Abstract

We describe a case of relapsed paratyphoid fever in which the isolate had reduced susceptibility to ciprofloxacin due to a rare mutation within the gyrA gene. 18Fluorodeoxyglucose positron emission tomography scanning identified deep-seated infection including unsuspected aortitis and highlights the utility of novel imaging techniques to improve our understanding and treatment of this disease.

A 47-year-old resident of the United Kingdom presented with fever, abdominal discomfort, and altered bowel habit 3 months after returning from India, where she had visited Hyderabad, Delhi, and Mumbai. Salmonella enterica serotype Paratyphi A was isolated from her stool. She received a 10-day course of ciprofloxacin (1 g per day) with some apparent clinical improvement in her condition. However, 1 week after completing therapy, she presented to our hospital with recurrent symptoms and worsening lower back pain. S. Paratyphi A was subsequently isolated from blood cultures, and relapsed paratyphoid fever was diagnosed. Although the isolate appeared to be susceptible to ciprofloxacin on standard disc diffusion testing [1], it was resistant to nalidixic acid. This finding prompted measurement of the MIC of ciprofloxacin by E-test (AB Biodisk), which revealed reduced susceptibility (MIC, 0.25 µg/mL). The patient's original stool isolate, processed at a different hospital, was not tested with a nalidixic acid disc. Both isolates were sensitive to ceftriaxone, ampicillin, gentamicin, trimethoprim, and imipenem.

Although the relapse of this patient's disease was originally believed to be caused by the inappropriate prescription of ciprofloxacin, the patient's worsening back pain also suggested vertebral osteomyelitis. Plain spinal radiography, MRI, and technetium bone scanning revealed no evidence of deep-seated infection. Two days after a normal gadolinium-enhanced spinal MRI scan, an 18fluorodeoxyglucose positron emission tomography scan (18fluorodeoxyglucose is a glucose analogue known to be taken up by activated macrophages and neutrophils) revealed clear evidence of vertebral osteomyelitis (figure 1A) and an aortitis (figure 1B) that was unsuspected and undetectable clinically. Treatment was initiated with 3 weeks of intravenous ceftriaxone (2 g per day) and followed by 2 months of treatment with oral ofloxacin (800 mg per day) plus amoxicillin (3 g per day), after which complete clinical recovery was achieved. Repeat positron emission tomography scans showed considerable improvement of both aortitis and osteomyelitis at 6 weeks and resolution of changes by 3 months.

Figure 1

18Fluorodeoxyglucose positron emission tomography scan showing enhanced uptake in lumbar vertebrae (A) and aorta (B).

Figure 1

18Fluorodeoxyglucose positron emission tomography scan showing enhanced uptake in lumbar vertebrae (A) and aorta (B).

Globally, 75% of cases of enteric fever are caused by Salmonella enterica serotype Typhi. S. Paratyphi A is increasingly isolated in India [2], and in some regions of China it is emerging as the most frequent cause of enteric fever [3]. A significant minority of all patients with enteric fever experience relapse after treatment [4]. Relapsed disease can cause significant morbidity, an increased mortality, and may contribute to the development of drug resistance. However, the causes of relapse can be difficult to identify.

An important factor in treatment failure is unrecognized antibiotic resistance. Reduced susceptibility to ciprofloxacin has been recognized in both S. Typhi [5] and S. Paratyphi A [5], especially in isolates from India and elsewhere in Asia where the incidence of antibiotic resistance continues to rise. Resistance to nalidixic acid is recognized as a good predictor of a reduced susceptibility to ciprofloxacin [5] and treatment failure with fluoroquinolones [6].

Such low-level resistance is often associated with mutation within the quinolone—resistance determining region of the bacterial gyrA gene [6]. Amplification by PCR of this isolate's quinolone—resistance determining region was performed using the oligonucleotides gyrA-P1 (TGTCCGAGATGGCCTGAAGC) and gyrA-P2 (TACCGTCATAGTTATCCACG) [7]. Sequencing was performed using an ABI Prism dye terminator cycle sequencing kit (Perkin Elmer) and an ABI 3730 automated sequencer [8]. This revealed a single point mutation in the gyrA gene (Ser83Tyr), compared with a susceptible isolate. Although reported frequently in other serotypes of Salmonella [9], this mutation is rarely associated with reduced quinolone susceptibility in S. Paratyphi A [10].

This case reinforces the importance of routine testing for both S. Typhi and S. Paratyphi A isolates for nalidixic acid resistance and the need for formal determination of the MIC for the quinolone chosen as treatment, particularly in individuals who have travelled to areas of the world where these organisms have been observed to have increasing drug resistance. If the MIC of ciprofloxacin is ⩾0.125µg/mL, consideration should be given to alternative treatments, including cephalosporins [11], azithromycin, or newer quinolones [12].

Reduced ciprofloxacin sensitivity may not be the only factor in the relapse of this patient's illness. In 1 study of nalidixic acid—resistant S. Typhi isolates [6], only a minority of cases treated with short-course ofloxacin relapsed, suggesting that factors other than drug sensitivity are also important. Undiagnosed deep-seated disease is likely to be one such factor. In this case, 18fluorodeoxyglucose positron emission tomography imaging was more sensitive than MRI for the detection of osteomyelitis, and this supports experiences in different settings with other pathogens [13, 14]. More importantly, perhaps, is that positron emission tomography imaging was able to detect a clinically unsuspected aortitis. Aortitis is often very hard to detect clinically and may only be identified postmortem. CT scanning and MRI are able to detect aneurismal dilatation, but such infections are well established, and often major surgery and prolonged courses of antibiotics are required [15], with the estimated mortality in nontyphoidal salmonellosis determined to be 14%–60% [16]. Early recognition and treatment of aortitis could prevent disease relapse, disease progression, and even death.

These images not only provide a novel insight into disease pathogenesis and relapse, but also show that where available, such imaging could influence clinical management and provide a rational basis for deciding the duration of treatment. Taken together, the radiological, clinical, and microbiological details provide unusual insight into the complexity of disease relapse for a single patient.

Acknowledgments

Potential conflicts of interest. All authors: no conflicts.

References

1
Andrews
JM
BSAC standardized disc susceptibility testing method
J Antimicrob Chemother
 , 
2001
, vol. 
48
 
Suppl 1
(pg. 
43
-
57
)
2
Sood
S
Kapil
A
Dash
N
Das
BK
Goel
V
Seth
P
Paratyphoid fever in India: an emerging problem
Emerg Infect Dis
 , 
1999
, vol. 
5
 (pg. 
483
-
4
)
3
Jin
Y
An analysis of S. Paratyphi A and S. Typhi prevalence in Guangxi autonomous region between 1994–2002
Chinese Tropical Medicine
 , 
2004
, vol. 
4
 (pg. 
177
-
80
)
4
Parry
CM
Hien
TT
Dougan
G
White
NJ
Farrar
JJ
Typhoid fever
N Engl J Med
 , 
2002
, vol. 
347
 (pg. 
1770
-
82
)
5
Threlfall
EJ
Skinner
JA
Ward
LR
Detection of decreased in vitro susceptibility to ciprofloxacin in Salmonella enterica serotypes Typhi and Paratyphi A
J Antimicrob Chemother
 , 
2001
, vol. 
48
 (pg. 
740
-
1
)
6
Wain
J
Hoa
NT
Chinh
NT
, et al.  . 
Quinolone-resistant Salmonella Typhi in Viet Nam: molecular basis of resistance and clinical response to treatment
Clin Infect Dis
 , 
1997
, vol. 
25
 (pg. 
1404
-
10
)
7
Griggs
DJ
Gensberg
K
Piddock
LJ
Mutations in gyrA gene of quinolone-resistant Salmonella serotypes isolated from humans and animals
Antimicrob Agents Chemother
 , 
1996
, vol. 
40
 (pg. 
1009
-
13
)
8
Parkhill
J
Dougan
G
James
KD
, et al.  . 
Complete genome sequence of a multiple drug resistant Salmonella enterica serovar Typhi CT18
Nature
 , 
2001
, vol. 
413
 (pg. 
848
-
52
)
9
Reyna
F
Huesca
M
Gonzalez
V
Fuchs
LY
Salmonella Typhimurium gyrA mutations associated with fluoroquinolone resistance
Antimicrob Agents Chemother
 , 
1995
, vol. 
39
 (pg. 
1621
-
3
)
10
Renuka
K
Kapil
A
Kabra
SK
, et al.  . 
Reduced susceptibility to ciprofloxacin and gyrA gene mutation in North Indian strains of Salmonella enterica serotype Typhi and serotype Paratyphi A
Microb Drug Resist
 , 
2004
, vol. 
10
 (pg. 
146
-
53
)
11
Parry
CM
The treatment of multidrug-resistant and nalidixic acid-resistant typhoid fever in Viet Nam
Trans R Soc Trop Med Hyg
 , 
2004
, vol. 
98
 (pg. 
413
-
22
)
12
Chinh
NT
Parry
CM
Ly
NT
, et al.  . 
A randomized controlled comparison of azithromycin and ofloxacin for treatment of multidrug-resistant or nalidixic acid-resistant enteric fever
Antimicrob Agents Chemother
 , 
2000
, vol. 
44
 (pg. 
1855
-
9
)
13
Kalicke
T
Schmitz
A
Risse
JH
, et al.  . 
Fluorine-18 fluorodeoxyglucose PET in infectious bone diseases: results of histologically confirmed cases
Eur J Nucl Med
 , 
2000
, vol. 
27
 (pg. 
524
-
8
)
14
Chacko
TK
Zhuang
H
Nakhoda
KZ
Moussavian
B
Alavi
A
Applications of fluorodeoxyglucose positron emission tomography in the diagnosis of infection
Nucl Med Commun
 , 
2003
, vol. 
24
 (pg. 
615
-
24
)
15
Soravia-Dunand
VA
Loo
VG
Salit
IE
Aortitis due to Salmonella: report of 10 cases and comprehensive review of the literature
Clin Infect Dis
 , 
1999
, vol. 
29
 (pg. 
862
-
8
)
16
Pegues
DA
Ohl
ME
Miller
SI
Mandell
GL
Salmonella species, including Salmonella Typhi
Principles and practice of infectious diseases
 , 
2005
Philadelphia, PA
Elsevier
(pg. 
2636
-
54
)

Comments

0 Comments