Abstract

Gephyrin is a scaffolding protein important for the postsynaptic clustering of inhibitory neurotransmitter receptors. Here, we investigated the properties of gephyrin scaffolds at γ-aminobutyric acid- (GABA-)ergic synapses in organotypic entorhino-hippocampal cultures prepared from a transgenic mouse line, which expresses green fluorescent protein-tagged gephyrin under the control of the Thy1.2 promoter. Fluorescence recovery after photobleaching revealed a developmental stabilization of postsynaptic gephyrin clusters concomitant with an increase in cluster size and synaptic strength between 1 and 4 weeks in vitro. Prolonged treatment of the slice cultures with diazepam or a GABAA receptor antagonist disclosed a homeostatic regulation of both inhibitory synaptic strength and gephyrin cluster size and stability in 4-weeks-old cultures, whereas at 1 week in vitro, the same drug treatments modulated GABAergic postsynapse and gephyrin cluster properties following a Hebbian mode of synaptic plasticity. Our data are consistent with a model in which the postnatal maturation of the hippocampal network endows CA1 pyramidal neurons with the ability to homeostatically adjust the strength of their inhibitory postsynapses to afferent GABAergic drive by regulating gephyrin scaffold properties.

Introduction

The proper balance of excitation and inhibition is a prerequisite for normal functioning of the nervous system and adequate behavioral responses (Luria 1932). Activity-induced changes in the efficacy of selected synapses that disturb this balance, such as long-term potentiation or long-term depression, must hence be compensated by homeostatic regulatory mechanisms that maintain network stability (reviewed in Pozo and Goda 2010; Turrigiano 2011). Similarly, during development changes in the number and strength of synapses on a given neuron require the homeostatic adaptation of excitability and synaptic efficacy to keep firing rates in the proper range. In central neurons, a slow adaptive mechanism termed homeostatic synaptic scaling has been shown to globally adjust the properties of excitatory synapses to persistent changes in activity, mainly by postsynaptically increasing or decreasing α-amino-3-hydroxy-5-methyl-4-isoxazolpropionic acid (AMPA) receptor numbers (for review see Turrigiano 2011).

At inhibitory synapses, evidence for adaptive changes in synaptic strength has also emerged (Turrigiano 2011). There, the scaffolding protein gephyrin is known to be important for the clustering of glycine and γ-aminobutyric acidA (GABAA) receptors (GABAARs; Essrich et al. 1998; Feng et al. 1998; Kneussel et al. 1999). Gephyrin is thought to form a hexagonal lattice beneath the postsynaptic membrane (Sola et al. 2004; Saiyed et al. 2007; Herweg and Schwarz 2012) and to determine receptor densities at, and hence the efficacy of, inhibitory synapses by interacting with specific receptor subunits (Meyer et al. 1995; Tretter et al. 2011). Single molecule tracking studies indicate that extrasynaptic glycine receptors and GABAARs diffuse freely in the neuronal plasma membrane but upon entering synaptic sites become less mobile due to receptor trapping by the postsynaptic gephyrin scaffold (Meier et al. 2001; Dahan et al. 2003; Jacob et al. 2005; Levi et al. 2008; Lüscher et al. 2011). Both the synaptic receptors and clustered gephyrin are subject to continuous exchange due to dissociation from and reassociation to the postsynapse (Maas et al. 2006; Calamai et al. 2009). The size and properties of gephyrin clusters are regulated by neuronal activity (Kirsch and Betz 1998; Bannai et al. 2009; Maas et al. 2009) and phosphorylation reactions (Bausen et al. 2010; Tyagarajan et al. 2011) and depend on interactions with the cytoskeleton (Kirsch and Betz 1995; Bausen et al. 2006; Charrier et al. 2006).

In this study, we used entorhino-hippocampal slice cultures prepared from mice expressing green flluorescent protein gephyrin (GFP-gephyrin) under the control of the Thy1.2 promoter to study the dynamics of gephyrin clusters at different postnatal stages by determining fluorescence recovery after photobleaching (FRAP). We find that synaptic gephyrin clusters are stabilized during developmental maturation in parallel with an increase in gephyrin cluster size and synaptic strength, and that in young slice cultures gephyrin cluster size and stability are increased by GABAAR activity. In contrast, in mature slice cultures, gephyrin cluster size and stability are regulated inversely by GABAAR activity. These results disclose a novel step in the postnatal maturation of the inhibitory hippocampal network, which endows CA1 pyramidal neurons with the capacity to change inhibitory synaptic strength in a homeostatic manner by regulating the dynamics of gephyrin scaffolds.

Materials and Methods

Generation of Thy1-EGFPgephyrin Mice

Transgenic mice expressing GFP-gephyrin under the control of the Thy1.2 promoter were generated following a previously described strategy (Caroni 1997; Feng et al. 2000). The pEGFP-C2-gephyrin plasmid encoding an enhanced green fluorescent protein (EGFP) fusion protein of rat gephyrin cDNA p1 (Prior et al. 1992) along with the 800-bp fragment of gephyrin's 3′ untranslated region (3′ UTR) has been described previously (Fuhrmann et al. 2002). A NheISacII fragment containing EGFPgephyrin obtained from this plasmid was inserted into the NheISacII sites of a modified mouse Thy1.2 expression cassette (Caroni 1997) harboring a multiple cloning site (kindly provided by Dr G. O'Sullivan, Max-Planck Institute for Brain Research, Frankfurt, Germany; Fig. 1A). The resulting Thy1-EGFPgephyrin transgene was purified as a NotI-PvuI fragment (Fig. 1A) by passage over a Sepharose 4B column (GE Healthcare, Freiburg, Germany), and the fractions collected were analyzed by agarose gel electrophoresis. The fraction containing the NotI-PvuI 10.5-kb transgene was ethanol precipitated, resuspended in injection buffer (10 mM Tris/0.1 mM ethylenediamine tetra-acetic acid, 100 mM NaCl, pH 7.4) at a concentration of 30 ng/μL, and injected by the Transgenic Facility of the University of Heidelberg into the pronuclei of E0.5 zygotes collected from superovulated C57BL/6 female zygote donors followed by transfer to pseudopregnant C57BL/6 recipients.

Figure 1.

Generation and characterization of Thy1-EGFPgephyrin mice. (A) Schematic representation of the construct used to generate transgenic Thy1-EGFPgephyrin mice. A NotI-PvuI fragment of the Thy1.2 expression cassette contains sequences essential for expression. The EGFP-tagged rat gephyrin p1 cDNA was cloned into the NheISacII sites of the expression cassette. The N-terminal EGFP tag is represented as a green box, and a 0.8-kb 3′ UTR of the gephyrin gene as a gray box. The positions of the primers used for genotyping are indicated by black arrows. Exons of the Thy1.2 gene are shown as grey boxes. Arrow at exon 1a indicates the transcription start site (5′ UTR; pA, polyadenylation sequence). (B) Genotyping from tail genomic DNA by PCR, using a Thy1.2-specific forward primer (Thy1F1) and an EGFP-specific reverse primer (EGFPrev), reveals a specific 940-bp fragment in Thy1-EGFPgephyrin transgenic (Tg) but not wt mice (M, DNA marker). (C) Western blot analysis of brain homogenates; equal amounts of protein (30 μg/lane) were loaded and probed with the indicated antibodies. Note the presence of GFP-gephyrin (green arrow) in homogenates derived from Thy1-EGFPgephyrin (Tg) but not wt animals. The expression levels of endogenous gephyrin (red asterisk) and other synaptic proteins tested (GABAAR, γ2, the γ2 subunit of GABAAR; GlyR, α, glycine receptor α-subunits; VIAAT) were not different among genotypes. β-actin, loading control. Note that the larger apparent molecular weight of gephyrin found here when compared with the previously reported 93 kDa is due to the use of different marker proteins; the calculated molecular weight of gephyrin is only about 80 kDa (Prior et al. 1992). (D) Sagittal section of Thy1-EGFPgephyrin mouse brain stained for VIAAT (red). Note GFP-gephyrin (green) expression in cortical regions and hippocampus. Blue, TO-PRO nuclear stain. Scale bar, 500 μm. (E) A single plane confocal image of the hippocampal area CA1 of a Thy1-EGFPgephyrin mouse immunostained for gephyrin (o, stratum oriens; pcl, pyramidal cell layer; rad, stratum radiatum). GFP-gephyrin fluorescence (green) colocalizes with gephyrin immunoreactive (red) puncta. In the pcl and at the border between pcl and o, larger GFP-gephyrin aggregates are observed (arrow). Scale bar, 10 μm. (F) As (E), but higher magnification of the stratum radiatum. Arrowheads indicate gephyrin clusters (red) colocalizing with GFP-gephyrin (green). Scale bar, 2 μm. (G) Average size (in μm2) of mAb 7a-immunoreactive gephyrin clusters in the stratum radiatum of 3-month-old wt and Thy1-EGFPgephyrin animals. In sections from Thy1-EGFPgephyrin brains, GFP-gephyrin(+) and GFP-gephyrin(−) clusters were analyzed separately (n = 300 clusters per group; 3 sections, each, from 3 mice per genotype). (H) Gephyrin cluster densities (per 1000 μm2) in the stratum radiatum of 3-months-old wt and Thy1-EGFPgephyrin mice (n = 9; 3 sections, each, from 3 mice per genotype).

Figure 1.

Generation and characterization of Thy1-EGFPgephyrin mice. (A) Schematic representation of the construct used to generate transgenic Thy1-EGFPgephyrin mice. A NotI-PvuI fragment of the Thy1.2 expression cassette contains sequences essential for expression. The EGFP-tagged rat gephyrin p1 cDNA was cloned into the NheISacII sites of the expression cassette. The N-terminal EGFP tag is represented as a green box, and a 0.8-kb 3′ UTR of the gephyrin gene as a gray box. The positions of the primers used for genotyping are indicated by black arrows. Exons of the Thy1.2 gene are shown as grey boxes. Arrow at exon 1a indicates the transcription start site (5′ UTR; pA, polyadenylation sequence). (B) Genotyping from tail genomic DNA by PCR, using a Thy1.2-specific forward primer (Thy1F1) and an EGFP-specific reverse primer (EGFPrev), reveals a specific 940-bp fragment in Thy1-EGFPgephyrin transgenic (Tg) but not wt mice (M, DNA marker). (C) Western blot analysis of brain homogenates; equal amounts of protein (30 μg/lane) were loaded and probed with the indicated antibodies. Note the presence of GFP-gephyrin (green arrow) in homogenates derived from Thy1-EGFPgephyrin (Tg) but not wt animals. The expression levels of endogenous gephyrin (red asterisk) and other synaptic proteins tested (GABAAR, γ2, the γ2 subunit of GABAAR; GlyR, α, glycine receptor α-subunits; VIAAT) were not different among genotypes. β-actin, loading control. Note that the larger apparent molecular weight of gephyrin found here when compared with the previously reported 93 kDa is due to the use of different marker proteins; the calculated molecular weight of gephyrin is only about 80 kDa (Prior et al. 1992). (D) Sagittal section of Thy1-EGFPgephyrin mouse brain stained for VIAAT (red). Note GFP-gephyrin (green) expression in cortical regions and hippocampus. Blue, TO-PRO nuclear stain. Scale bar, 500 μm. (E) A single plane confocal image of the hippocampal area CA1 of a Thy1-EGFPgephyrin mouse immunostained for gephyrin (o, stratum oriens; pcl, pyramidal cell layer; rad, stratum radiatum). GFP-gephyrin fluorescence (green) colocalizes with gephyrin immunoreactive (red) puncta. In the pcl and at the border between pcl and o, larger GFP-gephyrin aggregates are observed (arrow). Scale bar, 10 μm. (F) As (E), but higher magnification of the stratum radiatum. Arrowheads indicate gephyrin clusters (red) colocalizing with GFP-gephyrin (green). Scale bar, 2 μm. (G) Average size (in μm2) of mAb 7a-immunoreactive gephyrin clusters in the stratum radiatum of 3-month-old wt and Thy1-EGFPgephyrin animals. In sections from Thy1-EGFPgephyrin brains, GFP-gephyrin(+) and GFP-gephyrin(−) clusters were analyzed separately (n = 300 clusters per group; 3 sections, each, from 3 mice per genotype). (H) Gephyrin cluster densities (per 1000 μm2) in the stratum radiatum of 3-months-old wt and Thy1-EGFPgephyrin mice (n = 9; 3 sections, each, from 3 mice per genotype).

Positive offspring were identified by polymerase chain reaction (PCR) of tail biopsies using a Thy1.2-specific 5′ primer (Thy1F1: 5′ TCTGAGTGGCAAAGGACCTTAGG 3′) and an EGFP-specific 3′ primer (EGFPrev: 5′ GTCCATGCCGAGAGTGATC 3′) to amplify a 940-bp fragment (Fig. 1B). Mice positive by PCR were further screened for germline integration of the transgene by backcrossing them with C57BL/6 wildtype (wt) mice, and two mice were identified as founders. All experiments described here were performed on progeny from founder 1 (Thy1-EGFPgephyrin transgenic line 1).

Western Blotting

Brain homogenates were prepared as described (Kneussel et al. 1999), separated on 10% (w/v) SDS–polyacrylamide gels (30 μg protein/lane), transferred to nitrocellulose (Schleicher & Schüll, Dassel, Germany), and probed with different primary antibodies. The following primary antibodies were used: anti-gephyrin (mouse, BD Biosciences, Heidelberg, Germany, 1:500), anti-GFP (rabbit, Invitrogen, Karlsruhe, Germany; 1:1000), anti-GABAAR, γ2 subunit (rabbit, Alomone Laboratories, Jerusalem, Israel; 1:200), anti-glycine receptor (GlyR) α-subunits (mouse, mAb4a; 1:2000; Kirsch and Betz 1993), anti-vesicular inhibitory amino acid transporter (VIAAT; rabbit, Synaptic Systems GmbH, Goettingen, Germany; 1:1000), anti-β-actin (mouse, Sigma-Aldrich, Taufkirchen, Germany; 1:1000), followed by incubation with secondary antibodies conjugated to horseradish peroxidase (Promega, Madison, WI, USA; 1:10,000). Bound antibody was visualized using an enhanced chemiluminescence detection system (Perbio Science, Bonn, Germany).

Immunostaining on Cryostat Sections

For immunostainings with the gephyrin-specific antibody mAb7a (mouse, Synaptic Systems GmbH; 1:500; Feng et al. 1998; Kirsch and Betz 1998), mice were deeply anesthetized and decapitated. The brains were immediately removed and frozen on dry ice. Coronal hippocampal cryostat sections (14 μm) were fixed with 4% (w/v) paraformaldehyde (PFA) for 10 min at 4 °C, permeabilized with 0.3% (w/v) Triton X-100, and incubated overnight at 4 °C with the primary antibody at appropriate dilutions in phosphate buffered saline (PBS)/10% goat serum and for 1 h with a secondary antibody (Alexa 546, Invitrogen; 1:1000). For double immunostaining with the antibody recognizing gephyrin (mAb7a, 1:500) and an antibody specific for VIAAT (affinity-purified rabbit polyclonal, Synaptic Systems GmbH; 1:500), mice were deeply anesthetized and decapitated. The brains were immediately removed and incubated overnight at 4 °C in 50 mL fixative containing 4% (w/v) PFA in 0.1 M phosphate buffer, pH 7.4. Coronal 20-μm sections were prepared from frozen tissue and were mounted on SuperFrost Plus slides (Menzel GmbH, Braunschweig, Germany). Sections were then postfixed for 10 min with 4% (w/v) PFA at 4 °C and preincubated for 30 min at 95 °C in sodium citrate (SC) buffer (10 mM SC, 0.05% (v/v) Tween-20, pH 8.0) for antigen retrieval. Sections were permeabilized with 0.3% (w/v) Triton X-100, followed by immunostaining with the primary and secondary antibodies (Alexa 488 and Alexa 546, Invitrogen; 1:1000) as described above.

Preparation of Slice Cultures

Entorhino-hippocampal slice cultures were prepared from heterozygous Thy1-EGFPgephyrin mice at postnatal days 4 and 5 in agreement with the German law on the use of laboratory animals using a published protocol (Del Turco and Deller 2007). No attempt was made to distinguish between sexes in these experiments. Cultivation medium contained 50% (v/v) minimum essential medium, 25% (v/v) basal medium eagle, 25% (v/v) heat-inactivated normal horse serum, 25 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer solution, 0.15% (w/v) bicarbonate, 0.65% (w/v) glucose, 0.1 mg/mL streptomycin, 100 U/mL penicillin, and 2 mM glutamax. The pH was adjusted to 7.3, and the medium was replaced every second or third day. All slice cultures were kept in a humidified atmosphere with 5% (v/v) CO2 at 35 °C.

Live Cell Confocal Imaging and FRAP Analysis

FRAP experiments were performed with a Zeiss LSM Exciter confocal microscope equipped with an Acousto Optic Tunable Filter (AOTF) at 35 °C. Individual GFP-gephyrin clusters in the stratum radiatum of area CA1 were visualized using a ×40 water immersion objective lens (0.8 NA; Zeiss, Jena, Germany) and ×2 scan zoom, with the pinhole diameter set at 1 Airy Unit. Image stacks (7 sections) were taken at an ideal Nyquest rate. Imaging parameters were initially optimized to minimize bleaching by the imaging procedure itself. Following 15 min baseline registration, selected GFP-gephyrin clusters in the middle plane of the stack were completely bleached (<5% of initial fluorescence) using the bleaching function of Zeiss Zen Software (AOTF-controlled Argon laser 488 nm; 100% transmission; 100 bleach iterations), and FRAP was then followed for 80 min (Δt = 5 min).

Electrophysiology

Miniature inhibitory postsynaptic currents (mIPSCs) were recorded from CA1 pyramidal cells at 35 °C as previously described (Jedlicka et al. 2011). The bath solution (artificial cerebrospinal fluid [ACSF]) contained 126 mM NaCl, 2.5 mM KCl, 26 mM NaHCO3, 1.25 mM NaH2PO4, 2 mM CaCl2, 2 mM MgCl2, and 10 mM glucose. Patch pipettes contained 140 mM CsCl, 2 mM MgCl2, 10 mM HEPES, 0.3% (w/v) biocytin, and 10 μM Alexa 568 (pH 7.30 with CsOH, 295 mOsm with sucrose) and had a resistance of 6–10 MΩ. Data were recorded at a holding potential of −80 mV in the presence of 10 μM D-AP5, 10 μM CNQX, and 0.5 μM tetrodotoxin (TTX) and digitized at a sampling rate of 10 kHz. Series resistance was monitored every 2–3 min, and the recordings were discarded if the series resistance or the leak current reached 30 MΩ or 150pA, respectively. Cell-attached recordings (Mason et al. 2005; Perkins 2006) were performed in 0.5 μM TTX with recording pipettes filled with bath solution to qualitatively assess the effects of GABA in young (5 days in vitro [DIV]) and mature (30 DIV) CA1 pyramidal neurons. Puff application of GABA (100 μM in ACSF), glutamate (100 μM in ACSF), or ACSF was performed via a patch pipette positioned in the stratum radiatum close to the neuron of interest.

Immunostaining of Slice Cultures

Upon fixation in 4% (w/v) PFA and 4% (w/v) sucrose in PBS for 15 min, cultures were washed thoroughly in PBS, permeabilized for 1 h with 0.3% (v/v) Triton X-100, 4% (v/v) normal goat serum in PBS, and blocked for 2 h with 10% (v/v) normal goat serum in PBS. Cultures were incubated overnight at 4 °C with the affinity-purified polyclonal rabbit anti-VIAAT antibody (cytoplasmic domain, Synaptic Systems GmbH; 1:500) in PBS and 10% (v/v) goat serum, and after washing for 1 h with secondary antibodies (appropriate Alexa-coupled secondary antibodies, Invitrogen; 1:500). Cultures were then washed thoroughly in PBS, coverslipped in anti-fading mounting medium (DAKO Fluoromount) and analyzed using a Nikon Eclipse C1si confocal laser-scanning microscope equipped with a ×60 oil immersion objective (NA 1.3, Nikon; ×4 scan zoom).

Quantification and Statistics

Experimental data were evaluated by investigators blind to experimental conditions. The Image-J software package (http://rsb.info.nih.gov/ij) was used to analyze immunostainings and FRAP experiments. Immunostainings were analyzed as described (Bas Orth et al. 2005). FRAP of individual GFP-gephyrin clusters was corrected for background and bleaching by the imaging procedure itself. Values were normalized to prebleach fluorescence and to the first time point after bleaching. Values were expressed as the percentage of mean prebleach fluorescence (i.e. averaged corrected fluorescence of baseline recordings; Δt = 5 min) and averaged per culture, that is, per independent experiment. FRAP data were fitted using the curve fitting toolbox of MATLAB version 7.5 (The MathWorks Inc., Natick, MA, United States of America) with the following bi-exponential equation: 

formula
where Pf denotes the fraction of the fast component with the recovery time constant τf and Ps the fraction of the slow component with the recovery time τs, respectively. Where appropriate, the fractional contributions of the fast and slow components (Pf-norm and Ps-norm; expressed as the percentage of total), the corresponding recovery time constants, and the stationary fraction [1 − (Pf+ Ps); expressed as %] were then determined and statistically compared (Fig. 4). Due to difficulties to reliably determine the often rather small Pf values observed in the pharmacological experiments presented in Figures 5 and 6, here statistical evaluations were based on comparisons of the averaged FRAP values sampled between 65 and 80 min. Apposition of gephyrin and VIAAT clusters was assessed manually on 3D-image stacks using the Zeiss LSM image browser by scrolling through the stack. Electrophysiological data were analyzed using pClamp 10.2 (Axon Instruments, United States of America) and MiniAnalysis (Synaptosoft, United States of America) software. Events (300–400) were analyzed per recorded neuron. Since a normal distribution of our data could not be assured, statistical comparisons in this study were made using the non-parametric Wilcoxon Mann–Whitney test. The Kruskal–Wallis test and the Wilcoxon Mann–Whitney test followed by Bonferroni's correction for multiple comparisons were used in some cases (Figs 1G, 5A–D, and 6AD). P-values <0.05 were considered significant. All values represent means ± standard error of the mean. In the figures, *P < 0.05, **P < 0.01, and ***P < 0.001; not significant differences are indicated with “n.s.”

Digital Illustrations

Confocal image stacks were exported as 2D projections and stored as TIFF files. Figures were prepared using the Photoshop CS2 graphics software (Adobe, San Jose, CA, United States of America). Image brightness and contrast were adjusted.

Results

Generation and Characterization of Thy1-EGFPgephyrin Transgenic Mice

To allow visualization of gephyrin dynamics in living neurons, we generated mice in which the neuronal p1 splice variant of rat gephyrin (Prior et al. 1992) tagged with EGFP is expressed under the control of the neuron-specific Thy1.2 promoter (Fig. 1A,B; Caroni 1997; Feng et al. 2000). Thy1-EGFPgephyrin mice appeared phenotypically normal and showed no obvious alterations in development and fertility. Expression of GFP-gephyrin was readily detected in the hippocampus, neocortex (layer II, V, and VI), brain stem (caudal medulla), and spinal cord but barely seen in cerebellar neurons (Fig. 1D). Western blot analysis of brain homogenates from Thy1-EGFPgephyrin mice with antibodies against EGFP and gephyrin revealed a band of approximately 125 kDa corresponding to GFP-gephyrin (green arrow in Fig. 1C) that was not seen in age-matched wt animals which contained only the endogeneous 98 kDa gephyrin band (red asterisk in Fig. 1C). The expression levels of endogenous gephyrin and other postsynaptic (γ2 subunit of GABAAR, α subunits of GlyRs) or presynaptic (VIAAT) proteins were comparable among genotypes with β-actin as a loading control (Fig. 1C, right panel).

GFP-gephyrin expression may affect the clustering of endogenous gephyrin at developing postsynapses. Hence, sagittal brain sections from wt and Thy1-EGFPgephyrin mouse brains were counterstained with the gephyrin-specific antibody, mAb 7a, and gephyrin cluster densities, and cross-sectional areas were determined in the hippocampal formation (Fig. 1E–H). This revealed an overlap of EGFP-labeled and mAb 7a-immunoreactive clusters in the dendritic layers of the Thy1-EGFPgephyrin animals examined (Fig. 1E, F). The GFP-gephyrin clusters were synaptically localized, as revealed by their apposition to presynaptic VIAAT immunoreactivity, and their mean size in the stratum radiatum was not significantly different from that of mAb 7a-immunoreactive and GFP-negative clusters in brain sections prepared from either wt or Thy1-EGFPgephyrin animals (wt: 0.24 ± 0.01 μm2; Tg: GFP-gephyrin(−), 0.23 ± 0.01 μm2; and GFP-gephyrin(+), 0.25 ± 0.01 μm2; Fig. 1G). Also, the densities of mAb 7a-immunoreactive puncta per 1000 μm2 of the stratum radiatum did not significantly differ between genotypes (328 ± 29 in wt and 288 ± 21 in Tg; Fig. 1H). Thus, GFP-gephyrin expression had no apparent effect on gephyrin clustering in the dendritic layers of the hippocampal formation. However, we found GFP-gephyrin aggregates in the somata of neurons located in the stratum pyramidale and at the border between the stratum pyramidale and the oriens (arrow in Fig. 1E). The somatic aggregation of GFP-gephyrin could also be seen in neurons of the granule cell layer, in the hilus of the dentate gyrus, and in the layer V of the neocortex (data not shown). Similar gephyrin aggregates have been previously observed in mammalian cells (Meyer et al. 1995) and cultured neurons (Colin et al. 1996).

Developmental Maturation of GFP-Gephyrin Clusters and Synaptic Inhibition in Entorhino-Hippocampal Slice Cultures From Thy1-EGFPgephyrin Mice

To further examine the properties and dynamics of gephyrin clusters under close to in situ conditions, we used organotypic entorhino-hippocampal slice cultures prepared from brains of 4–5-days-old Thy1-EGFPgephyrin mice. These slice cultures are known to recapitulate the major steps of hippocampal development with excellent preservation of in vivo connectivity (Frotscher et al. 1995; Gahwiler et al. 1997). Prominent GFP-gephyrin expression was regularly seen in area CA1 of these organotypic cultures (Fig. 2A) both, after only 5–8 DIV (5–8; “week 1”), and ≥4 weeks in culture (DIV 30–33; “week 4”). At both, the young and the mature stage, individual GFP-gephyrin clusters were clearly discernable and mainly associated with dendritic shafts (Fig. 2D). Notably, most if not all of the GFP-gephyrin clusters were synaptically localized as revealed by co-immunolabeling for the presynaptic VIAAT (Fig. 2B). In 1- and 4-weeks-old cultures, about 92% (92.3 ± 0.7% and 92.2 ± 0.8%, respectively) of the GFP-gephyrin clusters were found to be apposed to VIAAT immunoreactivity in the CA1 stratum radiatum. This value is consistent with an almost exclusive localization of the GFP-gephyrin clusters at sites of nerve terminal contact and considerably higher than respective colocalization values determined in dissociated hippocampal neuron cultures (∼54–74%; Dobie and Craig 2011). We attribute this difference to the high anatomical integrity of the organotypic slice preparation.

Figure 2.

Gephyrin cluster size increases during in vitro development of entorhino-hippocampal slice cultures derived from Thy1-EGFPgephyrin mice. (A) Overview of a typical 4-weeks-old slice culture. Note GFP-gephyrin expression in area CA1. Gephyrin clusters were analyzed in the stratum radiatum (rad) of area CA1 (window). Blue, TO-PRO nuclear stain. Scale bar, 100 μm. (B) Both at weeks 1 and 4, >90% of the GFP-gephyrin clusters were synaptic as indicated by apposition to VIAAT (red). Shown are 2D projections of confocal image stacks from area CA1, stratum radiatum (overlap of the 2 signals is due to the projection along the z-axis, also clusters appear larger than their actual cross-sectional area; n = 4 cultures, each; 3 image stacks per culture). Scale bars, 1 μm. (C) Mean cross-sectional area sizes of GFP-gephyrin and VIAAT clusters increased during in vitro development (n = 9 cultures, each; 3 visual fields, i.e. single confocal image planes per culture). (D) GFP-gephyrin cluster densities in more than second-order dendritic branches of the stratum radiatum were not significantly different (n.s.) between weeks 1 and 4 (red, Alexa 568 filled neurons; n = 5 cultures, each; 2–3 segments per culture). Scale bars, 2 μm.

Figure 2.

Gephyrin cluster size increases during in vitro development of entorhino-hippocampal slice cultures derived from Thy1-EGFPgephyrin mice. (A) Overview of a typical 4-weeks-old slice culture. Note GFP-gephyrin expression in area CA1. Gephyrin clusters were analyzed in the stratum radiatum (rad) of area CA1 (window). Blue, TO-PRO nuclear stain. Scale bar, 100 μm. (B) Both at weeks 1 and 4, >90% of the GFP-gephyrin clusters were synaptic as indicated by apposition to VIAAT (red). Shown are 2D projections of confocal image stacks from area CA1, stratum radiatum (overlap of the 2 signals is due to the projection along the z-axis, also clusters appear larger than their actual cross-sectional area; n = 4 cultures, each; 3 image stacks per culture). Scale bars, 1 μm. (C) Mean cross-sectional area sizes of GFP-gephyrin and VIAAT clusters increased during in vitro development (n = 9 cultures, each; 3 visual fields, i.e. single confocal image planes per culture). (D) GFP-gephyrin cluster densities in more than second-order dendritic branches of the stratum radiatum were not significantly different (n.s.) between weeks 1 and 4 (red, Alexa 568 filled neurons; n = 5 cultures, each; 2–3 segments per culture). Scale bars, 2 μm.

Quantitative evaluations showed that the sizes of GFP-gephyrin clusters and VIAAT immunoreactive puncta increased during the differentiation of the slice cultures in vitro (GFP-gephyrin: 0.13 ± 0.01 μm2 at 1 week and 0.24 ± 0.01 μm2 at 4 weeks, P < 0.001; VIAAT: 0.20 ± 0.01 μm2 at 1 week and 0.28 ± 0.03 μm2 at 4 weeks, P < 0.05; Fig. 2C). In contrast, the corresponding cluster densities did not change significantly during this period (VIAAT cluster densities of 339 ± 37 per 1000 μm2 at 1 week and of 320 ± 15 per 1000 μm2 at 4 weeks; GFP-gephyrin cluster densities per μm dendrite of 0.23 ± 0.02 at 1 week and of 0.20 ± 0.01 at 4 weeks; Fig. 2D).

To evaluate the functional consequences of the changes in GFP-gephyrin cluster size and VIAAT immunoreactivity observed between 1 and 4 weeks in culture, individual CA1 pyramidal neurons were patch-clamped, and mIPSCs were recorded (Fig. 3). In these experiments, Alexa 568 containing patch pipettes were used. This made it possible to readily distinguish GFP-gephyrin(+) and GFP-gephyrin(−) neurons in confocal image stacks prior to recording (Fig. 3A). No significant differences in mIPSC amplitudes and inter-event intervals were found between GFP-gephyrin(+) and GFP-gephyrin(−) cells in both 1- and 4-weeks-old cultures (Fig. 3B, C). Apparently, transgenic expression of GFP-gephyrin did not affect the strength of inhibitory neurotransmission in cultured CA1 pyramidal cells from Thy1-EGFPgephyrin mice. However, at 4 weeks, a ∼50% increase in mean mIPSC amplitude was seen in CA1 pyramidal cells when compared with 1-week-old cultures (22.8 ± 1.4pA at 1 week, and 33.5 ± 1.2pA at 4 weeks; P < 0.001; Fig. 3D, E), and the mean frequency of the mIPSCs was about 10-fold higher (3.0 ± 0.2 Hz at 1 week and 32.7 ± 2.2 Hz at 4 weeks; P < 0.001). In addition, their average rise time was shortened (4.8 ± 0.15 ms at 1 week and 2.0 ± 0.04 ms at 4 weeks; P < 0.001), whereas decay times were not significantly different (13.5 ± 0.6 ms at 1 week and 12.6 ± 0.2 ms at 4 weeks). These results indicate an important strengthening of synaptic inhibition between 1 and 4 weeks in culture.

Figure 3.

Inhibitory synaptic strength increases during in vitro development of entorhino-hippocampal slice cultures derived from Thy1-EGFPgephyrin mice. (A) A 2D projection of a confocal image stack showing a patched GFP-gephyrin(+) CA1 pyramidal neuron filled with Alexa 568 (red; arrow). Note a GFP-gephyrin(–) neuron next to it (arrowhead; previously patched). The 2 groups of neurons could be clearly distinguished in 3D confocal image stacks. Asterisk, patch pipette. Scale bar, 10 μm. (B) Cumulative distribution diagrams of mIPSC amplitudes in GFP-gephyrin(+) and GFP-gephyrin (–) CA1 pyramidal neurons. At both developmental stages analyzed (blue, 1 week; red, 4 weeks), no significant difference (n.s.) was observed between the 2 groups (n = 8 neurons per group; 4 cultures each; statistical comparisons of mean values per neuron). (C) Similarly, the frequency of mIPSCs was not affected by GFP-gephyrin expression. Cumulative distributions of inter-event intervals are shown. (D) Representative traces of mIPSCs recorded from GFP-gephyrin expressing CA1 pyramidal neurons at 1 and 4 weeks in culture. (E) mIPSC mean amplitudes and frequencies increased between 1 and 4 weeks in culture. In addition, a significant reduction in rise time was observed (n = 16 neurons per group; 4 cultures, each; pooled data from both GFP-gephyrin(+) and GFP-gephyrin(−) CA1 pyramidal neurons). (F) Cell-attached recordings from DIV 5 (1 week; blue trace) and DIV 30 (4 weeks; red trace) CA1 pyramidal neurons, while puffing GABA (100 μM; in ACSF) showed that GABA is hyperpolarizing at both developmental stages (4 cultures, i.e. independent experiments, each; 2–3 cells per culture; recordings performed in the presence of 0.5 μM TTX). Puff applications of ACSF only or glutamate (100 μM in ACSF) demonstrated the specificity of the GABA effect (exemplary traces from 5 DIV CA1 pyramidal neurons are shown).

Figure 3.

Inhibitory synaptic strength increases during in vitro development of entorhino-hippocampal slice cultures derived from Thy1-EGFPgephyrin mice. (A) A 2D projection of a confocal image stack showing a patched GFP-gephyrin(+) CA1 pyramidal neuron filled with Alexa 568 (red; arrow). Note a GFP-gephyrin(–) neuron next to it (arrowhead; previously patched). The 2 groups of neurons could be clearly distinguished in 3D confocal image stacks. Asterisk, patch pipette. Scale bar, 10 μm. (B) Cumulative distribution diagrams of mIPSC amplitudes in GFP-gephyrin(+) and GFP-gephyrin (–) CA1 pyramidal neurons. At both developmental stages analyzed (blue, 1 week; red, 4 weeks), no significant difference (n.s.) was observed between the 2 groups (n = 8 neurons per group; 4 cultures each; statistical comparisons of mean values per neuron). (C) Similarly, the frequency of mIPSCs was not affected by GFP-gephyrin expression. Cumulative distributions of inter-event intervals are shown. (D) Representative traces of mIPSCs recorded from GFP-gephyrin expressing CA1 pyramidal neurons at 1 and 4 weeks in culture. (E) mIPSC mean amplitudes and frequencies increased between 1 and 4 weeks in culture. In addition, a significant reduction in rise time was observed (n = 16 neurons per group; 4 cultures, each; pooled data from both GFP-gephyrin(+) and GFP-gephyrin(−) CA1 pyramidal neurons). (F) Cell-attached recordings from DIV 5 (1 week; blue trace) and DIV 30 (4 weeks; red trace) CA1 pyramidal neurons, while puffing GABA (100 μM; in ACSF) showed that GABA is hyperpolarizing at both developmental stages (4 cultures, i.e. independent experiments, each; 2–3 cells per culture; recordings performed in the presence of 0.5 μM TTX). Puff applications of ACSF only or glutamate (100 μM in ACSF) demonstrated the specificity of the GABA effect (exemplary traces from 5 DIV CA1 pyramidal neurons are shown).

GABA has been shown to depolarize cultured neurons at embryonic and newborn stages (Ben-Ari et al. 2007). To exclude that GABA responses are depolarizing at the developmental stages analyzed here, we recorded responses to GABA-puffs in the cell-attached mode from CA1 pyramidal neurons at 5 and 30 DIV (Fig. 3F). These experiments revealed that GABA is hyperpolarizing in both 1- and 4-weeks-old slice cultures that were prepared at postnatal day p4.

Gephyrin Clusters are Stabilized During Synapse Maturation

The findings described above showed that the functional maturation of inhibitory synapses coincides with an increase in mean gephyrin cluster size. To unravel whether this increase may reflect a change in the exchange rate of gephyrin, we determined the FRAP of GFP-gephyrin clusters in 1- and 4-weeks-old slice cultures (Fig. 4). Following a 15-min baseline recording, individual GFP-gephyrin clusters were completely bleached (<5% of initial fluorescence intensity). The reappearance of GFP fluorescence was then followed for up to 80 min at 5-min intervals (Fig. 4). These experiments disclosed a significant difference in the FRAP of GFP-gephyrin clusters depending on the developmental stage analyzed (P < 0.01 for averaged 65–80 min values; Fig. 4B). In 1-week-old cultures, 30% of the averaged prebleach GFP-gephyrin fluorescence recovered within ∼5 min, and up to 80% within 80 min, after photobleaching. In contrast, in 4-weeks-old cultures, 30% recovery was reached only ∼30 min after the bleach, and after 80 min, <40% of the prebleach signal was detected. When applying a bi-exponential fitting procedure to the FRAP curves presented in Figure 4B, 2 kinetically distinct components could be distinguished, a fast one with a recovery time constant of about 1–3 min (τf of 2.2 ± 0.9 min at 1 week and of 0.9 ± 0.4 min at 4 weeks; P = 0.22) and a slower one with a constant ranging between 40 and 70 min (τs of 68 ± 18 min at 1 week, and of 43 ± 11 min at 4 weeks; P = 0.42; Fig. 4C). Notably, although the τf and τs values were not significantly different at the 2 stages analyzed, the relative contributions of the fast and slow components differed significantly in that the relative fraction of the fast component was lower (Pf-norm of 28 ± 4.9% at 1 week, and of 12 ± 3.1% at 4 weeks; P < 0.05), and of the slow component larger (Ps-norm of 72 ± 4.9% at 1 week, and of 88 ± 3.1% at 4 weeks; P < 0.05), at 4 weeks when compared with 1 week. More importantly, when the respective stationary fractions were calculated, a >10-fold increase to 43 ± 8.9% was found at 4 weeks over 2.8 ± 6.4% at 1 week (P < 0.05; Fig. 4C). Together, these results showed that the re-incorporation of GFP-gephyrin into individual clusters is slowed during postnatal development. We attribute this slowing to a reduced turnover, that is, the stabilization of postsynaptic gephyrin scaffolds (see Discussion).

Figure 4.

FRAP rates of GFP-gephyrin clusters are slowed during inhibitory synapse maturation in vitro. (A) Series of FRAP images taken from single GFP-gephyrin clusters in the CA1 stratum radiatum after bleaching at the 0-min time point; images are from 1- and 4-weeks-old slice cultures prepared from Thy1-EGFPgephyrin mice. Control, unbleached GFP-gephyrin cluster. (B) Quantitative evaluation of experiments as shown in (A). Fast FRAP was seen in 1-week-old cultures, with 30% of the averaged prebleach GFP-gephyrin fluorescence recovering within the first 5 min after photobleaching. In contrast, in 4-weeks-old cultures, 30% recovery was reached only 30 min after bleaching (n = 5 cultures per stage; 5–12 clusters bleached per culture; significance indicated for averaged 65–80 min values). (C) Group parameters obtained by bi-exponential fitting of the FRAP data shown in (B). While the τ values of the slow and the fast FRAP components were not significantly different (n.s.) between 1- and 4-weeks-old cultures, the relative fraction of the fast component was lower, and of the slow component larger, at 4 weeks when compared with 1 week. In addition, a significant increase in the stationary fraction of gephyrin clusters was observed in 4-weeks-old slice cultures. (D) The difference in recovery rates found between 1- and 4-weeks-old cultures was still observed when FRAP profiles of equally sized clusters were compared (n = 5 cultures per stage; statistical evaluations based on comparisons of the averaged FRAP values sampled between 65 and 80 min).

Figure 4.

FRAP rates of GFP-gephyrin clusters are slowed during inhibitory synapse maturation in vitro. (A) Series of FRAP images taken from single GFP-gephyrin clusters in the CA1 stratum radiatum after bleaching at the 0-min time point; images are from 1- and 4-weeks-old slice cultures prepared from Thy1-EGFPgephyrin mice. Control, unbleached GFP-gephyrin cluster. (B) Quantitative evaluation of experiments as shown in (A). Fast FRAP was seen in 1-week-old cultures, with 30% of the averaged prebleach GFP-gephyrin fluorescence recovering within the first 5 min after photobleaching. In contrast, in 4-weeks-old cultures, 30% recovery was reached only 30 min after bleaching (n = 5 cultures per stage; 5–12 clusters bleached per culture; significance indicated for averaged 65–80 min values). (C) Group parameters obtained by bi-exponential fitting of the FRAP data shown in (B). While the τ values of the slow and the fast FRAP components were not significantly different (n.s.) between 1- and 4-weeks-old cultures, the relative fraction of the fast component was lower, and of the slow component larger, at 4 weeks when compared with 1 week. In addition, a significant increase in the stationary fraction of gephyrin clusters was observed in 4-weeks-old slice cultures. (D) The difference in recovery rates found between 1- and 4-weeks-old cultures was still observed when FRAP profiles of equally sized clusters were compared (n = 5 cultures per stage; statistical evaluations based on comparisons of the averaged FRAP values sampled between 65 and 80 min).

To examine whether the slowed FRAP of the GFP-gephyrin clusters observed in the mature slice cultures is a consequence of cluster growth, the recovery rates of equally sized GFP-gephyrin clusters were compared between 1- and 4-weeks-old cultures (Fig. 4D). Unexpectedly, the difference in the FRAP rate seen between the 2 developmental stages was still preserved; GFP-gephyrin clusters in 1-week-old cultures recovered faster than clusters of equal size in 4-weeks-old cultures (P < 0.05 for averaged 65–80 min values). Moreover, comparison of clusters of significantly different sizes within each of the 2 age groups disclosed no difference in FRAP of small versus large GFP-gephyrin clusters (data not shown). Thus, gephyrin cluster size does not determine gephyrin re-incorporation rates but additional mechanisms, such as diffusional constraints resulting from modification reactions or interactions with the underlying cytoskeleton or other postsynaptic proteins, must underlie the developmental slowing of fluorescence recovery observed here.

Prolonged Diazepam Treatment Upregulates Both Inhibitory Synaptic Strength and Gephyrin Clustering in Young Slice Cultures

Different lines of evidence indicate that neuronal activity regulates the dynamics and/or transport of gephyrin in primary hippocampal neurons (Bannai et al. 2009; Maas et al. 2009). Since presynaptic changes at inhibitory synapses were detected between 1- and 4-weeks-old slice cultures (see VIAAT cluster size in Fig. 2C, and mIPSC frequency in Fig. 3E), we reasoned that changes in inhibitory drive, that is, in postsynaptic GABAAR activity, might affect gephyrin clustering at inhibitory postsynapses of CA1 pyramidal neurons. We therefore treated 1-weeks-old slice cultures prepared from the Thy1-EGFPgephyrin mice with 1 μM diazepam to chronically increase GABAAR activity (Fig. 5A, B). Electrophysiological recordings immediately after the addition of diazepam (acute treatment) revealed a significant increase in the mean mIPSC amplitude (P < 0.01; Fig. 5A). This increase in mIPSC amplitude was still present after 12 h of drug treatment (recordings in the presence of diazepam; P < 0.01) and partially persisted after diazepam washout (P < 0.05; Fig. 5A). Apparently, the CA1 pyramidal neurons in the 1-week-old cultures reacted to prolonged diazepam potentiation of GABAergic inhibition with an increase in inhibitory synaptic strength.

Figure 5.

GABAA receptor activity regulates gephyrin clusters in young slice cultures. (A) In 1-week-old entorhino-hippocampal slice cultures derived from Thy1-EGFPgephyrin mice, the mean mIPSC amplitudes of CA1 pyramidal neurons were significantly increased when recorded in the presence of diazepam (acute; 1 μM). This increase in amplitude was still seen after 12 h of diazepam treatment (recordings performed in the presence of diazepam) and persisted after washout of the drug (diazepam [12 h] after washout; n = 7–15 neurons per group; 4 cultures each). (B) FRAP of GFP-gephyrin clusters in 1-week-old cultures treated with 1 μM diazepam for 12 h (5 cultures; blue trace represents fitted group data) was slowed when compared with untreated control cultures (red trace, age- and time-matched control data from Fig. 4) concomitantly with an increase in gephyrin cluster size (inset; n = 5 cultures; FRAP performed after the washout of diazepam; significance indicated for averaged 65–80 min values). (C) FRAP analysis of GFP-gephyrin clusters in 1-week-old cultures treated with SR95531 (10 μM) + TTX (1 μM) for 12 h (n = 6 cultures) and 24 h (n = 4 cultures), respectively. While the 12-h treatment had no significant effect, after 24-h SR95531 + TTX fluorescence recovery was accelerated when compared with untreated controls (n = 5 cultures; new set of age- and time-matched control experiments; significance indicated for averaged 65–80 min values). All traces represent fitted group data. (D) Changes in GFP-gephyrin cluster size following blockade of GABAAR activity in 1-week-old cultures. A significant decrease in cluster size was observed after 24 h but not after 12 h of SR95531 + TTX treatment (n = 12 cultures, each; 3 visual fields, i.e. single confocal image planes per culture).

Figure 5.

GABAA receptor activity regulates gephyrin clusters in young slice cultures. (A) In 1-week-old entorhino-hippocampal slice cultures derived from Thy1-EGFPgephyrin mice, the mean mIPSC amplitudes of CA1 pyramidal neurons were significantly increased when recorded in the presence of diazepam (acute; 1 μM). This increase in amplitude was still seen after 12 h of diazepam treatment (recordings performed in the presence of diazepam) and persisted after washout of the drug (diazepam [12 h] after washout; n = 7–15 neurons per group; 4 cultures each). (B) FRAP of GFP-gephyrin clusters in 1-week-old cultures treated with 1 μM diazepam for 12 h (5 cultures; blue trace represents fitted group data) was slowed when compared with untreated control cultures (red trace, age- and time-matched control data from Fig. 4) concomitantly with an increase in gephyrin cluster size (inset; n = 5 cultures; FRAP performed after the washout of diazepam; significance indicated for averaged 65–80 min values). (C) FRAP analysis of GFP-gephyrin clusters in 1-week-old cultures treated with SR95531 (10 μM) + TTX (1 μM) for 12 h (n = 6 cultures) and 24 h (n = 4 cultures), respectively. While the 12-h treatment had no significant effect, after 24-h SR95531 + TTX fluorescence recovery was accelerated when compared with untreated controls (n = 5 cultures; new set of age- and time-matched control experiments; significance indicated for averaged 65–80 min values). All traces represent fitted group data. (D) Changes in GFP-gephyrin cluster size following blockade of GABAAR activity in 1-week-old cultures. A significant decrease in cluster size was observed after 24 h but not after 12 h of SR95531 + TTX treatment (n = 12 cultures, each; 3 visual fields, i.e. single confocal image planes per culture).

To disclose whether changes in gephyrin dynamics accompany the diazepam-induced increase of mIPSC amplitudes observed in the 1-week-old slice cultures, we next performed FRAP experiments. Figure 5B shows that the FRAP of GFP-gephyrin clusters in these cultures was slowed, and the cluster size increased, after 12 h of diazepam treatment when compared with untreated cultures. These differences were significant, as indicated by comparing mean cluster sizes (P < 0.01) and averaged FRAP values sampled between 65 and 80 min (P < 0.05). Thus, the pharmacological potentiation of GABAARs caused changes in GFP-gephyrin re-incorporation that partially mimicked the differences observed between 1- and 4-weeks-old slice cultures.

To further corroborate these results, GABAARs were blocked in 1-week-old slice cultures by the GABAAR antagonist SR95531 (10 μM; Fig. 5C,D). In addition, TTX (1 μM) was added to eliminate effects resulting from changes in network activity, that is, to prevent an increase in excitatory drive due to disinhibition. While GFP-gephyrin cluster FRAP and size were not significantly affected by 12-h SR95531 + TTX (Fig. 5C, D), a 24-h treatment with SR95531 + TTX caused a significant increase in FRAP (P < 0.05 for averaged 65–80 min values; Fig. 5C) and a significant decrease in GFP-gephyrin cluster size (P < 0.05; Fig. 5D). Control experiments showed that incubations with TTX alone for 12 and 24 h did not significantly affect the fluorescence recovery of GFP-gephyrin (Supplementary Fig. S1A), although some tendency toward changed FRAP was observed during the early recovery phase. Similarly, the mean GFP-gephyrin cluster size was unaltered after prolonged TTX treatment (Supplementary Fig. S1A), suggesting that network activity does not play a major role in gephyrin cluster regulation in young slice cultures, at least within the 12–24-h treatment period used here. Taken together, these results disclosed a regulation of gephyrin cluster properties by GABAAR activity in 1-week-old slice cultures that is consistent with a Hebbian model of synaptic plasticity, according to which more active synapses are strengthened (Hebb 1949).

In Mature Slice Cultures GABAA Receptor Activity Regulates Synaptic Strength and Gephyrin Cluster Properties in a Homeostatic Manner

We next investigated whether a comparable regulation of postsynaptic gephyrin clusters by GABAAR activity is observed in mature slice cultures (Fig. 6). Acute treatment with diazepam resulted in a significant increase in the mean mIPSC amplitude of mature CA1 pyramidal neurons, as seen in young cultures (P < 0.01; Fig. 6A). However, after 12-h incubation with diazepam, this increase in amplitude was not observed when recording mIPSCs in the continued presence of diazepam. Moreover, the subsequent washout of diazepam revealed reduced mIPSC amplitudes (P < 0.05; Fig. 6A). Thus, the CA1 pyramidal neurons in 4-weeks-old slice cultures reacted to the prolonged diazepam potentiation of GABAergic inhibition with a compensatory decrease in inhibitory synaptic strength. This result is in line with previous reports (Poisbeau et al. 1997; Li et al. 2000) and concurs with the concept of homeostatic synaptic plasticity in response to chronic perturbations of synaptic activity (Pozo and Goda 2010; Turrigiano 2011).

Figure 6.

Homeostatic regulation by GABAA receptor activity of inhibitory synaptic strength and gephyrin cluster properties in mature slice cultures. (A) Mean mIPSC amplitudes of CA1 pyramidal neurons in 4-weeks-old entorhino-hippocampal slice cultures derived from Thy1-EGFPgephyrin mice were significantly increased upon the addition of diazepam (acute; 1 μM). This increase in amplitude was not observed after 12 h of diazepam treatment (recordings performed in the presence of diazepam). Subsequent washout of diazepam revealed a reduction in mIPSC amplitudes following prolonged diazepam treatment (diazepam [12 h] after washout; n = 6–10 neurons per group; 4 cultures each). (B) Recovery of GFP-gephyrin fluorescence in 4-weeks-old cultures treated with 1 μM diazepam for 12 h (n = 5 cultures; blue trace represents fitted group data) was accelerated when compared with untreated control cultures (red trace, age- and time-matched control values from Fig. 4) concomitant with a decrease in gephyrin cluster size (inset; n = 5 cultures; FRAP performed after the washout of diazepam; significance indicated for averaged 65–80 min values). (C) FRAP analysis of GFP-gephyrin clusters in 4-weeks-old cultures treated with SR95531 (10 μM) + TTX (1 μM) for 12 h (n = 5 cultures) and 24 h (n = 4 cultures), respectively. Note slowed fluorescence recovery in the presence of SR95531 + TTX when compared with untreated controls (n = 5 cultures; new set of age- and time-matched control experiments; significance indicated for averaged 65–80 min values). All traces represent fitted group data. (D) Changes in GFP-gephyrin cluster size following blockade of GABAAR activity in 4-weeks-old cultures. A significant increase in cluster size was observed after 24 h but not 12 h of SR95531 + TTX treatment (n = 8–12 cultures per group; 3 visual fields per culture).

Figure 6.

Homeostatic regulation by GABAA receptor activity of inhibitory synaptic strength and gephyrin cluster properties in mature slice cultures. (A) Mean mIPSC amplitudes of CA1 pyramidal neurons in 4-weeks-old entorhino-hippocampal slice cultures derived from Thy1-EGFPgephyrin mice were significantly increased upon the addition of diazepam (acute; 1 μM). This increase in amplitude was not observed after 12 h of diazepam treatment (recordings performed in the presence of diazepam). Subsequent washout of diazepam revealed a reduction in mIPSC amplitudes following prolonged diazepam treatment (diazepam [12 h] after washout; n = 6–10 neurons per group; 4 cultures each). (B) Recovery of GFP-gephyrin fluorescence in 4-weeks-old cultures treated with 1 μM diazepam for 12 h (n = 5 cultures; blue trace represents fitted group data) was accelerated when compared with untreated control cultures (red trace, age- and time-matched control values from Fig. 4) concomitant with a decrease in gephyrin cluster size (inset; n = 5 cultures; FRAP performed after the washout of diazepam; significance indicated for averaged 65–80 min values). (C) FRAP analysis of GFP-gephyrin clusters in 4-weeks-old cultures treated with SR95531 (10 μM) + TTX (1 μM) for 12 h (n = 5 cultures) and 24 h (n = 4 cultures), respectively. Note slowed fluorescence recovery in the presence of SR95531 + TTX when compared with untreated controls (n = 5 cultures; new set of age- and time-matched control experiments; significance indicated for averaged 65–80 min values). All traces represent fitted group data. (D) Changes in GFP-gephyrin cluster size following blockade of GABAAR activity in 4-weeks-old cultures. A significant increase in cluster size was observed after 24 h but not 12 h of SR95531 + TTX treatment (n = 8–12 cultures per group; 3 visual fields per culture).

To test whether changes in gephyrin exchange rate underlie the diazepam-induced reduction of mIPSC amplitudes, we also performed FRAP experiments on 4-weeks-old slice cultures. Figure 6B shows that a 12-h treatment with diazepam significantly accelerated the fluorescence recovery of GFP-gephyrin clusters when compared with untreated control cultures (P < 0.05). In addition, a significant reduction in GFP-gephyrin cluster size was found (P < 0.01; inset in Fig. 6B). These results suggested that GABAAR activity regulates gephyrin clustering at mature inhibitory postsynapses in a homeostatic manner.

To further corroborate a homeostatic regulatory mechanism, GABAARs were blocked by SR95531 (10 μM) + TTX (1 μM). In contrast to what was observed in 1-week-old cultures, at 4 weeks incubation with SR95531 + TTX for 12 h resulted in a significant reduction in GFP-gephyrin FRAP when compared with untreated control cultures (P < 0.05 for averaged 65–80 min values; Fig. 6C). This result is consistent with a compensatory increase in the fraction of stationary gephyrin upon the prolonged blockade of GABAAR activity. Similar to the results obtained with 1-week-old cultures, treatment with TTX alone for either 12 or 24 h did not significantly affect GFP-gephyrin FRAP and mean GFP-gephyrin cluster size (Supplementary Fig. S1B). Interestingly, GFP-gephyrin cluster size was also not significantly affected by 12-h SR95531 + TTX (Fig. 6D), indicating that changes in gephyrin exchange rate may precede changes in cluster size. In line with this interpretation, a 24-h treatment with SR95531 + TTX produced not only a further decrease in fluorescence recovery when compared with the 12-h treatment but also a highly significant increase in GFP-gephyrin cluster size (P < 0.001; Fig. 6D). Thus, GABAAR activity inversely regulates gephyrin cluster properties at mature inhibitory postsynapses, a mechanism which may serve to homeostatically adjust the strength of inhibitory postsynaptic currents to afferent GABAergic drive.

Discussion

The major finding of this study is that the developmental maturation of GABAergic postsynapses in an organotypic hippocampal slice preparation is characterized not only by a striking increase in inhibitory synaptic strength concomitantly with increases in gephyrin cluster size and stability, but in addition involves the acquisition of a mechanism that allows to homeostatically regulate gephyrin cluster properties in response to changes in GABAAR activity. In mature slice cultures, chronic diazepam potentiation of GABAARs resulted in a “down-scaling” of both gephyrin clusters and inhibitory transmission, while in young cultures, prolonged GABAARs activation caused the opposite changes. Our results disclose an interdependence between gephyrin scaffold properties and inhibitory synaptic strength. Furthermore, they suggest a yet unknown differentiation step in the postnatal maturation of the hippocampal network, which endows neurons with the ability to homeostatically adjust the strength of their inhibitory postsynapses in response to prolonged changes in afferent GABAergic drive.

To allow direct visualization of gephyrin clusters in individual living neurons, we generated transgenic mouse lines that express GFP-gephyrin under the control of the Thy1.2 promoter (Caroni 1997; Feng et al. 2000). In the Thy1-EGFPgephyrin line used here, GFP-gephyrin expression was observed in the neocortex, the hippocampus, brain stem, and spinal cord. Transgenic GFP-gephyrin expression did not detectably affect the morphology and functional properties of GABAergic synapses. Immunostaining of brain sections failed to reveal changes in the mean size and density of gephyrin clusters in GFP-gephyrin expressing mice when compared with non-expressing ones. Similarly, in patch-clamp recordings, we found no difference in mIPSC properties between GFP-gephyrin(+) and GFP-gephyrin(−) neurons. We assume this to reflect comparatively low levels of GFP-gephyrin expression that are within or close to inter-animal variance. Consistent with this view, the Thy1-EGFPgephyrin mice did not show gross behavioral abnormalities and bred normally.

For all in vitro experiments reported here, we used entorhino-hippocampal slice cultures prepared from the Thy1-EGFPgephyrin mice. In such organotypic cultures, neuronal networks are well-preserved (Frotscher et al. 1995; Gahwiler et al. 1997), and changes in synapse morphology and protein composition can be studied at high resolution under developmental as well as mature conditions (Li et al. 1995; Dailey and Smith 1996; Ziv and Smith 1996; Del Turco and Deller 2007). Here, patch-clamp recordings from CA1 pyramidal neurons in the slice cultures revealed that the frequency of GABAergic mIPSCs increased about 10-fold between 1 and 4 weeks in vitro. This likely reflects a presynaptic maturation step that may involve an increase in the vesicle pool and/or a higher vesicle release probability, since only the average size but not the density of VIAAT immunoreactive puncta increased during this period. Concomitantly, mean mIPSC amplitudes increased by about 50% together with a shortening of the average rise time and an 85% increase in mean GFP-gephyrin cluster area, whereas cluster density did not change. Our data are consistent with considerable growth of both pre- and postsynaptic compartments accompanying the functional maturation of GABAergic neurotransmission.

FRAP analysis disclosed that GFP-gephyrin clusters are dynamic structures at the 2 stages of in vitro development analyzed. The observed 30% recovery rates in the range of ∼5 to 30 min are in agreement with previous studies showing that gephyrin continuously enters and leaves postsynaptic sites (Hanus et al. 2006; Maas et al. 2006, 2009; Calamai et al. 2009). It should, however, be noted that the FRAP rates determined here are much longer than the average dwell time of GABAARs at the synapse as estimated by single-particle tracking, which in dissociated hippocampal neurons has been reported to be only a few seconds (Bannai et al. 2009). Such short residence times would support models in which inhibitory receptors associate with and dissociate from the postsynaptic gephyrin scaffold without attached gephyrin (Kirsch and Betz 1998; Bogdanov et al. 2006). However, FRAP experiments with pHluorin-tagged GABAAR subunits have disclosed considerably slower bulk recovery rates for synaptic GABAARs that lie within a similar time range as those determined here for GFP-gephyrin FRAP (Jacob et al. 2005). Also, an about 50% recovery of GABAergic mIPSCs after agonist-induced irreversible inhibition of synaptic GABAAR has been shown to require 10 min and proposed to depend on the dissociation of the blocked receptors from their postsynaptic anchoring sites as the limiting step in recovery (Thomas et al. 2005). These latter estimates of synaptic GABAAR mobility together with our GFP-gephyrin FRAP results are consistent with time-lapse imaging studies, suggesting that GABAARs enter and leave postsynaptic sites with gephyrin being bound (Maas et al. 2006).

Our developmental FRAP analysis revealed that the kinetics of GFP-gephyrin re-incorporation into individual clusters change between 1 and 4 weeks in culture. During this period of hippocampal neuron maturation, initial FRAP rates were slowed, and in the 4-weeks-old cultures, a major fraction of the bleached fluorescence failed to recover during our 80-min observation period. Apparently, the slowly exchanging “stationary” fraction of gephyrin within postsynaptic clusters increases during postnatal development. This can be attributed to reduced scaffold turnover, that is, a decrease in gephyrin dissociation and not association rate, since clusters grow whilst FRAP is slowing. In other words, synapse growth during postnatal development is associated with not only an enlargement of the postsynaptic gephyrin scaffold but also a substantial increase in its stability. Both changes may provide for more efficient receptor trapping and, thereby, enhance the efficiency of inhibitory neurotransmission. It should, however, be emphasized that, although being nicely correlated during development, gephyrin cluster size and stability are not strictly coupled. In both 1- and 4-weeks-old cultures, the FRAP rates of individual clusters proved to be independent of their size. Thus, the stationary fraction of gephyrin within a single cluster is not determined by cluster size. This excludes models of postsynaptic scaffold stabilization, in which the developmental increase in the stationary fraction of gephyrin would simply reflect gephyrin recruitment to and dissociation from postsynaptic clusters occurring only at the cluster periphery, that is, the increasing area-to-circumference ratio resulting from cluster growth. Clearly more specific mechanisms, such as selective protein interactions and/or modifications leading to a denser packing of the scaffold or its tighter interaction with the cytoskeleton must underlie the stabilization of gephyrin clusters occurring postnatally.

A central finding of the present study was the observation that gephyrin scaffolds are regulated inversely by afferent GABAergic synaptic activity in mature slice cultures, while in young cultures, such compensatory regulation was not observed. In 1-week-old cultures, GABAAR potentiation by diazepam for 12 h increased both the size and the stationary fraction of gephyrin clusters as well as mean mIPSC amplitudes, whereas a 24-h incubation with the GABAAR antagonist SR95531 caused a reduction in gephyrin cluster size and increased FRAP. These results obtained with the young slice cultures are in agreement with the activity dependence of inhibitory synapse maturation seen in GABAAR deficient mice (Patrizi et al. 2008) and in animals with a conditional knockdown of glutamate decarboxylase 67 (GAD-67) in basket interneurons (Chattopadhyaya et al. 2007). Thus, after 1-week in vitro enhanced synaptic activity led to larger and more stable inhibitory postsynapses, obeying the rules of synaptic strengthening proposed by Hebb (1949). In contrast, in 4-weeks-old cultures, the same diazepam treatment reduced gephyrin cluster size and increased fluorescence recovery together with a decrease in mean mIPSC amplitude. Inversely, when these 4-weeks-old cultures were treated with SR95531 for 24 h, both the size and the stability of the GFP-gephyrin clusters increased. These results indicate that in mature hippocampal neurons changes in GABAergic transmission affect the size and stability of gephyrin clusters in a way that adjusts synaptic strength in a homeostatic manner. This observation is consistent with recent electrophysiological and immunocytochemical data from dissociated hippocampal neurons that demonstrated homeostatic changes in mIPSC properties as well as in the size of GABAAR clusters and presynaptic GAD-65 puncta upon prolonged depolarization (see also Kilman et al. 2002; Hartman et al. 2006; Maffei et al. 2006; Rannals and Kapur 2011). Apparently, CA1 pyramidal neurons of entorhino-hippocampal slice cultures acquire postnatally the ability to adjust their inhibitory synaptic strength in a homeostatic manner. This mechanism, which involves the activity-dependent regulation of gephyrin scaffolds, may serve to adjust and maintain the stability of the inhibitory network following its postnatal maturation.

The molecular mechanisms that regulate the size and stability of gephyrin clusters at synaptic sites remain poorly understood. Different interacting proteins, for example, neuroligin 2 (Poulopoulos et al. 2009) and collybistin (Papadopoulos et al. 2007), have been implicated in gephyrin deposition and maintenance at inhibitory synapses. As discussed elsewhere (Kneussel and Betz 2000), synaptic signaling pathways triggered by Ca2+ influx (Kirsch and Betz 1998), such as Ca2+-dependent phosphorylation/dephosphorylation reactions (Bannai et al. 2009), may regulate inhibitory postsynaptic scaffold dynamics and thereby control GABAAR recruitment and internalization rates. Recently, abolition of gephyrin phosphorylation by glycogen synthase kinase 3β at serine residue 270 was reported to increase gephyrin cluster densities and mIPSC frequencies in dissociated hippocampal neurons (Tyagarajan et al. 2011). The same study also showed that the inhibition of the Ca2+-activated protease calpain-1 by calpastatin-enhanced gephyrin cluster number but not size. Calpain-1–mediated degradation of gephyrin is, however, unlikely to cause the reduction in gephyrin cluster size observed upon diazepam treatment of the 4-weeks-old slice cultures, since in our cultures, GABA currents were hyperpolarizing (for a recent review on excitatory effects of GABA see Bregestovski and Bernard 2012), and hence diazepam should decrease Ca2+ influx (e.g. Ben-Ari et al. 1989; Ganguly et al. 2001; Tyzio et al. 2007). We therefore propose that the homeostatic regulation of gephyrin cluster properties involves changes in gephyrin's oligomerization/dissociation rather than synthesis/degradation rates.

The maturation step through which cultured CA1 pyramidal neurons in organotypic slice cultures acquire the capacity to regulate inhibitory synaptic strength in a homeostatic manner remains to be determined. It is interesting to speculate that changes known to affect GABAergic neurotransmission during postnatal development, such as changes in KCC2 expression (Blaesse et al. 2009), could be involved in this process. A systematic comparison of the differences in mRNA and protein expression levels between 1- and 4-weeks-old slice cultures may allow to identify novel candidate regulatory molecules involved in the homeostatic plasticity of inhibitory postsynapses. The Thy1-EGFPgephyrin mice described here may be a useful system to address these and other questions in future work.

Supplementary Material

Supplementary material can be found at:http://www.cercor.oxfordjournals.org/.

Funding

This work was supported by the Max-Planck Society and Deutsche Forschungsgemeinschaft (EXC 115 to H. B. and DFG DE 551/10-1 to T.D.). A.V. was supported by a Young Investigators Grant (Faculty of Medicine, Goethe-University Frankfurt) and S.R.A. was supported by the International Max-Planck Research School, Frankfurt.

Notes

We thank Dr Gregory O'Sullivan for help with initiating this project and comments on an earlier version of this manuscript, Dr Pico Caroni for kindly providing the mouse Thy1.2 expression cassette, Dr Jeong-Seop Rhee for help with the curve fitting analysis, Dr Gaby Schneider for assistance in statistics, and Charlotte Nolte-Uhl, Nadine Zahn, Belquis Nassim-Assir, and Ina Bartnik for excellent technical assistance. Conflict of Interest: None declared.

References

Bannai
H
Levi
S
Schweizer
C
Inoue
T
Launey
T
Racine
V
Sibarita
JB
Mikoshiba
K
Triller
A
Activity-dependent tuning of inhibitory neurotransmission based on GABAAR diffusion dynamics
Neuron
 , 
2009
, vol. 
62
 (pg. 
670
-
682
)
Bas Orth
C
Vlachos
A
Del Turco
D
Burbach
GJ
Haas
CA
Mundel
P
Feng
G
Frotscher
M
Deller
T
Lamina-specific distribution of Synaptopodin, an actin-associated molecule essential for the spine apparatus, in identified principal cell dendrites of the mouse hippocampus
J Comp Neurol
 , 
2005
, vol. 
487
 (pg. 
227
-
239
)
Bausen
M
Fuhrmann
JC
Betz
H
O'Sullivan
GA
The state of the actin cytoskeleton determines its association with gephyrin: role of ena/VASP family members
Mol Cell Neurosci
 , 
2006
, vol. 
31
 (pg. 
376
-
386
)
Bausen
M
Weltzien
F
Betz
H
O'Sullivan
GA
Regulation of postsynaptic gephyrin cluster size by protein phosphatase 1
Mol Cell Neurosci
 , 
2010
, vol. 
44
 (pg. 
201
-
209
)
Ben-Ari
Y
Cherubini
E
Corradetti
R
Gaiarsa
JL
Giant synaptic potentials in immature rat CA3 hippocampal neurones
J Physiol
 , 
1989
, vol. 
416
 (pg. 
303
-
325
)
Ben-Ari
Y
Gaiarsa
JL
Tyzio
R
Khazipov
R
GABA: a pioneer transmitter that excites immature neurons and generates primitive oscillations
Physiol Rev
 , 
2007
, vol. 
87
 (pg. 
1215
-
1284
)
Blaesse
P
Airaksinen
MS
Rivera
C
Kaila
K
Cation-chloride cotransporters and neuronal function
Neuron
 , 
2009
, vol. 
61
 (pg. 
820
-
838
)
Bogdanov
Y
Michels
G
Armstrong-Gold
C
Haydon
PG
Lindstrom
J
Pangalos
M
Moss
SJ
Synaptic GABAA receptors are directly recruited from their extrasynaptic counterparts
EMBO J
 , 
2006
, vol. 
25
 (pg. 
4381
-
4389
)
Bregestovski
P
Bernard
C
Excitatory GABA: how a correct observation may turn out to be an experimental artifact
Front Pharmacol
 , 
2012
, vol. 
3
 pg. 
65
 
Calamai
M
Specht
CG
Heller
J
Alcor
D
Machado
P
Vannier
C
Triller
A
Gephyrin oligomerization controls GlyR mobility and synaptic clustering
J Neurosci
 , 
2009
, vol. 
29
 (pg. 
7639
-
7648
)
Caroni
P
Overexpression of growth-associated proteins in the neurons of adult transgenic mice
J Neurosci Methods
 , 
1997
, vol. 
71
 (pg. 
3
-
9
)
Charrier
C
Ehrensperger
MV
Dahan
M
Levi
S
Triller
A
Cytoskeleton regulation of glycine receptor number at synapses and diffusion in the plasma membrane
J Neurosci
 , 
2006
, vol. 
26
 (pg. 
8502
-
8511
)
Chattopadhyaya
B
Di Cristo
G
Wu
CZ
Knott
G
Kuhlman
S
Fu
Y
Palmiter
RD
Huang
ZJ
GAD67-mediated GABA synthesis and signaling regulate inhibitory synaptic innervation in the visual cortex
Neuron
 , 
2007
, vol. 
54
 (pg. 
889
-
903
)
Colin
I
Rostaing
P
Triller
A
Gephyrin accumulates at specific plasmalemma loci during neuronal maturation in vitro
J Comp Neurol
 , 
1996
, vol. 
374
 (pg. 
467
-
479
)
Dahan
M
Levi
S
Luccardini
C
Rostaing
P
Riveau
B
Triller
A
Diffusion dynamics of glycine receptors revealed by single-quantum dot tracking
Science
 , 
2003
, vol. 
302
 (pg. 
442
-
445
)
Dailey
ME
Smith
SJ
The dynamics of dendritic structure in developing hippocampal slices
J Neurosci
 , 
1996
, vol. 
16
 (pg. 
2983
-
2994
)
Del Turco
D
Deller
T
Organotypic entorhino-hippocampal slice cultures–a tool to study the molecular and cellular regulation of axonal regeneration and collateral sprouting in vitro
Methods Mol Biol
 , 
2007
, vol. 
399
 (pg. 
55
-
66
)
Dobie
FA
Craig
AM
Inhibitory synapse dynamics: coordinated presynaptic and postsynaptic mobility and the major contribution of recycled vesicles to new synapse formation
J Neurosci
 , 
2011
, vol. 
31
 (pg. 
1048
-
1093
)
Essrich
C
Lorez
M
Benson
JA
Fritschy
JM
Luscher
B
Postsynaptic clustering of major GABAA receptor subtypes requires the gamma 2 subunit and gephyrin
Nat Neurosci
 , 
1998
, vol. 
1
 (pg. 
563
-
571
)
Feng
G
Mellor
RH
Bernstein
M
Keller-Peck
C
Nguyen
QT
Wallace
M
Nerbonne
JM
Lichtman
JW
Sanes
JR
Imaging neuronal subsets in transgenic mice expressing multiple spectral variants of GFP
Neuron
 , 
2000
, vol. 
28
 (pg. 
41
-
51
)
Feng
G
Tintrup
H
Kirsch
J
Nichol
MC
Kuhse
J
Betz
H
Sanes
JR
Dual requirement for gephyrin in glycine receptor clustering and molybdoenzyme activity
Science
 , 
1998
, vol. 
282
 (pg. 
1321
-
1324
)
Frotscher
M
Zafirov
S
Heimrich
B
Development of identified neuronal types and of specific synaptic connections in slice cultures of rat hippocampus
Prog Neurobiol
 , 
1995
, vol. 
45
 (pg. 
7
-
28
)
Fuhrmann
JC
Kins
S
Rostaing
P
El Far
O
Kirsch
J
Sheng
M
Triller
A
Betz
H
Kneussel
M
Gephyrin interacts with Dynein light chains 1 and 2, components of motor protein complexes
J Neurosci
 , 
2002
, vol. 
22
 (pg. 
5393
-
5402
)
Gahwiler
BH
Capogna
M
Debanne
D
McKinney
RA
Thompson
SM
Organotypic slice cultures: a technique has come of age
Trends Neurosci
 , 
1997
, vol. 
20
 (pg. 
471
-
477
)
Ganguly
K
Schinder
AF
Wong
ST
Poo
M
GABA itself promotes the developmental switch of neuronal GABAergic responses from excitation to inhibition
Cell
 , 
2001
, vol. 
105
 (pg. 
521
-
532
)
Hanus
C
Ehrensperger
MV
Triller
A
Activity-dependent movements of postsynaptic scaffolds at inhibitory synapses
J Neurosci
 , 
2006
, vol. 
26
 (pg. 
4586
-
4595
)
Hartman
KN
Pal
SK
Burrone
J
Murthy
VN
Activity-dependent regulation of inhibitory synaptic transmission in hippocampal neurons
Nat Neurosci
 , 
2006
, vol. 
9
 (pg. 
642
-
649
)
Hebb
DO
The organization of behavior
 , 
1949
New York
Wiley
Herweg
J
Schwarz
G
Splice-specific glycine receptor binding, folding, and phosphorylation of the scaffolding protein gephyrin
J Biol Chem
 , 
2012
, vol. 
287
 (pg. 
12645
-
12656
)
Jacob
TC
Bogdanov
YD
Magnus
C
Saliba
RS
Kittler
JT
Haydon
PG
Moss
SJ
Gephyrin regulates the cell surface dynamics of synaptic GABAA receptors
J Neurosci
 , 
2005
, vol. 
25
 (pg. 
10469
-
10478
)
Jedlicka
P
Hoon
M
Papadopoulos
T
Vlachos
A
Winkels
R
Poulopoulos
A
Betz
H
Deller
T
Brose
N
Varoqueaux
F
Increased dentate gyrus excitability in neuroligin-2-deficient mice in vivo
Cereb Cortex
 , 
2011
, vol. 
21
 (pg. 
357
-
367
)
Kilman
V
van Rossum
MC
Turrigiano
GG
Activity deprivation reduces miniature IPSC amplitude by decreasing the number of postsynaptic GABA(A) receptors clustered at neocortical synapses
J Neurosci
 , 
2002
, vol. 
22
 (pg. 
1328
-
37
)
Kirsch
J
Betz
H
Glycine-receptor activation is required for receptor clustering in spinal neurons
Nature
 , 
1998
, vol. 
392
 (pg. 
717
-
720
)
Kirsch
J
Betz
H
The postsynaptic localization of the glycine receptor-associated protein gephyrin is regulated by the cytoskeleton
J Neurosci
 , 
1995
, vol. 
15
 (pg. 
4148
-
4156
)
Kirsch
J
Betz
H
Widespread expression of gephyrin, a putative glycine receptor-tubulin linker protein, in rat brain
Brain Res
 , 
1993
, vol. 
621
 (pg. 
301
-
310
)
Kneussel
M
Betz
H
Clustering of inhibitory neurotransmitter receptors at developing postsynaptic sites: the membrane activation model
Trends Neurosci
 , 
2000
, vol. 
23
 (pg. 
429
-
435
)
Kneussel
M
Brandstatter
JH
Laube
B
Stahl
S
Muller
U
Betz
H
Loss of postsynaptic GABA(A) receptor clustering in gephyrin-deficient mice
J Neurosci
 , 
1999
, vol. 
19
 (pg. 
9289
-
9297
)
Levi
S
Schweizer
C
Bannai
H
Pascual
O
Charrier
C
Triller
A
Homeostatic regulation of synaptic GlyR numbers driven by lateral diffusion
Neuron
 , 
2008
, vol. 
59
 (pg. 
261
-
273
)
Li
D
Field
PM
Raisman
G
Failure of axon regeneration in postnatal rat entorhinohippocampal slice coculture is due to maturation of the axon, not that of the pathway or target
Eur J Neurosci
 , 
1995
, vol. 
7
 (pg. 
1164
-
1171
)
Li
M
Szabo
A
Rosenberg
HC
Down-regulation of benzodiazepine binding to alpha 5 subunit-containing gamma-aminobutyric Acid(A) receptors in tolerant rat brain indicates particular involvement of the hippocampal CA1 region
J Pharmacol Exp Ther
 , 
2000
, vol. 
295
 (pg. 
689
-
696
)
Luria
AR
The nature of human conflicts
 , 
1932
New York
Liveright Publishers
 
Chapter 1
Lüscher
B
Fuchs
T
Kilpatrick
CL
GABAA receptor trafficking-mediated plasticity of inhibitory synapses
Neuron
 , 
2011
, vol. 
70
 (pg. 
385
-
409
)
Maas
C
Belgardt
D
Lee
HK
Heisler
FF
Lappe-Siefke
C
Magiera
MM
van Dijk
J
Hausrat
TJ
Janke
C
Kneussel
M
Synaptic activation modifies microtubules underlying transport of postsynaptic cargo
Proc Natl Acad Sci USA
 , 
2009
, vol. 
106
 (pg. 
8731
-
8736
)
Maas
C
Tagnaouti
N
Loebrich
S
Behrend
B
Lappe-Siefke
C
Kneussel
M
Neuronal cotransport of glycine receptor and the scaffold protein gephyrin
J Cell Biol
 , 
2006
, vol. 
172
 (pg. 
441
-
451
)
Maffei
A
Nataraj
K
Nelson
SB
Turrigiano
GG
Potentiation of cortical inhibition by visual deprivation
Nature
 , 
2006
, vol. 
443
 (pg. 
81
-
84
)
Mason
MJ
Simpson
AK
Mahaut-Smith
MP
Robinson
HP
The interpretation of current-clamp recordings in the cell-attached patchclamp configuration
Biophys J
 , 
2005
, vol. 
88
 (pg. 
739
-
750
)
Meier
J
Vannier
C
Serge
A
Triller
A
Choquet
D
Fast and reversible trapping of surface glycine receptors by gephyrin
Nat Neurosci
 , 
2001
, vol. 
4
 (pg. 
253
-
260
)
Meyer
G
Kirsch
J
Betz
H
Langosch
D
Identification of a gephyrin binding motif on the glycine receptor beta subunit
Neuron
 , 
1995
, vol. 
15
 (pg. 
563
-
572
)
Papadopoulos
T
Korte
M
Eulenburg
V
Kubota
H
Retiounskaia
M
Harvey
RJ
Harvey
K
O'Sullivan
GA
Laube
B
Hulsmann
S
Impaired GABAergic transmission and altered hippocampal synaptic plasticity in collybistin-deficient mice
EMBO J
 , 
2007
, vol. 
26
 (pg. 
3888
-
3899
)
Patrizi
A
Scelfo
B
Viltono
L
Briatore
F
Fukaya
M
Watanabe
M
Strata
P
Varoqueaux
F
Brose
N
Fritschy
JM
Synapse formation and clustering of neuroligin-2 in the absence of GABAA receptors
Proc Natl Acad Sci USA
 , 
2008
, vol. 
105
 (pg. 
13151
-
13156
)
Perkins
KL
Cell-attached voltage-clamp and current-clamp recording and stimulation techniques in brain slices
J Neurosci Methods
 , 
2006
, vol. 
154
 (pg. 
1
-
18
)
Poisbeau
P
Williams
SR
Mody
I
Silent GABAA synapses during flurazepam withdrawal are region-specific in the hippocampal formation
J Neurosci
 , 
1997
, vol. 
17
 (pg. 
3467
-
3475
)
Poulopoulos
A
Aramuni
G
Meyer
G
Soykan
T
Hoon
M
Papadopoulos
T
Zhang
M
Paarmann
I
Fuchs
C
Harvey
K
Neuroligin 2 drives postsynaptic assembly at perisomatic inhibitory synapses through gephyrin and collybistin
Neuron
 , 
2009
, vol. 
63
 (pg. 
628
-
642
)
Pozo
K
Goda
Y
Unraveling mechanisms of homeostatic synaptic plasticity
Neuron
 , 
2010
, vol. 
66
 (pg. 
337
-
351
)
Prior
P
Schmitt
B
Grenningloh
G
Pribilla
I
Multhaup
G
Beyreuther
K
Maulet
Y
Werner
P
Langosch
D
Kirsch
J
Primary structure and alternative splice variants of gephyrin, a putative glycine receptor-tubulin linker protein
Neuron
 , 
1992
, vol. 
8
 (pg. 
1161
-
1170
)
Rannals
MD
Kapur
J
Homeostatic strengthening of inhibitory synapses is mediated by the accumulation of GABA(A) receptors
J Neurosci
 , 
2011
, vol. 
31
 (pg. 
17701
-
12
)
Saiyed
T
Paarmann
I
Schmitt
B
Haeger
S
Sola
M
Schmalzing
G
Weissenhorn
W
Betz
H
Molecular basis of gephyrin clustering at inhibitory synapses: role of G- and E-domain interactions
J Biol Chem
 , 
2007
, vol. 
282
 (pg. 
5625
-
5632
)
Sola
M
Bavro
VN
Timmins
J
Franz
T
Ricard-Blum
S
Schoehn
G
Ruigrok
RW
Paarmann
I
Saiyed
T
O'Sullivan
GA
Structural basis of dynamic glycine receptor clustering by gephyrin
EMBO J
 , 
2004
, vol. 
23
 (pg. 
2510
-
2519
)
Thomas
P
Mortensen
M
Hosie
AM
Smart
TG
Dynamic mobility of functional GABAA receptors at inhibitory synapses
Nat Neurosci
 , 
2005
, vol. 
8
 (pg. 
889
-
897
)
Tretter
V
Kerschner
B
Milenkovic
I
Ramsden
SL
Ramerstorfer
J
Saiepour
L
Maric
HM
Moss
SJ
Schindelin
H
Harvey
RJ
Molecular basis of the GABAA receptor {alpha}3 subunit interaction with gephyrin
J Biol Chem
 , 
2011
, vol. 
43
 (pg. 
37702
-
37711
)
Turrigiano
G
Too many cooks? Intrinsic and synaptic homeostatic mechanisms in cortical circuit refinement
Annu Rev Neurosci
 , 
2011
, vol. 
34
 (pg. 
89
-
103
)
Tyagarajan
SK
Ghosh
H
Yevenes
GE
Nikonenko
I
Ebeling
C
Schwerdel
C
Sidler
C
Zeilhofer
HU
Gerrits
B
Muller
D
Regulation of GABAergic synapse formation and plasticity by GSK3beta-dependent phosphorylation of gephyrin
Proc Natl Acad Sci USA
 , 
2011
, vol. 
108
 (pg. 
379
-
384
)
Tyzio
R
Holmes
GL
Ben-Ari
Y
Khazipov
R
Timing of the developmental switch in GABAA mediated signaling from excitation to inhibition in CA3 rat hippocampus using gramicidin perforated patch and extracellular recording
Epilepsia
 , 
2007
, vol. 
48
 (pg. 
96
-
105
)
Ziv
NE
Smith
SJ
Evidence for a role of dendritic filopodia in synaptogenesis and spine formation
Neuron
 , 
1996
, vol. 
17
 (pg. 
91
-
102
)

Author notes

A.V. and S.R.-A. contributed equally to this work.
T.D. and H.B. are joint senior authors.
This paper is dedicated to Professor Jean-Pierre Changeux on the occasion of his 75th birthday.