheads) present. There are no cells that are colabeled. Bar = 100 μm.

There are Non–Cell Autonomous Effects of Embryonic Kiaa0319 Knockdown

In order to assess whether embryonic transfection with Kiaa0319 shRNA affects the normal laminar position of neurons, we stained Kiaa0319 shRNA-transfected brains with laminar markers. Staining with Cux1, a marker of layer 2–4 neurons in parietal and other medial cortices, revealed a number of Kiaa0319 shRNA–transfected neurons in both the PVHs and layer 2/3 that were colabeled with Cux1. In contrast, staining for Ctgf, a marker of layer 6b neurons, did not disclose any colabeled neurons (Fig. 4). Similarly, staining with the layer 6 marker Foxp2 did not reveal any transfected cells that were colabeled (Fig. 5). These results suggest that PVHs and some of the deeper cortical areas contain neurons that are normally destined for supragranular layers.

Figure 4.

Confocal microscopy of lamina specific markers Cux1 and Ctgf in the brain of rats embryonically transfected with shRNA targeted against Kiaa0319. The white line delineates the border between a PVH and the white matter. The 4 panels illustrate cells transfected with eGFP (A), cells immunopositive for the upper lamina specific marker Cux1 (B), cells immunopositive for the subplate specific marker Ctgf (C) and a merged panel (D). There are eGFP (shRNA–transfected) cells that are Cux1 positive (straight sided arrowheads), and some that are not (concave arrowheads). There are, in addition, a large number of Cux1-positive cells that are not colabeled with eGFP (arrows). This suggests that these nontransfected cells arrive in the PVH by non–cell autonomous mechanisms. There are no cells that colabel with Ctgf+ cells. Bar = 100 μm.

Figure 4.

Confocal microscopy of lamina specific markers Cux1 and Ctgf in the brain of rats embryonically transfected with shRNA targeted against Kiaa0319. The white line delineates the border between a PVH and the white matter. The 4 panels illustrate cells transfected with eGFP (A), cells immunopositive for the upper lamina specific marker Cux1 (B), cells immunopositive for the subplate specific marker Ctgf (C) and a merged panel (D). There are eGFP (shRNA–transfected) cells that are Cux1 positive (straight sided arrowheads), and some that are not (concave arrowheads). There are, in addition, a large number of Cux1-positive cells that are not colabeled with eGFP (arrows). This suggests that these nontransfected cells arrive in the PVH by non–cell autonomous mechanisms. There are no cells that colabel with Ctgf+ cells. Bar = 100 μm.

Figure 5.

Distribution of the lower lamina specific marker Foxp2 in the brain of a rat embryonically transfected with Kiaa0319 shRNA. (A) Photomicrograph of cerebral cortex of Nissl-stained section illustrating region of PVH (arrows). This animal was embryonically transfected with Kiaa0319 shRNA + eGFP. Bar = 500 μm. (B) Photomicrograph of section adjacent to panel (A) immunohistochemically stained for eGFP. Transfected neurons are located within the PVH. Bar = 500 μm. (C, D, and E) Confocal microscopic images of PVH (white lines) seen in (A) and (B). The 3 panels illustrate cells transfected with eGFP and Kiaa0319 shRNA (C), cells immunopositive for the lower lamina specific marker Foxp2 (D), and a merged panel (E). There are no cells double labeled for eGFP and Foxp2, nor are there any Foxp2 labeled cells in the PVH. This suggests that lower lamina cells are not disrupted by embryonic transfection with Kiaa0319 shRNA. Arrow in (C) is for orientation. Box in each panel indicates region magnified in panels (F, G, and H). Bar = 200 μm. (F, G, and H) Magnified regions of panels (C, D, and E), respectively. Bar = 100 μm.

Figure 5.

Distribution of the lower lamina specific marker Foxp2 in the brain of a rat embryonically transfected with Kiaa0319 shRNA. (A) Photomicrograph of cerebral cortex of Nissl-stained section illustrating region of PVH (arrows). This animal was embryonically transfected with Kiaa0319 shRNA + eGFP. Bar = 500 μm. (B) Photomicrograph of section adjacent to panel (A) immunohistochemically stained for eGFP. Transfected neurons are located within the PVH. Bar = 500 μm. (C, D, and E) Confocal microscopic images of PVH (white lines) seen in (A) and (B). The 3 panels illustrate cells transfected with eGFP and Kiaa0319 shRNA (C), cells immunopositive for the lower lamina specific marker Foxp2 (D), and a merged panel (E). There are no cells double labeled for eGFP and Foxp2, nor are there any Foxp2 labeled cells in the PVH. This suggests that lower lamina cells are not disrupted by embryonic transfection with Kiaa0319 shRNA. Arrow in (C) is for orientation. Box in each panel indicates region magnified in panels (F, G, and H). Bar = 200 μm. (F, G, and H) Magnified regions of panels (C, D, and E), respectively. Bar = 100 μm.

Intriguingly, there were large numbers of Cux1+ neurons in the PVHs that were not colabeled with eGFP (indicating that they were not transfected with Kiaa0319 shRNA) that failed to migrate (Fig. 4). This suggested that there were non–cell autonomous effects of transfection with Kiaa0319 shRNA. Alternatively, it could be that these Cux1+ neurons were originally transfected with Kiaa0319 shRNA + eGFP, and that the fluorescent protein had been subsequently lost from the cells. In order to test this alternative, we examined the brains of animals transfected with Kiaa0319 shRNA + eGFP on E15/16 and subsequently injected with BrdU at E18/19. We first assessed the distribution of BrdU+ and eGFP+ cells following a 4-h post-BrdU injection interval (Fig. 6A–F). We found that there were very few colabeled cells, indicating that cells labeled by BrdU at E18/19 were largely nontransfected cells (Fig. 6C,F; Supplemental Movies 1 and 2), and that the BrdU+ and eGFP+ populations belong to distinct populations. We then examined similarly treated animals in the postnatal period, and examined for the colocalization of BrdU+, Cux1+, and eGFP+ neurons in layer 2/3 and the PVH (Fig. 6G–N).

Figure 6.

Non–cell autonomous effects of Kiaa0319 shRNA transfection. Distribution of cells in the border between the subventricular zone (SVZ) and the IZ (AC) and the VZ/SVZ border (DF) 4 h after an injection of BrdU at E18/19 in rats transfected at E15/16 with Kiaa0319 shRNA + eGFP. There are few cells double labeled for eGFP and BrdU (arrow), indicating that these are 2 separate populations. Z-axis movie of panels C and F are available as supplements. Bar = 20 μm. (GN) Distribution of Cux1- and E18/19 BrdU+ cells in the layer 2/3 (GJ) and the PVH (delineated by dashed white lines; KN) of a rat embryonically transfected with Kiaa0319 shRNA + eGFP at E15/16. There are large numbers of eGFP+ (G and K), Cux1+ (H and L), and BrdU+ (I and M) cells in both layer 2/3 and the PVH. A significant subset of cells in both in layer 2 and the PVH are both Cux1+ and BrdU+. These are seen as purple cells in the merged panels (J and N; arrows). As in Figure 3, there is another subset of cells that colabel for both eGFP and Cux1 (yellow cells in the merged panel, arrowheads). There are, however, no cells colabeled for eGFP and BrdU in either layer 2/3 or the PVH. The lack of double-labeled cells in the PVH support the notion that there are non–cell autonomous effects of embryonic transfections with Kiaa0319 shRNA. Bar = 200 μm.

Figure 6.

Non–cell autonomous effects of Kiaa0319 shRNA transfection. Distribution of cells in the border between the subventricular zone (SVZ) and the IZ (AC) and the VZ/SVZ border (DF) 4 h after an injection of BrdU at E18/19 in rats transfected at E15/16 with Kiaa0319 shRNA + eGFP. There are few cells double labeled for eGFP and BrdU (arrow), indicating that these are 2 separate populations. Z-axis movie of panels C and F are available as supplements. Bar = 20 μm. (GN) Distribution of Cux1- and E18/19 BrdU+ cells in the layer 2/3 (GJ) and the PVH (delineated by dashed white lines; KN) of a rat embryonically transfected with Kiaa0319 shRNA + eGFP at E15/16. There are large numbers of eGFP+ (G and K), Cux1+ (H and L), and BrdU+ (I and M) cells in both layer 2/3 and the PVH. A significant subset of cells in both in layer 2 and the PVH are both Cux1+ and BrdU+. These are seen as purple cells in the merged panels (J and N; arrows). As in Figure 3, there is another subset of cells that colabel for both eGFP and Cux1 (yellow cells in the merged panel, arrowheads). There are, however, no cells colabeled for eGFP and BrdU in either layer 2/3 or the PVH. The lack of double-labeled cells in the PVH support the notion that there are non–cell autonomous effects of embryonic transfections with Kiaa0319 shRNA. Bar = 200 μm.

As expected, there were large numbers of neurons colabeled for BrdU and Cux1 as well as Cux1 and eGFP colabeled cells in layer 2. However, there were no neurons colabeled with eGFP and BrdU. In the PVH, the results were identical to those described in Figure 5. Specifically, there were large numbers of Cux1+ neurons that were not colabeled with eGFP. Moreover, there were large numbers of E18/19 BrdU+ neurons in the PVH and none of these were colabeled with eGFP (although some coexpressed Cux1). Taken together, these results indicate that the nontransfected neurons in the PVH did not lose the eGFP label, but rather represent non–cell autonomous effects of Kiaa0319 knockdown in the developing rat brain.

We sought further confirmation of the non–cell autonomous effects of embryonic knockdown of Kiaa0319 by staining for GABAergic interneurons in the PVH using antibodies against Calretinin and Parvalbumin. GABAergic interneurons are generated in the medial ganglionic eminence, and are therefore not likely to have been transfected following in utero electroporation. Thus, the presence of positive immunoreactive cells in the PVH would argue strongly for non–cell autonomous effects. We found both Calretinin- and Parvalbumin-positive interneurons within the PVH (Fig. 7), which supports the notion that embryonic transfection with shRNA targeted against Kiaa0319 has non–cell autonomous effects on both radially migrating and tangentially migrating neurons.

Figure 7.

GABAergic interneurons are present in PVHs. Distribution of Calretinin-positive (AC) and Parvalbumin-positive (EF) interneurons in a PVH (dashed white lines) from a brain embryonically transfected with Kiaa0319 shRNA. There are no neurons that colabel for eGFP (arrowheads, neurons that were transfected with Kiaa0319 shRNA) and either of the 2 GABAergic antibodies (arrows). Bar = 100 μm.

Figure 7.

GABAergic interneurons are present in PVHs. Distribution of Calretinin-positive (AC) and Parvalbumin-positive (EF) interneurons in a PVH (dashed white lines) from a brain embryonically transfected with Kiaa0319 shRNA. There are no neurons that colabel for eGFP (arrowheads, neurons that were transfected with Kiaa0319 shRNA) and either of the 2 GABAergic antibodies (arrows). Bar = 100 μm.

Altered Expression of KIAA0319 Disrupts the Laminar Position of Pyramidal Neurons

Previously, we demonstrated a distinctive pattern of migrational disturbance following transfections with shRNA targeted against Dyx1c1 or Dcdc2. Specifically, we found a bimodal pattern of migration, with approximately 7–20% of the transfected neurons not migrating past the cortical–white matter border, and the remaining neurons “overmigrating” past their expected laminar locations (Rosen et al. 2007; Burbridge et al. 2008). In the current experiment, we sought to determine whether this overmigration phenotype occurred following either knockdown of Kiaa0319 or overexpression of its protein.

Of the 57 animals, 4 were excluded from this analysis because the transfections were outside the main region of analysis (somatosensory cortex). The results of the migration distance analysis for all groups are summarized in Figure 8. Virtually, all (98.4%) of the neurons in the Kiaa0319 scram (control) transfected group migrated into the neocortex, with the majority peaking in layer 2/3, at approximately 75% of the cortical depth, with an average of 69.8 ± 1.0%. In comparison, 10% of the Kiaa0319 shRNA—transfected cells remained at the cortical/white matter border, which is significantly different from the Kiaa0319 scram group (F1,36 = 9.1, P < 0.01). Interestingly, the distribution of those neurons that did migrate is virtually identical to that of the Kiaa0319 scram group, with an average migration distance of 68.8 ± 1.0% (F1,36 < 1, NS). Thus, although the bimodal migration distance phenotype is consistent among all 3 candidate dyslexia susceptibility genes examined, unlike Dcdc2 and Dyx1c1 (Rosen et al. 2007; Burbridge et al. 2008) there is no overmigration phenotype following knockdown of Kiaa0319.

Figure 8.

Migration distance analysis following embryonic knockdown and/or overexpression of Kiaa0319. Quantitative migration analysis of the percent of neurons migrating (X-axis) against the normalized depth of the cerebral cortex. Photomicrograph of cerebral cortex is included as an aid for laminar delineation. There are significantly more unmigrated neurons in the shRNA group (blue) when compared with the other 3 groups. There is no difference in the upper layer migration between the Kiaa0319 shRNA and Kiaa0319 scrambled (green) groups, nor is there a difference between the Overexpression (red) and Rescue (light blue) groups. Neurons in brains embryonically transfected with KIAA0319 protein migrate below their expected laminar position based on comparison with the scrambled group.

Figure 8.

Migration distance analysis following embryonic knockdown and/or overexpression of Kiaa0319. Quantitative migration analysis of the percent of neurons migrating (X-axis) against the normalized depth of the cerebral cortex. Photomicrograph of cerebral cortex is included as an aid for laminar delineation. There are significantly more unmigrated neurons in the shRNA group (blue) when compared with the other 3 groups. There is no difference in the upper layer migration between the Kiaa0319 shRNA and Kiaa0319 scrambled (green) groups, nor is there a difference between the Overexpression (red) and Rescue (light blue) groups. Neurons in brains embryonically transfected with KIAA0319 protein migrate below their expected laminar position based on comparison with the scrambled group.

Virtually all (98.7%) of the neurons transfected with the KIAA0319 expression construct migrated into the neocortex, with the major peak at lower layer 2/3 at a cortical depth of 65%, (average = 63.6 ± 2.5%). This average migration distance differs from the Kiaa0319 scram group (F1,16 = 5.1, P < 0.05), suggesting that KIAA0319 overexpression disrupts the normal migration of neurons. Of the neurons that were co–transfected with Kiaa0319 shRNA and KIAA0319 expression construct (the rescue condition), 5.5% did not migrate in the CP. This percentage of unmigrated cells is significantly smaller than that in the Kiaa0319 shRNA group (F1,33 = 5.6, P < 0.05), which indicates that the presence of the KIAA0319 protein rescues the “nonmigration” phenotype. Interestingly, the migration distance for the rescue condition peaks at the same point as the KIAA0319 expression vector alone group, at around 65% of the cortical depth, with an average of 63.3% ± 1.0. This differs significantly from the Kiaa0319 scram group (F1,17 = 12.6, P < 0.01), and does not significantly differ from the KIAA0319 overexpression group (F1,13 < 1, NS). Taken together, the evidence suggests that neurons that are transfected with the KIAA0319 expression construct (both the overexpression and rescue groups) tend to migrate to lower laminar positions than would be expected for normal cohort of migrating cells. As the KIAA0319 expression construct used to rescue is insensitive to complete knockdown by the Kiaa0319 shRNA this would suggest that overexpression of KIAA0319 alters the position of cells within cortical lamina. It is not yet clear whether this shift in position by overexpression of KIAA0319 results from impairment of migration or from impairment of laminar sorting, which could result from changes in cell adhesion.

Knockdown of Kiaa0319 Causes Increased Arborization of Apical Dendrites

The results from the quantitative analysis of dendritic arborization are summarized in Figure 9. We analyzed the data from the Sholl analysis (Fig. 9A,B) using a repeated measures ANOVA, with dendrite length within each 10-μm concentric circle as a dependent measure, treatment groups as the independent measure, and the concentric circles (“bins”) as the repeated measure. For apical dendrites, there were significant main effects for both treatment group (F3,52 = 5.7, P < 0.01) and bins (F332,4316 = 171.2, P < 0.001), as well as a significant bins × treatment group interaction (F249,4316 = 6.33, P < 0.001). We further analyzed the treatment group main effect, and found that the Kiaa0319 shRNA group significantly differed from each of the other 3 groups (shRNA vs. Overexpression: F1,35 = 9.3, P < 0.01; shRNA vs. Rescue: F1,37 = 8.9, P < 0.01; shRNA vs. Scram: F1,38 = 4.3, P < 0.05). This indicated that there was significant dendritic hypertrophy in neurons embryonically transfected with Kiaa0319 shRNA. In contrast, there was no significant difference among the 4 treatment conditions for basal dendrite length (F3,52 = 2.0, NS), although there were significant effects for bins (F48,2496 = 351.2, P < 0.001) and bin × treatment group interaction (F144,2496 = 2.5, P < 0.001). These results suggest a trophic effect on apical, but not basal, dendritic arborization caused by Kiaa0319 interference.

Figure 9.

Neuronal morphology and quantitative analysis following embryonic knockdown and/or overexpression of Kiaa0319. (AD) Representative tracing of neurons embryonically transfected with plasmids expressing Kiaa0319 shRNA (A), KIAA0319 protein (B), scrambled Kiaa0319 shRNA (C), and both Kiaa0319 shRNA and KIAA0319 protein (D). (E) Sholl analysis of apical dendrites for each condition. The dendrites of Kiaa0319 shRNA–transfected neurons are longer within 200 μm of the cell body when compared with the other 3 groups. (F) Sholl analysis of basal dendrites for each condition reveals no significant differences among the 4 groups. (G) Quantitative analysis of specific dendritic features confirms the Sholl analysis. Apical dendrites of neurons embryonically transfected with Kiaa0319 shRNA have more nodes, ends, and overall length when compared with the scrambled and rescue groups. In contrast, there are no significant differences in any of these measures in the basal dendrites. There is no difference in the number of basal dendrites. *Differs from Kiaa0319 shRNA, P < 0.05.

Figure 9.

Neuronal morphology and quantitative analysis following embryonic knockdown and/or overexpression of Kiaa0319. (AD) Representative tracing of neurons embryonically transfected with plasmids expressing Kiaa0319 shRNA (A), KIAA0319 protein (B), scrambled Kiaa0319 shRNA (C), and both Kiaa0319 shRNA and KIAA0319 protein (D). (E) Sholl analysis of apical dendrites for each condition. The dendrites of Kiaa0319 shRNA–transfected neurons are longer within 200 μm of the cell body when compared with the other 3 groups. (F) Sholl analysis of basal dendrites for each condition reveals no significant differences among the 4 groups. (G) Quantitative analysis of specific dendritic features confirms the Sholl analysis. Apical dendrites of neurons embryonically transfected with Kiaa0319 shRNA have more nodes, ends, and overall length when compared with the scrambled and rescue groups. In contrast, there are no significant differences in any of these measures in the basal dendrites. There is no difference in the number of basal dendrites. *Differs from Kiaa0319 shRNA, P < 0.05.

In order to dissect the components of the dendritic tree that differed among the treatment groups, we analyzed the number of dendrites (for basal only), nodes, ends, and total length (Fig. 9C). For apical dendrites, we found that the Kiaa0319 shRNA–transfected neurons had more ends, nodes, and longer dendritic length than neurons in the Rescue group (F1,35 = 7.5, P < 0.01; F1,35 = 8.0, P < 0.01; F1,35 = 7.1, P < 0.05, respectively). In addition, we found that there were more ends (F1,37 = 7.6, P < 0.01) and nodes (F1,37 = 7.8, P < 0.01) in the Kiaa0319 shRNA group when compared with the Kiaa0319 scram group. There were no significant differences in any of these apical dendrite measures between neurons embryonically transfected with Kiaa0319 shRNA neurons and those transfected with the KIAA0319 expression construct. Moreover, there were no significant differences among any of the basal dendrite measures. Taken together, these results support the Sholl analysis, and indicate that knockdown of Kiaa0319 results in apical, but not basal, dendritic hypertrophy.

Discussion

Previous reports had demonstrated that embryonic transfection with shRNA targeted against the rat homolog of the candidate dyslexia susceptibly gene Kiaa0319 resulted in significant arrest of neuronal migration when assessed 4 days following transfection, with the majority of transfected cells remaining in the VZ (Paracchini et al. 2006). The current experiment indicates that this disruption of neuron migration causes specific types of neuronal migration anomalies in the postnatal brain—specifically PVHs and abnormal laminar locations, and embryonically transfecting neurons with both the Kiaa0319 shRNA and KIAA0319 expression construct rescues this phenotype. In contrast, overexpressing the KIAA0319 protein does not cause gross neuronal migration disorders.

In humans, PVHs and other anomalies of neuronal migration are relatively easy to visualize with computed tomography and magnetic resonance imaging and are confirmed post mortem using standard histological techniques. It has been hypothesized, however, that these malformations may simply act as flags for other, more widespread, disturbances in neocortical organization. For example, disturbances in white matter connectivity associated with neuronal migration disorders have been revealed using diffusion tensor imaging in humans (Lee et al. 2005; Huppi and Dubois 2006), and severe disruptions in connectivity have been demonstrated in various animal models of neuronal migration disorders (Giannetti et al. 1999, 2000; Jenner et al. 2000; Rosen et al. 2000). Moreover, the abundance of radial glia-like morphology in Nestin-positive fibers within the PVH, supports the existence of a more widespread disturbance in neocortical organization. Interestingly, this maintenance of radial glia–like morphology is remarkably similar to that seen following induction a malformation resembling microgyria via a P1 freezing lesion, where Nestin-positive fibers were seen in the microgyria well into adulthood (Rosen et al. 1994).

Inducing neuronal migration anomalies by embryonic transfection with shRNA has enabled us to identify disruptions of laminar positioning that would otherwise not be visualized. In the current experiment, we have demonstrated that following embryonic transfection with Kiaa0319 shRNA, Cux1+ and E18/19 BrdU+ neurons that are normally destined for layer 2/3 collect in PVHs. Although some of these neurons were transfected with Kiaa0319 shRNA, there were large numbers that were not. This replicates and extends previous reports, where we found that embryonic transfection with shRNA targeted against the rat homologue of the candidate dyslexia susceptibility gene Dcdc2 resulted in nontransfected Cux1+ neurons in the PVH (Burbridge et al. 2008).

It could be argued, however, that the Cux1+ and BrdU+ neurons that are eGFP negative, were in fact transfected with Kiaa0319 shRNA but that the cell simply stopped expressing eGFP in the postnatal period. To test this hypothesis, we examined animals that received E15/16 transfections of Kiaa0319 shRNA, an E18/19 injection of BrdU, and were then sacrificed 4 hours later. In these animals, the eGFP+ and BrdU+ cells made up separate and unique populations—there were few cells that were double labeled (Fig. 6AF). When we examined the brains of identically treated animals in the postnatal period, then, any BrdU+ neuron was not transfected with Kiaa0319 shRNA + eGFP. Because we found large numbers of BrdU+ neurons in the PVH, this strongly supports the hypothesis that these cells failed to migrate due to non–cell autonomous mechanisms. This argument is further bolstered by the presence of GABAergic interneurons in the PVH. Because these neurons are not generated in the VZ (Anderson et al. 2001), it is unlikely that they were transfected with Kiaa0319 shRNA + eGFP. The presence, therefore, of Parvalbumin- and Calretinin-positive interneurons, which are not colabeled with eGFP in the PVH, strongly supports the notion that there are non–cell autonomous effects of embryonic transfection with Kiaa0319 shRNA.

The results reported here are similar to previous reports that examined the pre- and postnatal phenotypes associated with embryonic transfection of candidate dyslexia susceptibility genes. Thus, embryonic knockdown of Dcdc2 (Meng et al. 2005; Paracchini et al. 2006; Burbridge et al. 2008) and Dyx1c1 (Wang et al. 2006; Rosen et al. 2007) disrupted neuronal migration. As with Kiaa0319 embryonic knockdown, the majority of brains transfected with Dcdc2 or Dyx1c1 shRNA develop PVHs, although Dyx1c1 and Kiaa0319 knockdown groups have more extensive malformations. We did find hippocampal malformations following embryonic transfections with shRNA targeted against Kiaa0319, but the incidence was smaller than that associated with knockdown of either Dyx1c1 or Dcdc2. As with the case of Dcdc2 transfected brains, we did not find any evidence of molecular layer ectopias in the current study, whereas they were present in about 25% of the brains transfected with Dyx1c1 shRNA.

Although embryonic knockdown of the 3 candidate dyslexia susceptibility genes always resulted in a population of unmigrated neurons, the disposition of those neurons that did migrate into the cerebral cortex differed. In the case of the previous reports, the peak locations of transfected neurons in the cerebral cortex were superficial to their expected lamina (Rosen et al. 2007; Burbridge et al. 2008). This was not the case in the present report, as neurons embryonically transfected with Kiaa0319 shRNA were distributed in the cerebral cortex identically to control animals transfected with the scrambled version of the Kiaa0319 shRNA. In contrast, we did find disruptions of laminar position following overexpression of KIAA0319, with transfected neurons migrating to positions below their expected location. This was true both for the overexpression and “rescue” group, which were simultaneously transfected with the overexpression construct and Kiaa0319 shRNA. This “undermigration” of neurons transfected in both conditions could either represent the effects of overexpressing the protein, or could be due to the effect of the human protein on the migrating neurons. Because we lack an effective antibody against the protein, we cannot directly distinguish between these 2 possibilities.

It is possible that changes in the methods of quantification may explain the disparity between the previous reports and the current experiment. In the original 2 reports, migration distance of transfected neurons was assessed by determining the number of neurons in successive deciles in a 250-μm-wide sampling grid. In the current experiment, the actual distance that each neuron migrated (as a percent of the total depth of the cortex) was recorded (Supplemental Fig. 2). It could be, then, that the results from the previous reports resulted from undersampling. We have reanalyzed the data from one of these experiments using the present methodology (Burbridge et al. 2008), and found that the results were identical to the previous report (unpublished observations). It is therefore likely that the results reported here reflect a real difference in the postnatal phenotypes between Kiaa0319 and the other candidate dyslexia susceptibility genes.

There is little currently known concerning the functions of these genes, but what is known suggests that they may well disrupt neuronal migration by distinct mechanisms. DCDC2 is one of a group of proteins distinguished by the presence of tandem or single dcx domains, which are critical for binding and stabilizing microtubules (Allen et al. 1998; des Portes et al. 1998; Gleeson et al. 1999; Graham et al. 2004; LoTurco 2004; Reiner et al. 2004; Schaar et al. 2004). The function of Dyx1c1 is not well known, but previous reports suggest that Dyx1c1 is localized in the cytoplasm along microtubules as well (Wang et al. 2006). KIAA0319, on the other hand, is a gene that codes for an integral membrane protein with a large glycosylated (Velayos-Baeza et al. 2008) extracellular region containing multiple PKD domains, a single transmembrane domain, and a small cytoplasmic C-terminus. Recently 3 KIAA0319 splice variants have been identified and one of these codes for a secreted protein (Velayos-Baeza et al. 2008). We do not yet know which splice variant may be responsible for function in migration or dendritic differentiation, however future experiments using different splice variants to rescue the RNAi phenotypes described here can now be used to distinguish among their functions. The full-length KIAA0319 may be involved in cellular adhesion, as PKD domains in polycistin–1 are necessary for adhesion of renal epithelial cells (Wilson 2001). Consistent with a function in cell adhesion in developing cortex, Parrachini et al. (2006) showed a change in the relationship between radial glia and migrating neurons following interference of Kiaa0319 in embryonic neocortex. Similarly, the significant non–cell autonomous component of migration disruption we show here is consistent with a role for the secreted splice variant of Kiaa0319 (Velayos-Baeza et al. 2008).

Prior to the current experiment, the effects of embryonic knockdown and overexpression of candidate dyslexia susceptibility genes on neuronal morphology had not been addressed. Here we find that transfection with Kiaa0319 shRNA results in hypertrophy of apical, but not basal, dendrites when compared with the other 3 conditions. It could be that our results could be affected by biases in the orientation of the sections, the laminar positions of the neurons being measured, or in the relatively narrow section thickness. There was no difference in the laminar distribution of neurons that were measured between the groups, and the analysis of the subsection of those neurons in the upper laminae were identical to those from the entire population. Our results could be explained by biased sectioning only if the orientations of Kiaa0319 shRNA–transfected neurons were systematically different than those of neurons in the other groups. We have no evidence of differential orientation between the experimental groups. The relatively narrow section thickness does result in a less elaborate dendritic branching when compared with, for example, biocytin injection. Although there is no evidence of systematic bias between the groups, replication of these results in thicker sections of biocytin-injected neurons would be warranted. Further confirmation of the effect of Kiaa0319 expression on dendritic outgrowth awaits experiments in cultured neurons.

The mechanisms underlying the dendritic differences are not known, but could reflect direct effects of Kiaa0319 on both neuronal migration and dendritic outgrowth. Along these lines, the relationship between neuronal migration disorders and dendritic hypertrophy has been previously established. Takashima et al. (1991) reported the coexistence of hemimegalencephaly, a disorder of neuronal migration, and dendritic hypertrophy in 6 post mortem patients. More recently, PTEN deficient mice—a model for macrocephaly and Lhermitte–Dudos disease—exhibit both ectopic neurons and hypertrophic dendrites in the cerebral cortex (Kwon et al. 2006). The p21-activated kinase (Pak1), a cytoskeletal regulator, has significant effects on neuronal migration, elaboration of axons and dendrites, and the formation of dendritic spines (Banerjee et al. 2002; Causeret et al. 2009), and Lis-1 deficient mice have hippocampal migration disorders as well as altered dendritic arborization (Fleck et al. 2000). ROBO1, a candidate dyslexia susceptibility gene, plays important roles in both neuronal migration and process outgrowth (Long et al. 2004; Hannula-Jouppi et al. 2005; Andrews et al. 2008). Alternatively, it could be that the changes in the elaborations of the dendrites are secondary to the neuronal migration disorder that is induced by Kiaa0319 knockdown. For example, long-term potentiation has been shown to increase various measures of dendritic morphology in the cerebral cortex (Monfils et al. 2004), and it is well known that damage to the developing brain can affect dendritic arborization in connected regions (Marin-Padilla 1997). One way to distinguish between these possibilities would be to assess dendritic morphology of both transfected and nontransfected neurons in the same brain. Future experiments involving sequentially transfecting pups will enable this question to be directly addressed. Alternatively, one could conditionally re-express Kiaa0319 in animals embryonically transfected with Kiaa0319 shRNA after the completion of neuronal migration and during the dendritic differentiation (P7–P21).

In summary, we have demonstrated that embryonic knockdown of the candidate dyslexia susceptibility gene homolog Kiaa0319 results in a neuronal migration disorder and hypertrophy of apical dendrites. Both cell autonomous and non–cell autonomous mechanisms appear to play a role in the formation of the neuronal migration disturbances, but their relative contribution to apical dendritic hypertrophy is not known. Overexpression of KIAA0319 does not produce PVH or other gross disturbances in neuronal migration, but does act to limit the distance that neurons migrate into the CP. At present, all of the candidate dyslexia susceptibility genes whose functions have been investigated have been found to play a role in neuronal migration. This is the first demonstration that one of these genes has an effect on subsequent neuronal morphology, which may provide another biological substrate for the functional differences seen in this disorder. Whether other dyslexia susceptibility genes have similar effects on neuronal morphology is not known, but will provide a fruitful avenue for future investigations.

Supplementary Material

Supplementary material can be found at: http://www.cercor.oxfordjournals.org/.

Funding

National Institutes of Health (HD20806) to A.M.G., J.J.L., and G.D.R; and Department of Defense (DoD) through the National Defense Science & Engineering Graduate Fellowship (NDSEG) Program and Fannie and John Hertz Foundation/Myhrvold Family fellowship supported Z.W.G.

The authors thank Ankur Thomas for the validation of the plasmids. The authors thank the reviewers for their helpful comments on a previous version of the manuscript. Conflict of Interest: None declared.

References

Allen
KM
Gleeson
JG
Shoup
SM
Walsh
CA
A YAC contig in Xq22.3-q23, from DXS287 to DXS8088, spanning the brain- specific genes doublecortin (DCX) and PAK3
Genomics
 , 
1998
, vol. 
52
 (pg. 
214
-
218
)
Anderson
S
Marin
O
Horn
C
Jennings
K
Rubenstein
J
Distinct cortical migrations from the medial and lateral ganglionic eminences
Development
 , 
2001
, vol. 
128
 (pg. 
353
-
363
)
Andrews
W
Barber
M
Hernadez-Miranda
LR
Xian
J
Rakic
S
Sundaresan
V
Rabbitts
TH
Pannell
R
Rabbitts
P
Thompson
H
, et al.  . 
The role of Slit-Robo signaling in the generation, migration and morphological differentiation of cortical interneurons
Dev Biol.
 , 
2008
, vol. 
313
 (pg. 
648
-
658
)
Bai
J
Ramos
RL
Ackman
JB
Thomas
AM
Lee
RV
LoTurco
JJ
RNAi reveals doublecortin is required for radial migration in rat neocortex
Nat Neurosci
 , 
2003
, vol. 
6
 (pg. 
1277
-
1283
)
Banerjee
M
Worth
D
Prowse
DM
Nikolic
M
Pak1 phosphorylation on t212 affects microtubules in cells undergoing mitosis
Curr Biol.
 , 
2002
, vol. 
12
 (pg. 
1233
-
1239
)
Berger
UV
Hediger
MA
Differential distribution of the glutamate transporters GLT-1 and GLAST in tanycytes of the third ventricle
J Comp Neurol
 , 
2001
, vol. 
433
 (pg. 
101
-
114
)
Brkanac
Z
Chapman
NH
Matsushita
MM
Chun
L
Nielsen
K
Cochrane
E
Berninger
VW
Wijsman
EM
Raskind
WH
Evaluation of candidate genes for DYX1 and DYX2 in families with dyslexia
Am J Med Genet B Neuropsychiatric Genet.
 , 
2007
 
Epub ahead of print: n/a
Burbridge
T
Wang
Y
Volz
A
Peschansky
V
Lisann
L
Galaburda
AM
LoTurco
JJ
Rosen
GD
Postnatal analysis of the effect of embryonic knockdown and overexpression of candidate dyslexia susceptibility gene DCDC2
Neuroscience
 , 
2008
, vol. 
152
 (pg. 
723
-
733
)
Causeret
F
Terao
M
Jacobs
T
Nishimura
YV
Yanagawa
Y
Obata
K
Hoshino
M
Nikolic
M
The p21-activated kinase is required for neuronal migration in the cerebral cortex
Cereb Cortex
 , 
2009
, vol. 
19
 (pg. 
861
-
875
)
Chang
BS
Ly
J
Appignani
B
Bodell
A
Apse
KA
Ravenscroft
RS
Sheen
VL
Doherty
MJ
Hackney
DB
O'Connor
M
, et al.  . 
Reading impairment in the neuronal migration disorder of periventricular nodular heterotopia
Neurology
 , 
2005
, vol. 
64
 (pg. 
799
-
803
)
Cope
N
Harold
D
Hill
G
Moskvina
V
Stevenson
J
Holmans
P
Owen
MJ
O'Donovan
MC
Williams
J
Strong evidence that KIAA0319 on chromosome 6p is a susceptibility gene for developmental dyslexia
Am J Hum Genet.
 , 
2005
, vol. 
76
 (pg. 
581
-
591
)
des Portes
V
Pinard
JM
Billuart
P
Vinet
MC
Koulakoff
A
Carrie
A
Gelot
A
Dupuis
E
Motte
J
Berwald-Netter
Y
, et al.  . 
A novel CNS gene required for neuronal migration and involved in X- linked subcortical laminar heterotopia and lissencephaly syndrome
Cell.
 , 
1998
, vol. 
92
 (pg. 
51
-
61
)
Fisher
SE
Francks
C
Genes, cognition and dyslexia: learning to read the genome
Trends Cogn Sci.
 , 
2006
, vol. 
10
 (pg. 
250
-
257
)
Fleck
MW
Hirotsune
S
Gambello
MJ
Phillips-Tansey
E
Suares
G
Mervis
RF
Wynshaw-Boris
A
McBain
CJ
Hippocampal abnormalities and enhanced excitability in a murine model of human lissencephaly
J Neurosci
 , 
2000
, vol. 
20
 (pg. 
2439
-
2450
)
Francks
C
Paracchini
S
Smith
SD
Richardson
AJ
Scerri
TS
Cardon
LR
Marlow
AJ
MacPhie
IL
Walter
J
Pennington
BF
, et al.  . 
A 77-kilobase region of chromosome 6p22.2 is associated with dyslexia in families from the United Kingdom and from the United States
Am J Hum Genet.
 , 
2004
, vol. 
75
 (pg. 
1046
-
1058
)
Galaburda
AM
Kemper
TL
Cytoarchitectonic abnormalities in developmental dyslexia; a case study
Ann Neurol
 , 
1979
, vol. 
6
 (pg. 
94
-
100
)
Galaburda
AM
Sherman
GF
Rosen
GD
Aboitiz
F
Geschwind
N
Developmental dyslexia: four consecutive cases with cortical anomalies
Ann Neurol
 , 
1985
, vol. 
18
 (pg. 
222
-
233
)
Giannetti
S
Gaglini
P
Di Rocco
F
Di Rocco
C
Granato
A
Organization of cortico-cortical associative projections in a rat model of microgyria
NeuroReport
 , 
2000
, vol. 
11
 (pg. 
2185
-
2189
)
Giannetti
S
Gaglini
P
Granato
A
Di Rocco
C
Organization of callosal connections in rats with experimentally induced microgyria
Childs Nerv Syst
 , 
1999
, vol. 
15
 (pg. 
444
-
448
discussion 449–450
Gleeson
JG
Lin
PT
Flanagan
LA
Walsh
CA
Doublecortin is a microtubule-associated protein and is expressed widely by migrating neurons
Neuron
 , 
1999
, vol. 
23
 (pg. 
257
-
271
)
Graham
ME
Ruma-Haynes
P
Capes-Davis
AG
Dunn
JM
Tan
TC
Valova
VA
Robinson
PJ
Jeffrey
PL
Multisite phosphorylation of doublecortin by cyclin-dependent kinase 5
Biochem J
 , 
2004
, vol. 
381
 (pg. 
471
-
481
)
Hannula-Jouppi
K
Kaminen-Ahola
N
Taipale
M
Eklund
R
Nopola-Hemmi
J
Kaariainen
H
Kere
J
The axon guidance receptor gene ROBO1 is a candidate gene for developmental dyslexia
PLoS Genet.
 , 
2005
, vol. 
1
 pg. 
e50
 
Harold
D
Paracchini
S
Scerri
T
Dennis
M
Cope
N
Hill
G
Moskvina
V
Walter
J
Richardson
AJ
Owen
MJ
, et al.  . 
Further evidence that the KIAA0319 gene confers susceptibility to developmental dyslexia
Mol Psychiatry
 , 
2006
, vol. 
11
 (pg. 
1085
-
1091
1061
Heuer
H
Christ
S
Friedrichsen
S
Brauer
D
Winckler
M
Bauer
K
Raivich
G
Connective tissue growth factor: a novel marker of layer VII neurons in the rat cerebral cortex
Neuroscience
 , 
2003
, vol. 
119
 (pg. 
43
-
52
)
Humphreys
P
Kaufmann
WE
Galaburda
AM
Developmental dyslexia in women: neuropathological findings in three cases
Ann Neurol
 , 
1990
, vol. 
28
 (pg. 
727
-
738
)
Huppi
PS
Dubois
J
Diffusion tensor imaging of brain development
Semin Fetal Neonat Med
 , 
2006
, vol. 
11
 (pg. 
489
-
497
)
Jenner
AR
Galaburda
AM
Sherman
GF
Connectivity of ectopic neurons in the molecular layer of the somatosensory cortex in autoimmune mice
Cereb Cortex
 , 
2000
, vol. 
10
 (pg. 
1005
-
1013
)
Keays
DA
Tian
G
Poirier
K
Huang
GJ
Siebold
C
Cleak
J
Oliver
PL
Fray
M
Harvey
RJ
Molnar
Z
, et al.  . 
Mutations in alpha-tubulin cause abnormal neuronal migration in mice and lissencephaly in humans
Cell.
 , 
2007
, vol. 
128
 (pg. 
45
-
57
)
Kwon
CH
Luikart
BW
Powell
CM
Zhou
J
Matheny
SA
Zhang
W
Li
Y
Baker
SJ
Parada
LF
Pten regulates neuronal arborization and social interaction in mice
Neuron
 , 
2006
, vol. 
50
 (pg. 
377
-
388
)
Lee
SK
Kim
DI
Kim
J
Kim
DJ
Kim
HD
Kim
DS
Mori
S
Diffusion-tensor MR imaging and fiber tractography: a new method of describing aberrant fiber connections in developmental CNS anomalies
Radiographics
 , 
2005
, vol. 
25
 (pg. 
53
-
65
discussion 66–58
Long
H
Sabatier
C
Ma
L
Plump
A
Yuan
W
Ornitz
DM
Tamada
A
Murakami
F
Goodman
CS
Tessier-Lavigne
M
Conserved roles for Slit and Robo proteins in midline commissural axon guidance
Neuron
 , 
2004
, vol. 
42
 (pg. 
213
-
223
)
LoTurco
J
Doublecortin and a tale of two serines
Neuron
 , 
2004
, vol. 
41
 (pg. 
175
-
177
)
Luciano
M
Lind
PA
Duffy
DL
Castles
A
Wright
MJ
Montgomery
GW
Martin
NG
Bates
TC
A haplotype spanning KIAA0319 and TTRAP is associated with normal variation in reading and spelling ability
Biol Psychiatry
 , 
2007
, vol. 
62
 (pg. 
811
-
817
)
Marin-Padilla
M
[Pathology and pathogenesis of secondary epilepsy to hypoxic-ischemic encephalopathies]
Rev Neurol
 , 
1997
, vol. 
25
 (pg. 
673
-
682
)
Marino
C
Citterio
A
Giorda
R
Facoett
iA
Menozzi
G
Vanzin
L
Lorusso
M
Nobile
M
Molteni
M
Association of short-term memory with a variant within DYX1C1 in developmental dyslexia
Genes Brain Behav
 , 
2007
 
ePub ahead of print
Meng
H
Smith
SD
Hager
K
Held
M
Liu
J
Olson
RK
Pennington
BF
DeFries
JC
Gelernter
J
O'Reilly-Pol
T
, et al.  . 
DCDC2 is associated with reading disability and modulates neuronal development in the brain
Proc Natl Acad Sci USA
 , 
2005
, vol. 
102
 (pg. 
17053
-
17058
)
Molyneaux
BJ
Arlotta
P
Menezes
JR
Macklis
JD
Neuronal subtype specification in the cerebral cortex
Nat Rev Neurosci
 , 
2007
, vol. 
8
 (pg. 
427
-
437
)
Monfils
MH
VandenBerg
PM
Kleim
JA
Teskey
GC
Long-term potentiation induces expanded movement representations and dendritic hypertrophy in layer V of rat sensorimotor neocortex
Cereb Cortex
 , 
2004
, vol. 
14
 (pg. 
586
-
593
)
Nieto
M
Monuki
ES
Tang
H
Imitola
J
Haubst
N
Khoury
SJ
Cunningham
J
Gotz
M
Walsh
CA
Expression of Cux-1 and Cux-2 in the subventricular zone and upper layers II-IV of the cerebral cortex
J Comp Neurol
 , 
2004
, vol. 
479
 (pg. 
168
-
180
)
Paracchini
S
Steer
CD
Buckingham
L-L
Morris
AP
Ring
S
Scerri
T
Stein
J
Pembrey
ME
Ragoussis
J
Golding
J
, et al.  . 
Association of the KIAA0319 dyslexia susceptibility gene with reading skills in the general population
Am J Psychiatry
 , 
2008
, vol. 
165
 (pg. 
1576
-
1584
)
Paracchini
S
Thomas
A
Castro
S
Lai
C
Paramasivam
M
Wang
Y
Keating
BJ
Taylor
JM
Hacking
DF
Scerri
T
, et al.  . 
The chromosome 6p22 haplotype associated with dyslexia reduces the expression of KIAA0319, a novel gene involved in neuronal migration
Hum Mol Genet.
 , 
2006
, vol. 
15
 (pg. 
1659
-
1666
)
Reiner
O
Gdalyahu
A
Ghosh
I
Levy
T
Sapoznik
S
Nir
R
Sapir
T
DCX's phosphorylation by not just another kinase (JNK)
Cell Cycle
 , 
2004
, vol. 
3
 (pg. 
747
-
751
)
Rosen
GD
Bai
J
Wang
Y
Fiondella
CG
Threlkeld
SW
LoTurco
JJ
Galaburda
AM
Disruption of neuronal migration by targeted RNAi knockdown of Dyx1c1 results in neocortical and hippocampal malformations
Cereb Cortex
 , 
2007
, vol. 
17
 (pg. 
2562
-
2572
)
Rosen
GD
Burstein
D
Galaburda
AM
Changes in efferent and afferent connectivity in rats with cerebrocortical microgyria
J Comp Neurol
 , 
2000
, vol. 
418
 (pg. 
423
-
440
)
Rosen
GD
Sherman
GF
Galaburda
AM
Radial glia in the neocortex of adult rats: effects of neonatal brain injury
Brain Res Dev Brain Res.
 , 
1994
, vol. 
82
 (pg. 
127
-
135
)
Schaar
BT
Kinoshita
K
McConnell
SK
Doublecortin microtubule affinity is regulated by a balance of kinase and phosphatase activity at the leading edge of migrating neurons
Neuron
 , 
2004
, vol. 
41
 (pg. 
203
-
213
)
Schumacher
J
Anthoni
H
Dahdouh
F
Konig
IR
Hillmer
AM
Kluck
N
Manthey
M
Plume
E
Warnke
A
Remschmidt
H
, et al.  . 
Strong genetic evidence of DCDC2 as a susceptibility gene for dyslexia
Am J Hum Genet.
 , 
2006
, vol. 
78
 (pg. 
52
-
62
)
Sokol
DK
Golomb
MR
Carvahlo
KS
Edwards-Brown
M
Reading impairment in the neuronal migration disorder of periventricular nodular heterotopia
Neurology
 , 
2006
, vol. 
66
 pg. 
294
  
author reply 294
Taipale
M
Kaminen
N
Nopola-Hemmi
J
Haltia
T
Myllyluoma
B
Lyytinen
H
Muller
K
Kaaranen
M
Lindsberg
PJ
Hannula-Jouppi
K
, et al.  . 
A candidate gene for developmental dyslexia encodes a nuclear tetratricopeptide repeat domain protein dynamically regulated in brain
Proc Natl Acad Sci USA
 , 
2003
, vol. 
100
 (pg. 
11553
-
11558
)
Takashima
S
Chan
F
Becker
LE
Kuruta
H
Aberrant neuronal development in hemimegalencephaly: immunohistochemical and Golgi studies
Pediatr Neurol
 , 
1991
, vol. 
7
 (pg. 
275
-
280
)
Velayos-Baeza
A
Toma
C
Paracchini
S
Monaco
AP
The dyslexia-associated gene KIAA0319 encodes highly N- and O-glycosylated plasma membrane and secreted isoforms
Hum Mol Genet.
 , 
2008
, vol. 
17
 (pg. 
859
-
871
)
Wang
Y
Paramasivam
M
Thomas
A
Bai
J
Kaminen
N
Kere
J
Voskul
J
Rosen
G
Galaburda
A
LoTurco
J
Dyx1c1 functions in neuronal migration in developing neocortex
Neuroscience
 , 
2006
, vol. 
143
 (pg. 
515
-
522
)
Wilson
PD
Polycystin: new aspects of structure, function, and regulation
J Am Soc Nephrol
 , 
2001
, vol. 
12
 (pg. 
834
-
845
)

Author notes

Veronica J. Peschansky, Timothy J. Burbridge, and Amy J. Volz contributed equally to this manuscript.