Abstract

Astrocytes release peptide and nonpeptide transmitters that influence neuronal development, function, and plasticity. However, the molecular components of the astroglial secretory pathways in vivo are largely unknown. Here, we analyze in astrocytes the production, expression regulation, trafficking, and release of secretogranin III (SgIII), a member of the multifunctional granin family. We show that astroglial cells in culture synthesize and release a nonprocessed form of SgIII. In vivo studies show that many neuronal populations produce and transport SgIII. In particular, the highest SgIII expression in the cerebral cortex in vivo is present in astroglial cells. Both SgIII protein and mRNA are abundantly detected in cortical astrocytes and in Bergmann glial cells. Moreover, the levels of SgIII mRNA and protein in reactive astrocytes, induced by perforating injury increase dramatically. These results implicate SgIII in the astrocyte secretory pathway in vivo and show that its expression is finely regulated during glial activation. The robust expression of SgIII in astrocytes and its regulation in the injured brain suggest both intracellular and extracellular roles for this glial granin in the physiology and repair/damage of neuronal circuits.

Introduction

Exocytotic vesicular secretion of signaling molecules contributes to glia–neuron communication (Araque et al. 2001; Volterra and Meldolesi 2005). In particular, astrocyte-secreted glutamate, adenosine triphosphate (ATP) and D-serine regulate neuronal physiology by modulating synaptic transmission and network activity (Pascual et al. 2005; Panatier et al. 2006; Perea and Araque 2007). In addition to nonpeptide transmitters, peptides and proteins released from astrocytes, such as growth factors, cytokines, and extracellular components, control the development, plasticity, and pathology of neuronal circuits (Allan and Rothwell 2001; Christopherson et al. 2005). Although astrocyte vesicular secretion is crucial for neuronal function, secretory pathways remain poorly characterized. It has now been shown that astroglial cells contain competent compartments and molecular machinery for a regulated secretory pathway (for review, see Montana et al. 2006). Thus, astrocytes can release gliotransmitters, such as glutamate, ATP, and neuropeptide Y, from synaptic-like microvesicles, lysosomes, and secretory granules in a Ca2+-dependent manner (Bezzi et al. 2004; Zhang et al. 2007; Ramamoorthy and Whim 2008). However, the molecular components of the transmitter secretory pathway in glia in vivo are largely unknown (Fiacco et al. 2009).

A biochemical hallmark of neuroendocrine secretory granules is the storage and release of uniquely acidic proteins known as granins, which are considered markers of the regulated secretory pathway (Taupenot et al. 2003; Helle 2004). The granin family comprises the “classical” members: chromogranin A (CgA), chromogranin B (CgB), and secretogranin II (SgII); and the 5 less known secretogranin III (SgIII, 1B1075 gene product), secretogranin IV (HISL-19 antigen), secretogranin V (neuroendocrine secretory protein 7B2), secretogranin VI (NESP55), and secretogranin VII (the nerve growth factor inducible protein VGF; Taupenot et al. 2003; Helle 2004; Montero-Hadjadje et al. 2008). Intracellularly, granins have a role in the sorting and aggregation of secretory products in the trans-Golgi network and in the subsequent biogenesis of secretory granules (Taupenot et al. 2003; Helle 2004). Moreover, proteolytic processing of these proteins, as for prohormones, gives rise to bioactive peptides (e.g., catestatin and secretoneurin) with autocrine, paracrine, and endocrine functions (Simon et al. 1988; Shyu et al. 2008).

In endocrine cells, SgIII is a key sorting receptor for peptide hormones (for review, see Takeuchi and Hosaka 2008). Moreover, SgIII has recently been shown to be expressed and released by nonneuroendocrine cell types that display a regulated secretory pathway, such as platelets and mast cells (Coppinger et al. 2004; Prasad et al. 2008). Here, we studied the little known SgIII in rodent astrocytes. We show that a nonprocessed form of SgIII is produced and released by cortical astrocytes in primary cultures. In brain sections, SgIII transcripts and protein were found in neuronal populations and abundantly in cortical astrocytes. Moreover, SgIII expression was specifically upregulated in reactive astrocytes after perforating brain injury. These results show that SgIII is a reliable component of the astrocyte secretory pathway and suggest important roles for glial SgIII in the glia–neuron communication.

Materials and Methods

Antibodies and Reagents

Polyclonal antibodies against SgIII were purchased from Sigma–Aldrich (Deisenhofen, Germany) and Proteintech Group Inc. (Chicago, IL). SgII antibodies were kindly provided by Dr R. Fischer-Colbrie. Monoclonal antibodies against synaptosome-associated protein of 25 kDa (SNAP-25), glial fibrillary acidic protein (GFAP), neuronal nuclei (NeuN), carboxypeptidase E (CPE), FLAG, β-tubulin, and vimentin were obtained from Sternberg Monoclonals Inc. (Baltimore, MD), Chemicon (Temecula, CA), BD Transduction Laboratories (San Jose, CA), Sigma–Aldrich, and Developmental Studies Hybridoma Bank (Department of Biological Sciences, The University of Iowa, Iowa city, IA). Polyclonal antibody to Olig2 was from Chemicon. FLAG-tagged rat SgIII (1–471) cDNA was a gift of Dr M. Hosaka. Brefeldin A was obtained by Sigma–Aldrich and 8Br-cyclic adenosine 3′,5′-monophosphate (cAMP) was from Biolog Life Science Institute (Bremen, Germany). Most chemicals and cell culture reagents were from Sigma–Aldrich and GIBCO (Invitrogen, Paisley, UK), respectively.

Animals

OF1 mice were provided by Charles River Laboratories, Inc. (Lyon, France), and Sprague–Dawley rats were obtained from the Laboratory Animal Service of the University of Barcelona. Animals were anesthetized with ketamine (Ketolar, Parke-Davis, Barcelona, Spain) and xylazine (Rompun, Bayer Healthcare, Kiel, Germany). Stab wound lesions were made as described previously (Aguado et al. 2002). Under anesthesia, adult animals were fixed to a stereotactical frame, and the cerebral cortex was then stabbed with a #11 scalpel blade. The wounds were 3-mm long and 2-mm deep at 1.5 mm from and parallel to midline and ran 0.5 mm away from the Bregma over the right parietal cortex. To provoke secretory protein accumulation in neural bodies, colchicine was administrated intracerebroventricular (i.c.v.) (Aguado et al. 1999). Seventy-five microgram of colchicine in 10 μL of phosphate-buffered saline (PBS) was stereotaxically injected in the lateral ventricle of adult rats. Sham-operated controls only received 10 μL of PBS. Animals were kept under controlled temperature (22 ± 2 °C), humidity (40–60%), and light (12-h cycles) and treated in accordance with the European Community Council Directive (86/609/EEC) on animal welfare. Every effort was made to minimize animal suffering. In all in vivo experimental conditions, at least 4 animals were used per time-point.

Cell Cultures

The COS kidney epithelial cell line was grown in Dulbecco's Modified Eagle's Medium supplemented with 10% fetal bovine serum with penicillin/streptomycin at 37 °C in a 5% CO2 atmosphere. COS cell line was transfected with FLAG-SgIII using Lipofectamin 2000, and peptide expression was assayed 48 h later.

Astrocyte cultures were prepared from the cerebral cortex of 2-day-old mice as described previously (Paco et al. 2009). Briefly, the cerebral cortex was isolated, and the meninges were carefully dissected away. Cortical tissues were then minced and incubated in 0.25% trypsin and 0.01% DNase (Roche Diagnostics, Mannheim, Germany). Dissociated cells were seeded in flasks and grown in high-glucose Dulbecco's Modified Eagle's Medium, and F-12 (1:1) containing 10% fetal bovine serum, 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid and penicillin/streptomycin at 37 °C in a 5% CO2 incubator. At confluence (days 10–12), the flasks were shaken over night, and the cells were rinsed, detached, and subcultured at a density of 50 000 cells/cm2 on poly-L-lysine-coated plastic culture dishes and coverslips. Under these conditions, cell cultures were essentially formed by astrocytes (>92% GFAP+ cells) and virtually devoid of neurons (<0.5% Tuj-1+ cells). A small percentage of microglia and immature oligodendrocytes (<8% CD11b+ and NG2+ cells) was also detected (Paco et al. 2009). Long-term treatment with 8Br-cAMP did not change the cellular composition (Paco et al. 2009). Neuronal cultures were prepared from the cerebral cortex of E16 mouse embryos. After trypsin and DNase treatment, dissociated cells were seeded on poly-L-lysine-coated culture plates. Neurons were grown at a density of 50 000 cells/cm2 in Neurobasal medium containing B27 and N2 supplements, glutamine, and penicillin/streptomycin at 37 °C in a 5% CO2 atmosphere for 10 days. During the first 4 days in culture, the media were also supplemented with 20 μg/mL 5-fluoro-2′-deoxyuridine and 50 μg/mL uridine to inhibit the mitotic activity of glial cells. More than 99% of the cells were Tuj-1+ neurons and less than 1% of the cells were GFAP+ astrocytes (Paco et al. 2009). In all in vitro conditions, at least 3 independent experiments in duplicate were performed.

Reverse Transcriptase-Polymerase Chain Reaction

To perform polymerase chain reaction (PCR) experiments, total RNA was purified from the forebrain and from cultured astrocytes of mice using Trizol Reagent (Invitrogen) following the manufacturer's instructions. All RNA obtained was reverse transcribed using pdN6 (random hexamers) and AMV reverse transcriptase (Amersham Biosciences, GE Healthcare, Buckinghamshire, UK). Then, cDNAs were then amplified with specific primer pairs (5′–3′) for SgIII, forward CAATTCAAGCTTTCCCCAAA and reverse TTTCACTCGGCTTGCTTTCT (NM_009130); GFAP, forward TGCTAGCTACATCGAGAAGG and reverse TCCTCTGTCTCTTGCATGTT (NM_001131020.1); SNAP-25, forward CCTCCACTCTTGCTACCTGC and reverse CTCCTCTGCATCTCCTCCAG (NM_011428.3); and actin, forward ATATCGCTGCGCTGGTCGTC and reverse AGGATGGCGTGAGGGAGAGC (NM_007393.3). PCR products were analyzed on 1–2% agarose gels, and images were captured with a scanner.

Western Blotting

Cultured cells and tissues were homogenized in ice-cold lysis buffer containing 50 mM Tris–HCl pH 7.4, 150 mM NaCl, 5 mM MgCl2, 1 mM ethyleneglycol-bis(2-aminoethylether)-N,N,N',N'-tetra acetic acid, 1% Triton X-100, and protease inhibitor cocktail (Roche Diagnostics). Samples of postnuclear lysates were electrophoresed in 12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE; BioRad Laboratories, Hercules, CA) and then transferred to nitrocellulose membranes (Whatman Schleicher & Schuell, Keene, NH). The membranes were blocked in a solution containing 5% nonfat milk powder in tris-buffered saline tween-20 (140 mM NaCl, 10 mM Tris–HCl, pH 7.4, and 0.1% Tween 20) for 1 h at room temperature and then incubated with primary antibodies in blocking buffer for 2 h at room temperature. After several washes in blocking solution, the membranes were incubated for 1 h with horseradish peroxidase-conjugated secondary antibodies (VECTOR, Burlingame, CA). Bound antibodies were visualized with enhanced chemiluminescence reagents (GE Healthcare). Blot images were captured with a scanner.

Peptide Release

Astrocytes and neurons were seeded on poly-L-lysine-coated tissue culture dishes, to minimize cell loss. Before the release experiment, cells were serum starved. Brefeldin A 5 μg/mL was incubated with astrocytes for 12 h and with neurons for 4 h. After release, conditioned medium was collected, and lysis buffer was added to the cells (see above). Cell media were centrifuged at 600 g for 5 min to remove dislodged cells, and proteins were precipitated with 5% trichloroacetic acid. Secretory proteins were analyzed in both media and cells by SDS–PAGE and immunoblotting.

Immunocytochemistry

Cells grown on glass coverslips were washed in ice-cold PBS and fixed with 4% paraformaldehyde in PBS for 15 min. Animals were perfused transcardially under deep anesthesia with 4% paraformaldehyde in 0.1 M phosphate buffer (PB), pH 7.4. The brains were removed from the skulls, postfixed for 4 h in the same fixative solution, and cryoprotected overnight at 4 °C by immersion in a 30% sucrose solution in 0.1 M PB. Forty-micrometer thick frozen sections were obtained with a cryostat and collected in PBS. Sections processed for the peroxidase method were soaked for 30 min in PBS containing 10% methanol and 3% H2O2 and subsequently washed in PBS. To suppress nonspecific binding, cell cultures and brain sections were incubated in 10% serum–PBS containing 0.1% Triton X-100, 0.2% glycine, and 0.2% gelatin for 1 h at room temperature. Incubations with the primary antibodies were carried out overnight at 4 °C in PBS containing 1% fetal calf serum, 0.1% Triton X-100, and 0.2% gelatin. Some histological sections were processed using the avidin–biotin–peroxidase method (Vectastain ABC kit, VECTOR). The peroxidase complex was visualized by incubating the sections with 0.05% diaminobenzidine and 0.01% H2O2 in PBS. Sections were mounted, dehydrated, and coverslipped in Eukitt. Cell cultures and some brain sections were processed for immunofluorescence using secondary fluorochrome-conjugated antibodies (Alexa Fluor 488 and Alexa Fluor 568, Molecular Probes, Eugene, OR), and cell nuclei were stained with 4′,6-diamidino-2-phenylindole (Molecular Probes). Cell-containing coverslips and histological sections were mounted with Mowiol. The specificity of the immunostaining was tested by omitting the primary antibodies or by replacing them with an equivalent concentration of nonspecific IgG. No immunostaining was observed in these conditions. Bright field and fluorescent images were obtained with the Olympus fluorescent BX-61 and Leica TCS SPE scanning confocal microscopes.

Double immunolabeling using primary antibodies raised in the same species (SgIII and Olig-2) was performed by a sequential avidin–biotin–peroxidase method (Levey et al. 1986). The first immunostaining was performed as above. The second immunolabeling reaction was developed in a medium containing 0.01% benzidine dihydrochloride, 0.025% sodium nitroprusside (Merck, Darmstadt, Germany), and 0.005% H2O2 in PBS, pH 6. Double immunolabeling using primary antibodies raised in different species was performed by incubation with different fluorescent-conjugated secondary antibodies. Colocalization data are expressed as mean ± standard error of the mean of the colocalization percentage for at least 7 brain sections from 3 animals.

In Situ Hybridization

Nonradioactive hybridizations were performed on free-floating forebrain sections according to the method of Aguado et al. (2003). Briefly, 4% paraformaldehyde-perfused brains were cryoprotected in 30% sucrose, frozen, and coronally sectioned at 40 mm. Antisense, sense, and nonrelated probes were obtained by in vitro transcription of the rat SgIII and the mouse neuron-specific cotransporter KCC2 cDNAs in the presence of digoxigenin-UTP (Aguado et al. 2003; Han et al. 2008). Free-floating coronal sections were hybridized with RNA probes. After hybridization, sections were incubated with sheep polyclonal antidigoxigenin Fab fragments conjugated to alkaline phosphatase (Roche Diagnostics) and developed with a BCPI/NTB substrate. To reveal the strong SgIII mRNA expression in glial cells compared with neurons, hybridization reaction was limited. In some hybridized sections, SgIII, GFAP, and NeuN were subsequently detected by immunofluorescence. No signal was detected in control hybridizations performed with sense riboprobe, and a neuronal-restricted expression pattern was obtained with the KCC2 riboprobe.

Results

A Nonprocessed Form of SgIII Is Produced and Released by Cultured Astrocytes

To identify SgIII, we used 2 different polyclonal antibodies, HPA006880 and 10954-1-AP. We confirmed the specificity of the antibodies detecting FLAG-tagged SgIII expressed in COS cells by western blotting (Fig. 1). HPA006880 and FLAG antibodies recognized the same bands corresponding to SgIII in both cell lysates and media of transfected cultures (Fig. 1). No signal was found when the SgIII antibodies were incubated with mock-transfected COS cells (Fig. 1). Immunofluorescence staining revealed that transfected SgIII was sorted to cytoplasmic compartments (data not shown). Similar results were obtained with 10954-1-AP antibodies (data not shown).

Figure 1.

Identification of SgIII in COS cells by HPA006880 antibodies. (A) Cell lysates (10-μg protein) and the basal release into the media (over night) were analyzed from FLAG-SgIII transfected and mock COS cells by immunoblotting. HPA006880 SgIII antibodies accurately recognize the construct, as do the FLAG antibodies, only in transfected cells but not in mock cells. β-tubulin was used as a loading control. The mobility of molecular mass markers (in kDa) is indicated.

Figure 1.

Identification of SgIII in COS cells by HPA006880 antibodies. (A) Cell lysates (10-μg protein) and the basal release into the media (over night) were analyzed from FLAG-SgIII transfected and mock COS cells by immunoblotting. HPA006880 SgIII antibodies accurately recognize the construct, as do the FLAG antibodies, only in transfected cells but not in mock cells. β-tubulin was used as a loading control. The mobility of molecular mass markers (in kDa) is indicated.

We examined the expression of SgIII by astrocytes analyzing tissues and primary cell cultures. As previously reported (Ottiger et al. 1990), anterior pituitary was a major source of SgIII, whereas brain tissues showed moderate quantities of the granin (Fig. 2A). In endocrine tissues (Fig. 2A), both polyclonal antibodies against SgIII recognized the precursor, mature, and cleaved proteins (ranging from 70 to 20 kDa; Holthuis et al. 1996; Han et al. 2008). Precursor and mature SgIII (∼70 and 55 kDa bands) were also found in brain and cultured neurons, whereas a higher electrophoretic mobility band (∼75–80 kDa; Han et al. 2008) was occasionally detected in cultured neurons (Fig. 2A). SgIII was also observed in lysates of cultured astrocytes but at lower levels. Remarkably, the detected SgIII forms in glial cells corresponded with the largest size forms (Fig. 2A). Electrophoretic mobility of SgIII in cultured astrocytes was the same, irrespective of whether it was detected using either HPA006880 or 10954-1-AP antibodies (data not shown). We also compared SgIII content in cell cultures with another astroglial granin, SgII (Fischer-Colbrie et al. 1993). SgII was hardly detected and only revealed by increasing the amount of total protein loaded on gel (Fig. 2A). Finally, expression of SgIII by cultured astrocytes was further confirmed by reverse transcriptase-polymerase chain reaction (Fig. 2B). These data demonstrate that SgIII is expressed by cultured astrocytes.

Figure 2.

SgIII protein and mRNA expression in cultured astrocytes. (A) A total of 20-μg protein samples from pituitary, forebrain and cultured neurons, and astrocytes were analyzed by immunoblotting for the presence of SgIII and SgII. The astroglial and neuronal markers GFAP and SNAP-25, respectively, were used to monitor the purity of the primary cultures. β-tubulin was used as a loading control. The mobility of molecular mass markers (in kDa) is indicated. (B) Reverse transcriptase-polymerase chain reaction analysis of SgIII in forebrain and in cultured astrocytes. Astrocyte culture purity was confirmed by GFAP and SNAP-25 mRNA amplification. Actin was a loading control. Size of amplification products (in bp) is indicated.

Figure 2.

SgIII protein and mRNA expression in cultured astrocytes. (A) A total of 20-μg protein samples from pituitary, forebrain and cultured neurons, and astrocytes were analyzed by immunoblotting for the presence of SgIII and SgII. The astroglial and neuronal markers GFAP and SNAP-25, respectively, were used to monitor the purity of the primary cultures. β-tubulin was used as a loading control. The mobility of molecular mass markers (in kDa) is indicated. (B) Reverse transcriptase-polymerase chain reaction analysis of SgIII in forebrain and in cultured astrocytes. Astrocyte culture purity was confirmed by GFAP and SNAP-25 mRNA amplification. Actin was a loading control. Size of amplification products (in bp) is indicated.

Next, we analyzed SgIII trafficking and release from cultured astrocytes. SgIII was abundant in the culture medium of astrocytes (as early as 30 min after release) but scarce in cell lysates (Fig. 3A). A double band corresponding to nonprocessed precursor forms was generally observed in astrocyte culture media and cell lysates (Fig. 3A). In agreement with the secretory pathway involved, SgIII released from astrocytes was markedly reduced after administration of Brefeldin A, a drug that blocks secretion by inhibiting transport from endoplasmatic reticulum to the Golgi (Fig. 3A). In contrast, Brefeldin A treatment dramatically increased the SgIII content in cell lysates (Fig. 3A). Immunofluorescence labeling showed the retention of de novo synthetized SgIII in secretory compartments of astrocytes during Brefeldin A treatment (Fig. 3B). Moreover, the granin accumulation in GFAP-positive cells after Brefeldin A treatment further confirmed the SgIII expression by astroglial cells. In contrast to astrocytes, basal secretion of SgIII was extremely low in neurons (Fig. 3A). Moreover, Brefeldin A incubation in neuronal cultures increased the content of the precursor SgIII form, indicating that SgIII retention in early secretory compartments prevents its proteolytic processing in neurons (Fig. 3A). Because it has been proposed that SgIII exerts a role in peptide sorting thought its interaction with CPE and astrocytes do synthesize CPE (Vilijn et al. 1989; Hosaka et al. 2005), we compared release of SgIII with CPE from astroglial cells. Brefeldin A-sensitive secretion of glial CPE was very similar to that observed for SgIII, displaying high rates of basal release (Fig. 3A). We conclude that SgIII is produced by cultured astrocytes as a nonprocessed form which is poorly stored and mostly secreted into the media concurrently with CPE.

Figure 3.

Trafficking and release of SgIII in cultured astrocytes. (A) Immunoblots illustrating basal SgIII and CPE secretion from astrocyte and neuron cultures treated or not with 5 μg/mL Brefeldin A. Drug administration and release were 12 h for astrocytes and 4 h for neurons. Each lane represents a fraction of the culture media and 10 μg of total protein of cell lysates from individual culture plates. (B). Confocal images of SgIII immunofluorescence in identified astrocytes (GFAP+) treated or not with Brefeldin A. Note the Brefeldin A-induced accumulation of SgIII in perinuclear compartments. Scale bar: 1 μm.

Figure 3.

Trafficking and release of SgIII in cultured astrocytes. (A) Immunoblots illustrating basal SgIII and CPE secretion from astrocyte and neuron cultures treated or not with 5 μg/mL Brefeldin A. Drug administration and release were 12 h for astrocytes and 4 h for neurons. Each lane represents a fraction of the culture media and 10 μg of total protein of cell lysates from individual culture plates. (B). Confocal images of SgIII immunofluorescence in identified astrocytes (GFAP+) treated or not with Brefeldin A. Note the Brefeldin A-induced accumulation of SgIII in perinuclear compartments. Scale bar: 1 μm.

It has been shown that granin synthesis can respond differently in different cell types to a variety of signaling pathways, including cAMP (Taupenot et al. 2003). To examine whether the content of SgIII in cultured astrocytes is regulated differentially to other glial granins, cell cultures were treated with the permeable cAMP analog 8Br-cAMP (1 mM) for 8 days, and levels of SgIII and SgII were analyzed. Long-term cAMP elevation in astrocytes upregulated SgII in both culture media and cell lysates (Fig. 4). This regulation is consistent with the presence of a functional cAMP response element in the SgII promoter (Taupenot et al. 2003). In contrast, released SgIII was reduced by 8Br-cAMP administration (Fig. 4). No apparent changes were detected in cell lysates (Fig. 4). These results show that SgIII and SgII are differentially regulated in astrocyte by the cAMP signaling pathway.

Figure 4.

Differential regulation of SgIII and SgII by cAMP in cultured astrocytes. Representative immunoblotting of basal release (12 h) and cellular content (10 μg of total protein) of SgIII and SgII in untreated and 8Br-cAMP–treated cultured astrocytes. Each lane corresponds to one individual culture plate. β-tubulin is used as a loading control.

Figure 4.

Differential regulation of SgIII and SgII by cAMP in cultured astrocytes. Representative immunoblotting of basal release (12 h) and cellular content (10 μg of total protein) of SgIII and SgII in untreated and 8Br-cAMP–treated cultured astrocytes. Each lane corresponds to one individual culture plate. β-tubulin is used as a loading control.

Cortical Astrocytes Robustly Express SgIII In Vivo

To analyze expression of SgIII by astrocytes in vivo, we combined immunohistochemistry with nonradioactive in situ hybridization on tissue sections. The strongest SgIII immunostaining was detected in endocrine cell subsets of the anterior pituitary and neurosecretory areas of the brain (Fig. 5A,B). Endocrine pituitary cells showed granular staining throughout the cytoplasm (Fig. 5A), whereas SgIII signal in hypothalamic areas was mainly associated with neuronal fibers (Fig. 5B). The immunostaining for SgIII in neuroendocrine areas was consistently correlated with an mRNA hybridization signal (Fig. 5B,C). In addition to neuroendocrine nuclei, varicose axons, punctate structures, and neuronal cell bodies were immunolabeled for SgIII in most forebrain areas (data not shown). Although many neuronal somata displayed SgIII mRNA hybridization signal, SgIII immunolabeling was weak in neuronal cell bodies (Fig. 5D,E). We examined whether synthesized neuronal SgIII is transported along axons by arresting the axonal transport with colchicine. Although the microtubule disruption colchicine may alter gene expression, protein accumulation in the neuronal bodies and the initial axonal segment by i.c.v. administration is considered the consequence of a transport arresting (Cortés et al. 1990; Aguado et al. 1999). In colchicine-treated brains, SgIII immunolabeling was found accumulated in neuronal bodies in different areas, as shown in the cerebral cortex (Fig. 5E,F). Specifically, strong SgIII immunostaining was detected in dilated proximal axons of large-projection neurons (Fig. 5F). Accordingly with the high levels of SgIII mRNA in neuroendocrine cells, the colchicine-induced SgIII increase in neuronal somata was outstandingly prominent in hypothalamic neurons (Fig. 5G,H). These data show that SgIII is expressed and transported along axons in forebrain neurons.

Figure 5.

In vivo expression and transport of SgIII in neurons and neuroendocrine cells. (A) Cytoplasmic granular immunostaining for SgIII in endocrine cells of the anterior pituitary. Asterisk indicates a blood vessel. (B, C) SgIII immunolabeling (B) and in situ hybridization (C) in the hypothalamic paraventricular nucleus. (D) SgIII mRNA detection in layer V neurons of the somatosensory cortex (arrowheads). (E, F) SgIII immunostaining of layer V pyramidal neurons in untreated (E) and colchicine-treated (F) somatosensory cortex. Arrowheads point to axon hillocks. Note the intense SgIII immunoreactivity accumulated in enlarged axonal fiber and neuronal soma from treated animals. (G, H) Hypothalamic supraoptic nuclei showing SgIII immunolabeling in untreated (G) and colchicine-treated (H) animals. Abbreviations: III, third ventricle; ox, optic chiasm. Scale bar: (A, D–F), 20 μm; (B, C, G, H), 50 μm.

Figure 5.

In vivo expression and transport of SgIII in neurons and neuroendocrine cells. (A) Cytoplasmic granular immunostaining for SgIII in endocrine cells of the anterior pituitary. Asterisk indicates a blood vessel. (B, C) SgIII immunolabeling (B) and in situ hybridization (C) in the hypothalamic paraventricular nucleus. (D) SgIII mRNA detection in layer V neurons of the somatosensory cortex (arrowheads). (E, F) SgIII immunostaining of layer V pyramidal neurons in untreated (E) and colchicine-treated (F) somatosensory cortex. Arrowheads point to axon hillocks. Note the intense SgIII immunoreactivity accumulated in enlarged axonal fiber and neuronal soma from treated animals. (G, H) Hypothalamic supraoptic nuclei showing SgIII immunolabeling in untreated (G) and colchicine-treated (H) animals. Abbreviations: III, third ventricle; ox, optic chiasm. Scale bar: (A, D–F), 20 μm; (B, C, G, H), 50 μm.

In addition to neurons, a prominent SgIII immunolabeling was observed in cell bodies and thin processes of nonneuronal star-shaped cells in the forebrain (Fig. 6A,B). SgIII stained astroglial-like cells were consistently observed throughout different layers of the cerebral cortex (i.e., neocortex and hippocampus), mainly in the upper layers (Fig. 6A,B). Other areas of the forebrain and mid- and hindbrain also displayed non neuronal Sg-III positive cells (Supplementary Figure S1). Some star-shaped cells showing a faint SgIII labeling were detected in myelinated tracts, such as corpus callosum, fimbria, and the optic nerve (Fig. 6C). Strong labeling for SgIII was detected in Bergmann glial cell bodies located in the Purkinje cell layer of the cerebellum and their radial processes to the pial surface (Fig. 6D). Double labeling with SgIII and the marker Olig2 indicated that oligodendrocytes did not contain this granin (Fig. 6E). In contrast, we found a widespread colocalization of SgIII with the astrocyte marker GFAP (Fig. 7). For instance, about 96% of SgIII-labeled nonneuronal cells in the piriform cortex (96.71 ± 0.96%) and hippocampus (97.12 ± 0.95%) were GFAP+ (Fig. 7). Characteristically, other GFAP structures, such as cell bodies in the white matter and astrocytic end-feet surrounding blood vessels and the glia limitans displayed weak or absent SgIII immunostaining (Fig. 7). High magnification images performed by confocal microscopy showed that SgIII labeling in astrocytes was typically found as scattered punctate staining in cell bodies and processes (Fig. 7). Parallel double immunofluorescence staining was performed with antibodies against SgII. However, no signal for SgII was detected in GFAP+ structures (data not shown). These results show that SgIII is a distinctive granin of astrocytes in situ.

Figure 6.

Glial cells display SgIII protein in vivo. (A, B) SgIII immunostaining in astrocyte-like cells located in layer I, II, III, and V of the somatosensory cortex (A) and the CA1 region of the hippocampus (B). Black arrowheads and arrows point to glial cells and neurons, respectively. Note the strong labeling in glial cells compared with neurons. (C) Glial cells immunoreactive for SgIII in the optic nerve (C) and corpus callosum (inset). Asterisks indicate a blood vessel. (D) SgIII immunostaining in Bergmann cells and their radial processes (white arrows) in the cerebellum. (E) Double immunostaining against SgIII (brown) and Olig-2 (blue) in upper layers of the somatosensory cortex showing the lack of SgIII in oligodendrocytes. Abbreviations: gl, granular layer; ml, molecular layer; Pl, Purkinje cell layer; so, stratum oriens; sp, stratum pyramidale; sr, stratum radiatum. Scale bar: (A, B, D), 50 μm; (C), 10 μm; (E), 5 μm.

Figure 6.

Glial cells display SgIII protein in vivo. (A, B) SgIII immunostaining in astrocyte-like cells located in layer I, II, III, and V of the somatosensory cortex (A) and the CA1 region of the hippocampus (B). Black arrowheads and arrows point to glial cells and neurons, respectively. Note the strong labeling in glial cells compared with neurons. (C) Glial cells immunoreactive for SgIII in the optic nerve (C) and corpus callosum (inset). Asterisks indicate a blood vessel. (D) SgIII immunostaining in Bergmann cells and their radial processes (white arrows) in the cerebellum. (E) Double immunostaining against SgIII (brown) and Olig-2 (blue) in upper layers of the somatosensory cortex showing the lack of SgIII in oligodendrocytes. Abbreviations: gl, granular layer; ml, molecular layer; Pl, Purkinje cell layer; so, stratum oriens; sp, stratum pyramidale; sr, stratum radiatum. Scale bar: (A, B, D), 50 μm; (C), 10 μm; (E), 5 μm.

Figure 7.

Astrocytes in situ express SgIII protein. Confocal images illustrating double immunofluorescence of SgIII and GFAP in the somatosensory and piriform cortex (upper layers) and in the CA3 region of the hippocampus (stratum radiatum). Arrowheads and arrows point to glial cells and neurons, respectively. Note the high degree of colocalization between SgIII and GFAP in astrocytes. The images of the neocortex show the low SgIII immunostaining in astrocyte processes surrounding capillaries (asterisk) and the glia limitants. Abbreviation: m, meninge. Scale bar: 20 μm.

Figure 7.

Astrocytes in situ express SgIII protein. Confocal images illustrating double immunofluorescence of SgIII and GFAP in the somatosensory and piriform cortex (upper layers) and in the CA3 region of the hippocampus (stratum radiatum). Arrowheads and arrows point to glial cells and neurons, respectively. Note the high degree of colocalization between SgIII and GFAP in astrocytes. The images of the neocortex show the low SgIII immunostaining in astrocyte processes surrounding capillaries (asterisk) and the glia limitants. Abbreviation: m, meninge. Scale bar: 20 μm.

Next, expression of SgIII by astrocytes was further investigated by analyzing SgIII transcripts in brain sections. Examination of forebrain showed that the strongest SgIII hybridization signal corresponded to nonneuronal cells (Fig. 8). The SgIII mRNA expression pattern in nonneuronal cells was similar to that observed for SgIII protein. Thus, glial cells displaying SgIII mRNA transcripts were mainly detected in the cerebral cortex and to a lesser extend in other forebrain regions (Fig. 8A–D). Nonneuronal cells expressing high SgIII mRNA levels were distributed throughout the different layers of cortical areas, that is, neocortex and hippocampus (Fig. 8A–D). Hybridization signal was detected as a thin punctate in the processes and somata of glial cells (Fig. 6A,D). Astrocytic identity of glial SgIII expressing cells was demonstrated by double labeling with the marker GFAP in each region analyzed (Fig. 8D,E). Moreover, location of SgIII mRNA and protein in the same glial cells further substantiates the SgIII synthesis in astrocytes (Fig. 8F,H). Taken together, these data show that SgIII is robustly expressed by astrocytes in vivo.

Figure 8.

SgIII mRNA transcripts in astrocytes in situ. (A–C) SgIII mRNA hybridization signal in astrocytes (arrowheads) of the CA1 region of the hippocampus (A) and the upper layers of the somatosensory (B) and piriform (C) cortices. (D, E) Triple labeling of SgIII mRNA (blue precipitate, D), GFAP (red, E), and NeuN (green, E) illustrating the transcriptional expression of SgIII in astroglial cells (arrowheads). (F–H) Images showing SgIII mRNA (F) and protein (G) colocalization in the same cells. The composition in (H) merges SgIII mRNA (blue precipitate) and protein (red) labeling and 4′,6-diamidino-2-phenylindole staining for cell nuclei (green). Abbreviations: gl, granular layer; ml, molecular layer; so, stratum oriens; sp, stratum pyramidale; sr, stratum radiatum. Scale bar: (A, C), 20 μm; (B), 50 μm; (D–H), 10 μm.

Figure 8.

SgIII mRNA transcripts in astrocytes in situ. (A–C) SgIII mRNA hybridization signal in astrocytes (arrowheads) of the CA1 region of the hippocampus (A) and the upper layers of the somatosensory (B) and piriform (C) cortices. (D, E) Triple labeling of SgIII mRNA (blue precipitate, D), GFAP (red, E), and NeuN (green, E) illustrating the transcriptional expression of SgIII in astroglial cells (arrowheads). (F–H) Images showing SgIII mRNA (F) and protein (G) colocalization in the same cells. The composition in (H) merges SgIII mRNA (blue precipitate) and protein (red) labeling and 4′,6-diamidino-2-phenylindole staining for cell nuclei (green). Abbreviations: gl, granular layer; ml, molecular layer; so, stratum oriens; sp, stratum pyramidale; sr, stratum radiatum. Scale bar: (A, C), 20 μm; (B), 50 μm; (D–H), 10 μm.

Injury-Induced Reactive Astrocytes Upregulate SgIII Gene Expression

The functional role of granins in glial cells is unknown. To investigate potential roles of SgIII in astrocyte in vivo, we analyzed regulation of SgIII expression in the injured brain. In response to CNS insults, astrocytes become reactive and exert important roles in repair and damage of neuronal circuits (Sofroniew 2005). We examined responses of SgIII protein and mRNA expression in a model of traumatic brain injury induced by stab wounds (Mathewson and Berry 1985).

SgIII protein was examined in sections from brains obtained 2, 5, and 9 days postinjury. We observed an increase of SgIII immunoreactivity in the vicinity of the wound site in the injured hemisphere (Fig. 9A). This enhancement was noticed after 2 days and peaked at 9 days postinjury (data not shown). Upregulation of SgIII was restricted to hypertrophied astroglial-shaped cells (Fig. 9C,E). Glial SgIII labeling was strongest around the lesion and declined in intensity in proportion to the distance from the wound (Fig. 9A). The highest levels of wound-induced SgIII expression were located throughout the hippocampus, as well as in the white matter tracts, corpus callosum, and fornix (Fig. 9D,E). SgIII also increased in astroglia in the injured neocortex but to a lesser extent (Fig. 9B,C). Patterns of SgIII staining in the noninjured hemisphere resembled those observed in the sham-injured brain (Fig. 9B,D). However, in some cases, glial cells exhibiting upregulated levels of SgIII were observed in the hippocampus and white matter contralateral to the lesion (data not shown). A 95.8 ± 0.72% of the cells showing stabbing-induced upregulation of SgIII were also costained with GFAP (Fig. 9H–J). Astrocytes showing SgIII overexpression in the vicinity of the wound exhibited the main characteristics of reactive cells, such as enhanced content of GFAP, hypertrophy, and thickened processes (Fig. 9H). Reactive distinctiveness of astrocytes was more obvious in the hippocampus and white matter tract than in the neocortex (data not shown). To further confirm the activated state of SgIII+ glial cells, we performed double labeling with the reactive astrocyte marker vimentin. Astrocytes exhibiting upregulated levels of SgIII in the vicinity of the wound site were strongly immunostained for vimentin (Fig. 9G). In contrast, vimentin immunofluorescence was absent in normal SgIII+ astrocytes in the contralateral hemisphere (Fig. 9F). For comparative purposes, we examined immunostaining for SgII in damaged sections. In the hippocampus and neocortex, SgII staining was associated with varicose fibers and neuronal cell bodies but consistently not with GFAP+ astrocytes (Fig. 9K–M). We conclude that perforating brain injury differentially upregulates SgIII content in activated astrocytes.

Figure 9.

Increased SgIII protein in astrocytes after brain injury. (A–E) SgIII immunostaining in the cerebral cortex 5 days after a stab wound injury. Low-magnification image of a SgIII-immunolabeled brain section in the ipsilateral hemispheres to the lesion. Asterisk marks the wound (A). Representative glial cells displaying SgIII immunoreactivity in the contralateral (B, D) and ipsilateral (C, E) neocortex (B, C), and CA1 region of the hippocampus (D, E). (F, G) Confocal images illustrating double immunofluorescence of SgIII and vimentin in the stratum oriens of the control (F) and injured (G) hippocampus. Note the lack of vimetin immunolabeling in control SgIII-containing astrocytes. In contrast, reactive SgIII+ astrocytes in the injured side display a strong immunolabeling for vimentin, a hypertrophied morphology. (H–J) Double immunolabeling of SgIII (H), GFAP (I), and the colocalization in the same cells (J) in the CA1 region of the injured hippocampus. (K–M) Immunofluorescences for SgII (K), GFAP (L), and the merge (M) in the damaged CA1 hippocampal region. Note the lack of colocalization (M). Arrowheads and arrows point to glial cells and neurons, respectively. Abbreviations: CA1 and CA3, hippocampal regions; CC, corpus callosum; DG, dentate gyrus; NC, neocortex; so, stratum oriens; and sp, stratum pyramidale. Scale bars: (A), 200 μm; (B–M), 20 μm.

Figure 9.

Increased SgIII protein in astrocytes after brain injury. (A–E) SgIII immunostaining in the cerebral cortex 5 days after a stab wound injury. Low-magnification image of a SgIII-immunolabeled brain section in the ipsilateral hemispheres to the lesion. Asterisk marks the wound (A). Representative glial cells displaying SgIII immunoreactivity in the contralateral (B, D) and ipsilateral (C, E) neocortex (B, C), and CA1 region of the hippocampus (D, E). (F, G) Confocal images illustrating double immunofluorescence of SgIII and vimentin in the stratum oriens of the control (F) and injured (G) hippocampus. Note the lack of vimetin immunolabeling in control SgIII-containing astrocytes. In contrast, reactive SgIII+ astrocytes in the injured side display a strong immunolabeling for vimentin, a hypertrophied morphology. (H–J) Double immunolabeling of SgIII (H), GFAP (I), and the colocalization in the same cells (J) in the CA1 region of the injured hippocampus. (K–M) Immunofluorescences for SgII (K), GFAP (L), and the merge (M) in the damaged CA1 hippocampal region. Note the lack of colocalization (M). Arrowheads and arrows point to glial cells and neurons, respectively. Abbreviations: CA1 and CA3, hippocampal regions; CC, corpus callosum; DG, dentate gyrus; NC, neocortex; so, stratum oriens; and sp, stratum pyramidale. Scale bars: (A), 200 μm; (B–M), 20 μm.

To assess whether brain stabbing regulates SgIII expression at the mRNA level, we analyzed SgIII transcripts in brains obtained 2 and 4 days postinjury. Although upregulation changes in astrocyte SgIII transcripts were detected in the ipsilateral hemisphere 2 days after brain stabbing, a dramatic increase of SgIII mRNA hybridization signal was observed 4 days postinjury (Fig. 10A). Changes of glial SgIII mRNA levels in wounded brains mirrored those found for the protein. Thus, we detected an SgIII mRNA overexpression in glial cells around the insult (Fig. 10A). Glial cells showing the most intense SgIII hybridization signal were distributed throughout the hippocampus, corpus callosum, and the neocortex (Fig. 10A–C). Increased levels of SgIII transcripts in glial cells were maximal in the vicinity of the wound and decreased with the distance from the lesion (Fig. 10A). Conversely, SgIII mRNA expression was slightly decreased in neuronal cell bodies adjacent to the lesion (Fig. 10B,C). As expected from the parallel expression changes of SgIII protein and mRNA in glial cells of the damaged hemisphere, upregulated SgIII transcripts and protein were colocalized in 98.92 ± 0.39% of glial cells. Furthermore, GFAP immunostaining of SgIII-hybridized sections from wounded brains revealed that almost all (98.91 ± 0.33%) of the glial cells exhibiting SgIII upregulation were astrocytes (Fig. 10D–F). Taken together, these results show that brain injury markedly induces SgIII gene expression in reactive astrocytes.

Figure 10.

SgIII mRNA is overexpressed in activated astrocytes in the damaged brain. (AC) SgIII hybridization signal in the cerebral cortex after a stab wound injury. Low-magnification image comparing SgIII mRNA expression in the contralateral and ipsilateral hemispheres to the lesion. Asterisk marks the wound (A). Higher magnifications of the square areas indicated in (A) showing astrocyte SgIII overexpression in the damaged hippocampus (B, C). (D–F) Triple labeling of SgIII mRNA (blue precipitate, D), GFAP (red, E), and NeuN (green, F) illustrating the transcriptional overexpression of SgIII in reactive astroglial cells (arrowheads). The composition in (F) merges the 3 labelings in the same image. Note the low SgIII expression in neurons, compared with glial cells. Abbreviations: CA1 and CA3, hippocampal regions; CC, corpus callosum; DG, dentate gyrus; fi, fimbria; H, habenula; NC, neocortex; so, stratum oriens; sp, stratum pyramidale; sr, stratum radiatum; and TH, thalamus. Scale bars: (A–C), 100 μm; (D–F), 20 μm.

Figure 10.

SgIII mRNA is overexpressed in activated astrocytes in the damaged brain. (AC) SgIII hybridization signal in the cerebral cortex after a stab wound injury. Low-magnification image comparing SgIII mRNA expression in the contralateral and ipsilateral hemispheres to the lesion. Asterisk marks the wound (A). Higher magnifications of the square areas indicated in (A) showing astrocyte SgIII overexpression in the damaged hippocampus (B, C). (D–F) Triple labeling of SgIII mRNA (blue precipitate, D), GFAP (red, E), and NeuN (green, F) illustrating the transcriptional overexpression of SgIII in reactive astroglial cells (arrowheads). The composition in (F) merges the 3 labelings in the same image. Note the low SgIII expression in neurons, compared with glial cells. Abbreviations: CA1 and CA3, hippocampal regions; CC, corpus callosum; DG, dentate gyrus; fi, fimbria; H, habenula; NC, neocortex; so, stratum oriens; sp, stratum pyramidale; sr, stratum radiatum; and TH, thalamus. Scale bars: (A–C), 100 μm; (D–F), 20 μm.

Discussion

In the present study, we show the expression, transcriptional regulation, trafficking, and release of the secretory pathway component SgIII in astroglial cells. Originally, SgIII was identified in CNS neurons and pituitary endocrine cells (Ottiger et al. 1990). More recent reports have analyzed the SgIII expression and function in different secretory cells, but the study of this granin in the brain has been poorly reported (Holthuis et al. 1996; Hosaka et al. 2002; Coppinger et al. 2004; Han et al. 2008; Prasad et al. 2008). We show here that SgIII is synthesized and transported along axons in many neuronal populations, especially in neuroendocrine nuclei and inner layers of the cerebral cortex. In addition to neurons, we reveal that high levels of SgIII mRNA and protein are expressed by astrocytes. These results are consistent with the in situ hybridization data provided by the Allen Brain Atlas indicating that SgIII mRNA is targeted in neurons and glial cells (Lein et al. 2007). By double-labeling analysis, we show that nonneuronal SgIII expression is restricted to astroglial cell populations and that the intensity of such expression varies. Thus, SgIII expression was high in cortical astrocytes and Bergmann glia but low in astrocytes located in white matter tracts. Typical components of the neurotransmitter secretory pathway, such as vesicular transporters and sorting/aggregation and trafficking/exocytic proteins have been shown in astroglial cells (Montana et al. 2006). However, most of these studies were performed on cultured or freshly isolated cells, whereas expression of the secretory pathway machinery in glial cells in situ is largely unknown. Our results implicate SgIII in the astroglial secretory pathway in vivo.

Regulation of the classical granins has been extensively analyzed in the brain under different conditions (Winkler and Fischer-Colbrie 1992; Fischer-Colbrie et al. 1995). CgA, CgB, and SgII/secretoneurin are distinctively regulated in neuronal subpopulations after brain insults but not in nonneuronal cells (Martí et al. 2001; Pirker et al. 2001). To our knowledge, the present study is the first to provide evidence of transcriptional control of a granin in glial cells in vivo. Both SgIII mRNA and protein levels were dramatically increased in reactive astrocytes after traumatic brain injury. Moreover, our in vitro and in vivo observations on SgIII and SgII indicate that granin expression in glial cells is differentially controlled. Coordinated regulation of SgIII and the hormone precursor proopiomelanocortin has been shown in Xenopus intermediate pituitary during color adaptation (Holthuis and Martens 1996). Based on this parallel transcriptional control, an active role of SgIII in the production and release of secretory peptides was initially suggested (Holthuis and Martens 1996). Reactive astrocytes, induced by different brain insults, overexpress a variety of secreted peptides (Ridet et al. 1997). For instance, expression of peptide hormones, growth factors, and cytokines, such as adrenomedullin, endothelin, normal growth factor, IL-6, and tumor necrosis factor α are upregulated in reactive astrocytes (Nie and Olsson 1996; Goss et al. 1998; Acarin et al. 2000; Jahnke et al. 2001). Therefore, we hypothesize an important functional involvement of SgIII in peptide trafficking in activated astrocytes in vivo.

We show here that the SgIII found in and released from astrocytes is larger than that detected in endocrine cells and neurons. A similar noncleaved form of SgIII has recently been identified in PC12 cells and adrenal glands (Han et al. 2008). Because the SgIII prohormone convertases PC1/3 and PC2 have not been detected in astrocytes (Winsky-Sommerer et al. 2000), glial cells may contain and release the unprocessed SgIII. In agreement, the prohormone convertase substrates SgII and proenkephalin were primarily detected as uncleaved forms in astrocytes (Batter et al. 1991; Fischer-Colbrie et al. 1993). Whether the noncleaved form of SgIII exerts a distinctive functional role or is processed extracellularly in vivo to peptides remains to be elucidated.

SgIII and its interacting protein CPE are essential sorting receptors for peptide hormones (Takeuchi and Hosaka 2008). Through its high cholesterol–binding domain, SgIII sorts adrenomedullin and proopiomelanocortin to the secretory granules (Hosaka et al. 2004; Han et al. 2008). Because astrocytes are equipped with molecular components of the secretory granules and can release peptide hormones in a Ca2+-dependent manner (Vilijn et al. 1989; Batter et al. 1991; Takahashi et al. 2000; Krzan et al. 2003; Ramamoorthy and Whim 2008; Paco et al. 2009), a function for SgIII in the regulated secretory pathway of glial cells is expected. However, the low cellular content of SgIII, together with its abundance in cell media, indicates that synthesized SgIII is poorly stored and promptly released from cultured astrocytes. Several mechanisms may explain the Ca2+-dependent release of peptides, accompanied by low SgIII retention in astrocytes. First, it has been demonstrated that a small quantity of SgIII is enough to sort a large number of peptides to secretory granules in PC12 cells (Han et al. 2008). CgA is considered a key aggregating factor involved in the biogenesis of secretory granules, which interacts with SgIII (Kim et al. 2001; Hosaka et al. 2002; Prasad et al. 2008). Thus, low expression of CgA in astrocytes could reflect the limited storage/aggregation of SgIII in glial cells (Majdoubi et al. 1996; Woulfe et al. 1999). Moreover, astrocytes display higher basal secretion and lower stimulus-triggered release of granule peptides than “professional” secretory cells (Fischer-Colbrie et al. 1993; Calegari et al. 1999; Paco et al. 2009). Finally, because astrocytes grown in culture do not accurately reflect their attributes in vivo, storage of peptides in astroglial cells may be higher in vivo than in culture. The present results and a recent microarray analysis show that SgIII mRNA expression and protein content in astrocytes are higher in vivo than in vitro (Cahoy et al. 2008; this study).

In addition to their intracellular functions, intact granins and their proteolytic-derived peptides exert important roles in cell-to-cell signaling, including homeostatic processes, inflammatory reactions, and the innate immunity (Helle 2004). For instance, CgA and the SgII fragment secretoneurin are potent microglia activators and chemotactic and angiogenic factors, respectively (Taupenot et al. 1996; Fischer-Colbrie et al. 2005). Our data clearly show that SgIII gene expression is upregulated in activated astroglia after perforating brain damage. We propose an extracellular role for glia-released SgIII in damage/repair of neuronal circuits after brain injury.

In summary, this study demonstrates that cortical astrocytes synthesize and release the secretory pathway component SgIII. Moreover, the robust expression of SgIII in astrocytes in vivo and its regulation in the damaged brain suggest important intracellular and/or extracellular roles for this granin in the glia–neuron communication.

Supplementary Material

Supplementary material can be found at: http://www.cercor.oxfordjournals.org/

Funding

Spanish Ministry of Education and Science Grants (BFU-2004-01154 and BFU2007-67889 to F.A.) and Carlos III Health Institute (PI070917 to E.P.).

We are grateful to Drs M. Hosaka (Gunma University) and R. Fisher-Colbrie (Innsbruck University) for FLAG-SgIII construct and SgII antibody, respectively; Dr E. Soriano (University of Barcelona) for helpful discussions; and Robin Rycroft for editorial assistance. Antibodies to β-tubulin were obtained from the Developmental Studies Hybridoma Bank at the University of Iowa. Conflict of Interest: None declared.

References

Acarin
L
González
B
Castellano
B
Neuronal, astroglial and microglial cytokine expression after an excitotoxic lesion in the immature rat brain
Eur J Neurosci
 , 
2000
, vol. 
12
 (pg. 
3505
-
3520
)
Aguado
F
Carmona
MA
Pozas
E
Aguiló
A
Martínez-Guijarro
FJ
Alcantara
S
Borrell
V
Yuste
R
Ibañez
CF
Soriano
E
BDNF regulates spontaneous correlated activity at early developmental stages by increasing synaptogenesis and expression of the K+/Cl- co-transporter KCC2
Development
 , 
2003
, vol. 
130
 (pg. 
1267
-
1280
)
Aguado
F
Espinosa-Parrilla
JF
Carmona
MA
Soriano
E
Neuronal activity regulates correlated network properties of spontaneous calcium transients in astrocytes in situ
J Neurosci
 , 
2002
, vol. 
22
 (pg. 
9430
-
9444
)
Aguado
F
Pozas
E
Blasi
J
Colchicine administration in the rat central nervous system induces SNAP-25 expression
Neuroscience
 , 
1999
, vol. 
93
 (pg. 
275
-
283
)
Allan
SM
Rothwell
NJ
Cytokines and acute neurodegeneration
Nat Rev Neurosci
 , 
2001
, vol. 
2
 (pg. 
734
-
744
)
Araque
A
Carmignoto
G
Haydon
PG
Dynamic signaling between astrocytes and neurons
Annu Rev Physiol
 , 
2001
, vol. 
63
 (pg. 
795
-
813
)
Batter
DK
Vilijn
MH
Kessler
J
Cultured astrocytes release proenkephalin
Brain Res
 , 
1991
, vol. 
563
 (pg. 
28
-
32
)
Bezzi
P
Gundersen
V
Galbete
JL
Seifert
G
Steinhäuser
C
Pilati
E
Volterra
A
Astrocytes contain a vesicular compartment that is competent for regulated exocytosis of glutamate
Nat Neurosci
 , 
2004
, vol. 
7
 (pg. 
613
-
620
)
Cahoy
JD
Emery
B
Kaushal
A
Foo
LC
Zamanian
JL
Christopherson
KS
Xing
Y
Lubischer
JL
Krieg
PA
Krupenko
SA
, et al.  . 
A transcriptome database for astrocytes, neurons, and oligodendrocytes: a new resource for understanding brain development and function
J Neurosci
 , 
2008
, vol. 
28
 (pg. 
264
-
278
)
Calegari
F
Coco
S
Taverna
E
Bassetti
M
Verderio
C
Corradi
N
Matteoli
M
Rosa
P
A regulated secretory pathway in cultured hippocampal astrocytes
J Biol Chem
 , 
1999
, vol. 
274
 (pg. 
22539
-
22547
)
Christopherson
KS
Ullian
EM
Stokes
CC
Mullowney
CE
Hell
JW
Agah
A
Lawler
J
Mosher
DF
Bornstein
P
Barres
BA
Thrombospondins are astrocyte-secreted proteins that promote CNS synaptogenesis
Cell
 , 
2005
, vol. 
120
 (pg. 
421
-
433
)
Coppinger
JA
Cagney
G
Toomey
S
Kislinger
T
Belton
O
McRedmond
JP
Cahill
DJ
Emili
A
Fitzgerald
DJ
Maguire
PB
Characterization of the proteins released from activated platelets leads to localization of novel platelet proteins in human atherosclerotic lesions
Blood
 , 
2004
, vol. 
103
 (pg. 
2096
-
2104
)
Cortés
R
Ceccatelli
S
Schalling
M
Hökfelt
T
Differential effects of intracerebroventricular colchicine administration on the expression of mRNAs for neuropeptides and neurotransmitter enzymes, with special emphasis on galanin: an in situ hybridization study
Synapse
 , 
1990
, vol. 
6
 (pg. 
369
-
391
)
Fiacco
TA
Agulhon
C
McCarthy
KD
Sorting out astrocyte physiology from pharmacology
Annu Rev Pharmacol Toxicol
 , 
2009
, vol. 
49
 (pg. 
151
-
174
)
Fischer-Colbrie
R
Kirchmair
R
Kähler
CM
Wiedermann
CJ
Saria
A
Secretoneurin: a new player in angiogenesis and chemotaxis linking nerves, blood vessels and the immune system
Curr Protein Pept Sci
 , 
2005
, vol. 
6
 (pg. 
373
-
385
)
Fischer-Colbrie
R
Kirchmair
R
Schobert
A
Olenik
C
Meyer
DK
Winkler
H
Secretogranin II is synthesized and secreted in astrocyte cultures
J Neurochem
 , 
1993
, vol. 
60
 (pg. 
2312
-
2314
)
Fischer-Colbrie
R
Laslop
A
Kirchmair
R
Secretogranin II: molecular properties, regulation of biosynthesis and processing to the neuropeptide secretoneurin
Prog Neurobiol
 , 
1995
, vol. 
46
 (pg. 
49
-
70
)
Goss
JR
O'Malley
ME
Zou
L
Styren
SD
Kochanek
PM
DeKosky
ST
Astrocytes are the major source of nerve growth factor upregulation following traumatic brain injury in the rat
Exp Neurol
 , 
1998
, vol. 
149
 (pg. 
301
-
309
)
Han
L
Suda
M
Tsuzuki
K
Wang
R
Ohe
Y
Hirai
H
Watanabe
T
Takeuchi
T
Hosaka
M
A large form of secretogranin III functions as a sorting receptor for chromogranin A aggregates in PC12 cells
Mol Endocrinol
 , 
2008
, vol. 
22
 (pg. 
1935
-
1949
)
Helle
KB
The granin family of uniquely acidic proteins of the diffuse neuroendocrine system: comparative and functional aspects
Biol Rev Camb Philos Soc
 , 
2004
, vol. 
79
 (pg. 
769
-
794
)
Holthuis
JC
Jansen
EJ
Martens
GJ
Secretogranin III is a sulfated protein undergoing proteolytic processing in the regulated secretory pathway
J Biol Chem
 , 
1996
, vol. 
271
 (pg. 
17755
-
17760
)
Holthuis
JC
Martens
GJ
The neuroendocrine proteins secretogranin II and III are regionally conserved and coordinately expressed with proopiomelanocortin in Xenopus intermediate pituitary
J Neurochem
 , 
1996
, vol. 
66
 (pg. 
2248
-
2256
)
Hosaka
M
Suda
M
Sakai
Y
Izumi
T
Watanabe
T
Takeuchi
T
Secretogranin III binds to cholesterol in the secretory granule membrane as an adapter for chromogranin A
J Biol Chem
 , 
2004
, vol. 
279
 (pg. 
3627
-
3634
)
Hosaka
M
Watanabe
T
Sakai
Y
Kato
T
Takeuchi
T
Interaction between secretogranin III and carboxypeptidase E facilitates prohormone sorting within secretory granules
J Cell Sci
 , 
2005
, vol. 
118
 (pg. 
4785
-
4795
)
Hosaka
M
Watanabe
T
Sakai
Y
Uchiyama
Y
Takeuchi
T
Identification of a chromogranin A domain that mediates binding to secretogranin III and targeting to secretory granules in pituitary cells and pancreatic beta-cells
Mol Biol Cell
 , 
2002
, vol. 
13
 (pg. 
3388
-
3399
)
Jahnke
GD
Brunssen
S
Maier
WE
Harry
GJ
Neurotoxicant-induced elevation of adrenomedullin expression in hippocampus and glia cultures
J Neurosci Res
 , 
2001
, vol. 
66
 (pg. 
464
-
474
)
Kim
T
Tao-Cheng
JH
Eiden
LE
Loh
YP
Chromogranin A, an “on/off” switch controlling dense-core secretory granule biogenesis
Cell
 , 
2001
, vol. 
106
 (pg. 
499
-
509
)
Krzan
M
Stenovec
M
Kreft
M
Pangrsic
T
Grilc
S
Haydon
PG
Zorec
R
Calcium-dependent exocytosis of atrial natriuretic peptide from astrocytes
J Neurosci
 , 
2003
, vol. 
23
 (pg. 
1580
-
1583
)
Lein
ES
Hawrylycz
MJ
Ao
N
Ayres
M
Bensinger
A
Bernard
A
Boe
AF
Boguski
MS
Brockway
KS
Byrnes
EJ
, et al.  . 
Genome-wide atlas of gene expression in the adult mouse brain
Nature
 , 
2007
, vol. 
445
 (pg. 
168
-
176
)
Levey
AI
Bolam
JP
Rye
DB
Hallanger
AE
Demuth
RM
Mesulam
MM
Wainer
BH
A light and electron microscopic procedure for sequential double antigen localization using diaminobenzidine and benzidine dihydrochloride
J Histochem Cytochem
 , 
1986
, vol. 
34
 (pg. 
1449
-
1457
)
Majdoubi
ME
Metz-Boutigue
MH
Garcia-Sablone
P
Theodosis
DT
Aunis
D
Immunocytochemical localization of chromogranin A in the normal and stimulated hypothalamo-neurohypophysial system of the rat
J Neurocytol
 , 
1996
, vol. 
25
 (pg. 
405
-
416
)
Martí
E
Ferrer
I
Blasi
J
Differential regulation of chromogranin A, chromogranin B and secretoneurin protein expression after transient forebrain ischemia in the gerbil
Acta Neuropathol
 , 
2001
, vol. 
101
 (pg. 
159
-
166
)
Mathewson
AJ
Berry
M
Observations on the astrocyte response to a cerebral stab wound in adult rats
Brain Res
 , 
1985
, vol. 
327
 (pg. 
61
-
69
)
Montana
V
Malarkey
EB
Verderio
C
Matteoli
M
Parpura
V
Vesicular transmitter release from astrocytes
Glia
 , 
2006
, vol. 
54
 (pg. 
700
-
715
)
Montero-Hadjadje
M
Vaingankar
S
Elias
S
Tostivint
H
Mahata
SK
Anouar
Y
Chromogranins A and B and secretogranin II: evolutionary and functional aspects
Acta Physiol (Oxf)
 , 
2008
, vol. 
192
 (pg. 
309
-
324
)
Nie
XJ
Olsson
Y
Endothelin peptides in brain diseases
Rev Neurosci
 , 
1996
, vol. 
7
 (pg. 
177
-
186
)
Ottiger
HP
Battenberg
EF
Tsou
AP
Bloom
FE
Sutcliffe
JG
1B1075: a brain- and pituitary-specific mRNA that encodes a novel chromogranin/secretogranin-like component of intracellular vesicles
J Neurosci
 , 
1990
, vol. 
10
 (pg. 
3135
-
3147
)
Paco
S
Margelí
MA
Olkkonen
VM
Imai
A
Blasi
J
Fischer-Colbrie
R
Aguado
F
Regulation of exocytotic protein expression and Ca2+-dependent peptide secretion in astrocytes
J Neurochem
 , 
2009
, vol. 
110
 (pg. 
143
-
156
)
Panatier
A
Theodosis
DT
Mothet
JP
Touquet
B
Pollegioni
L
Poulain
DA
Oliet
SH
Glia-derived D-serine controls NMDA receptor activity and synaptic memory
Cell
 , 
2006
, vol. 
125
 (pg. 
775
-
784
)
Pascual
O
Casper
KB
Kubera
C
Zhang
J
Revilla-Sanchez
R
Sul
JY
Takano
H
Moss
SJ
McCarthy
K
Haydon
PG
Astrocytic purinergic signaling coordinates synaptic networks
Science
 , 
2005
, vol. 
310
 (pg. 
113
-
116
)
Perea
G
Araque
A
Astrocytes potentiate transmitter release at single hippocampal synapses
Science
 , 
2007
, vol. 
317
 (pg. 
1083
-
1086
)
Pirker
S
Czech
T
Baumgartner
C
Maier
H
Novak
K
Fürtinger
S
Fischer-Colbrie
R
Sperk
G
Chromogranins as markers of altered hippocampal circuitry in temporal lobe epilepsy
Ann Neurol
 , 
2001
, vol. 
50
 (pg. 
216
-
226
)
Prasad
P
Yanagihara
AA
Small-Howard
AL
Turner
H
Stokes
AJ
Secretogranin III directs secretory vesicle biogenesis in mast cells in a manner dependent upon interaction with chromogranin A
J Immunol
 , 
2008
, vol. 
181
 (pg. 
5024
-
5034
)
Ramamoorthy
P
Whim
MD
Trafficking and fusion of neuropeptide Y-containing dense-core granules in astrocytes
J Neurosci
 , 
2008
, vol. 
28
 (pg. 
13815
-
13827
)
Ridet
JL
Privat
A
Malhotra
SK
Gage
FH
Reactive astrocytes: cellular and molecular cues to biological function
Trends Neurosci
 , 
1997
, vol. 
20
 (pg. 
570
-
577
)
Shyu
WC
Lin
SZ
Chiang
MF
Chen
DC
Su
CY
Wang
HJ
Liu
RS
Tsai
CH
Li
H
Secretoneurin promotes neuroprotection and neuronal plasticity via the Jak2/Stat3 pathway in murine models of stroke
J Clin Invest
 , 
2008
, vol. 
118
 (pg. 
133
-
148
)
Simon
JP
Bader
MF
Aunis
D
Secretion from chromaffin cells is controlled by chromogranin A-derived peptides
Proc Natl Acad Sci USA
 , 
1988
, vol. 
85
 (pg. 
1712
-
1716
)
Sofroniew
MV
Reactive astrocytes in neural repair and protection
Neuroscientist
 , 
2005
, vol. 
11
 (pg. 
400
-
407
)
Takahashi
K
Nakayama
M
Totsune
K
Murakami
O
Sone
M
Kitamuro
T
Yoshinoya
A
Shibahara
S
Increased secretion of adrenomedullin from cultured human astrocytes by cytokines
J Neurochem
 , 
2000
, vol. 
74
 (pg. 
99
-
103
)
Takeuchi
T
Hosaka
M
Sorting mechanism of peptide hormones and biogenesis mechanism of secretory granules by secretogranin III, a cholesterol-binding protein, in endocrine cells
Curr Diabetes Rev
 , 
2008
, vol. 
4
 (pg. 
31
-
38
)
Taupenot
L
Ciesielski-Treska
J
Ulrich
G
Chasserot-Golaz
S
Aunis
D
Bader
MF
Chromogranin A triggers a phenotypic transformation and the generation of nitric oxide in brain microglial cells
Neuroscience
 , 
1996
, vol. 
72
 (pg. 
377
-
389
)
Taupenot
L
Harper
KL
O'Connor
DT
The chromogranin-secretogranin family
N Engl J Med
 , 
2003
, vol. 
348
 (pg. 
1134
-
1149
)
Vilijn
MH
Das
B
Kessler
JA
Fricker
LD
Cultured astrocytes and neurons synthesize and secrete carboxypeptidase E, a neuropeptide-processing enzyme
J Neurochem
 , 
1989
, vol. 
53
 (pg. 
1487
-
1493
)
Volterra
A
Meldolesi
J
Astrocytes, from brain glue to communication elements: the revolution continues
Nat Rev Neurosci
 , 
2005
, vol. 
6
 (pg. 
626
-
640
)
Winkler
H
Fischer-Colbrie
R
The chromogranins A and B: the first 25 years and future perspectives
Neuroscience
 , 
1992
, vol. 
49
 (pg. 
497
-
528
)
Winsky-Sommerer
R
Benjannet
S
Rovère
C
Barbero
P
Seidah
NG
Epelbaum
J
Dournaud
P
Regional and cellular localization of the neuroendocrine prohormone convertases PC1 and PC2 in the rat central nervous system
J Comp Neurol
 , 
2000
, vol. 
424
 (pg. 
439
-
460
)
Woulfe
J
Deng
D
Munoz
D
Chromogranin A in the central nervous system of the rat: pan-neuronal expression of its mRNA and selective expression of the protein
Neuropeptides
 , 
1999
, vol. 
33
 (pg. 
285
-
300
)
Zhang
Z
Chen
G
Zhou
W
Song
A
Xu
T
Luo
Q
Wang
W
Gu
XS
Duan
S
Regulated ATP release from astrocytes through lysosome exocytosis
Nat Cell Biol
 , 
2007
, vol. 
8
 (pg. 
945
-
953
)