Antibody Detection and Dynamic Characteristics in Patients With Coronavirus Disease 2019

Abstract

Background

The coronavirus disease 2019 (COVID-19), caused by infection with the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), has been rapidly spreading nationwide and abroad. A serologic test to identify antibody dynamics and response to SARS-CoV-2 was developed.

Methods

The antibodies against SARS-CoV-2 were detected by an enzyme-linked immunosorbent assay based on the recombinant nucleocapsid protein of SARS-CoV-2 in patients with confirmed or suspected COVID-19 at 3–40 days after symptom onset. The gold standard for COVID-19 diagnosis was nucleic acid testing for SARS-CoV-2 by real-time reverse-transcription polymerase chain reaction (rRT-PCR). The serodiagnostic power of the specific immunoglobulin M (IgM) and immunoglobulin G (IgG) antibodies against SARS-CoV-2 was investigated in terms of sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), and consistency rate.

Results

The seroconversion of specific IgM and IgG antibodies were observed as early as the fourth day after symptom onset. In the patients with confirmed COVID-19, sensitivity, specificity, PPV, NPV, and consistency rate of IgM were 77.3% (51/66), 100%, 100%, 80.0%, and 88.1%, respectively, and those of IgG were 83.3% (55/66), 95.0%, 94.8%, 83.8%, and 88.9%. In patients with suspected COVID-19, sensitivity, specificity, PPV, NPV, and consistency rate of IgM were 87.5% (21/24), 100%, 100%, 95.2%, and 96.4%, respectively, and those of IgG were 70.8% (17/24), 96.6%, 85.0%, 89.1%, and 88.1%. Both antibodies performed well in serodiagnosis for COVID-19 and rely on great specificity.

Conclusions

The antibodies against SARS-CoV-2 can be detected in the middle and later stages of the illness. Antibody detection may play an important role in the diagnosis of COVID-19 as a complementary approach to viral nucleic acid assays.

SARS-CoV-2, COVID-19, serological test, ELISA, diagnosis

(See the Editorial Commentary by Stowell and Guarner on pages 1935–6.)

A novel coronavirus disease (coronavirus disease 2019 [COVID-19]) was first identified and broke out in Wuhan City, Hubei Province, China. A total of 93 090 cases of COVID-19 had occurred globally by 5 March 2020 [1]. Accurate and fast diagnosis of the causative severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is important to isolate patients with COVID-19 quickly and stop the epidemic, as well as to save people’s lives. Viral nucleic acid detection using real-time reverse-transcription polymerase chain reaction (rRT-PCR) assay, which has been developed and used for rapid detection of SARS-CoV-2, remains the standard for diagnosis of COVID-19 [2]. A large number of the “suspected” cases with typical clinical COVID-19 features and/or identical specific computed tomography (CT) results were not diagnosed [3, 4]. Moreover, RT-PCR assay, which is time consuming and laborious, needs special equipment, limiting its usage in low-resource or remote settings. The human antibody response, which is crucial for clearance of the initial virus infection, has been widely used to help diagnose viral infection. Compared to RT-PCR assays, the detection of antibody assays are often faster, less expensive, easy to use, and accessible to staff without laboratory training. Here, we detected dynamic characteristics and magnitude of antibody response in patients with COVID-19, and evaluated the serodiagnostic value of enzyme-linked immunosorbent assay (ELISA)–based immunoglobulin M (IgM) and immunoglobulin G (IgG) tests for COVID-19 pneumonia. Herein we present the sensitivity and specificity of antibody tests for detection of IgM and IgG and discuss the clinical application of these antibody assays for serodiagnosis of COVID-19.

MATERIALS AND METHODS

Patients and Data Sources

Patients at Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, were evaluated from 19 January 2020 to 2 March 2020. During this period, IgM and IgG antibody responses to SARS-CoV-2 infection were analyzed. The gold standard for diagnosis is nucleic acid testing for SARS-CoV-2 by RT-PCR tests of nasopharyngeal and/or oropharyngeal swab samples. RT-PCR tests were performed for patients who presented with (1) travel or residential history in Wuhan or local endemic areas, (2) an epidemiological history of contact with patients who were confirmed with COVID-19 pneumonia or individuals presenting with fever or respiratory symptoms from these areas within 14 days, or (3) a clustering outbreak, combined with clinical manifestation of fever and /or respiratory symptoms, positive findings similar to COVID-19 pneumonia on chest CT, or laboratory tests showing reduced lymphocytes and white blood cell counts in the early stage. In the case of an initially negative RT-PCR test, repeat testing was performed at intervals of 1 day or more. Laboratory-confirmed COVID-19 was defined as a positive nucleic acid test for SARS-CoV-2 by RT-PCR assay. The diagnosis of suspected COVID-19 was based on 1 of the epidemiological history and 2 of the clinical manifestations, but with negative RT-PCR for SARS-CoV-2. In confirmed cases, a patient showing fever and respiratory symptoms with radiological findings of pneumonia was defined as a normal case, whereas cases meeting any of the following criteria were defined as severe: (1) respiratory distress (≥ 30 breaths/minute), (2) oxygen saturation ≤ 93% at rest, or (3) arterial partial pressure of oxygen/fraction of inspired oxygen ratio ≤ 300 mm Hg (l mm Hg = 0.133 kPa). In addition, cases with chest imaging that showed obvious lesion progression within 24–48 hours > 50% were managed as severe cases. In the control group, samples were obtained from healthy blood donors or from patients with other diseases hospitalized in the same hospital. The detailed diagnosis standards are presented in Supplementary Table 1.

RNA Extraction and rRT-PCR Assay

Total RNA was extracted from nasopharyngeal and/or oropharyngeal swab samples of patients suspected of having SARS-CoV-2 infection within 2 hours using the respiratory sample RNA isolation kit. In brief, 40 μL of cell lysates were transferred into a collection tube followed by vortexing for 10 seconds. After standing at room temperature for 10 minutes, the collection tube was centrifuged at 1000 rpm/minute for 5 minutes. The suspension was used for rRT-PCR assay of SARS-CoV-2 RNA. Two target genes, including open reading frame1ab (ORF1ab) and nucleocapsid protein (N), were simultaneously amplified. Target 1 (ORF1ab): forward primer CCCTGTGGGTTTTACACTTAA; reverse primer ACGATTGTGCATCAGCTGA. Target 2 (N): forward primer GGGGAACTTCTCC TGCTAGAAT; reverse primer CAGACATTTTGCTCTCAAGCTG. RT-PCR assay was performed under the following conditions: incubation at 50°C for 15 minutes and 95°C for 2 minutes, followed by 45 cycles of denaturation at 95°C for 3 seconds, then annealing, extending and collecting fluorescence signal at 55°C for 30 seconds. The diagnostic criteria were based on the recommendation of the National Institute for Viral Disease Control and Prevention (China).

ELISA

The serum SARS-CoV-2 antibodies (IgM and IgG) of the subjects were detected using a sandwich ELISA kit (Livzon Inc, Zhuhai, China, lot numbers 20200308 [IgM] and 20200308 [IgG]). For detection of IgM, 100 µL diluted serum (1:100) was added into the 96-well microplate (coated with N protein) and then incubated for 1 hour at 37°C. After washing, 100 µL secondary antibody (against human IgM) labeled with conjugate was added into the wells and then incubated for 30 minutes at 37°C. Following the second wash cycle, 100 µL substrate was added into the wells and incubated for 15 minutes under 37°C. Finally, stop solution was added to the wells to terminate the reaction. The optical density (OD) of each well was determined by a microplate reader set to 450 nm within 30 minutes. The ratio of OD to the cutoff value (OD of the blank well + 0.1) was reported as the antibody concentration. For detection of IgG, the dilution factor was changed (1:20) and the cutoff value was modified (OD of the blank well + 0.13).

Statistical Analyses

All statistical analyses were performed using SPSS version 20.0 software. The diagnostic value of ELISA-based IgM and IgG antibody test for COVID-19 was based on sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), and accuracy. Log-normal distribution was used to fit the time distribution of IgM and IgG antibody seropositive rate, as well as calculative seroconversion rate of the 2 antibodies.

Ethical Approval

Ethics approval was exempted from institutional review board of the hospital, as we collected and analyzed all data from the patients according to the policy for public health outbreak investigation of emerging infectious diseases issued by the National Health Commission of the People’s Republic of China.

RESULTS

Demographic and Clinical Characteristics

Eighty-five patients with confirmed diagnosis and 24 patients with suspected diagnosis were recruited in this study. Demographic and clinical characteristics are shown in Table 1. Comorbidities in patients were recorded including hypertension, diabetes, surgical operation, malignancies, chronic lung disease, and chronic renal diseases. Healthy donors who were doctors and nurses working in the hospital and patients with other lung disorders including bacterial pneumonia (n = 5), acute exacerbation of chronic obstructive pulmonary disease (n = 2), lung cancer (n = 3), empyema (n = 1), interstitial lung disease (n = 2), and pleuritis (n = 1) were included as a control group.

Table 1.

Demographic and Clinical Characteristics of Coronavirus Disease 2019 Pneumonia

			Disease Severity, No. (%)		Comorbidities, No. (%)
Clinical Characteristics	Age, y, Median (IQR)	Female Sex, no./No. (%)	Normal	Severe	Yes	Nro
Confirmed group (n = 85)	51.0 (32.0–65)	54/85 (63.5)	67 (78.8)	18 (21.2)	33 (38.8)	52 (61.2)
Suspected group (n = 24)	44.0 (35.5–60.5)	12/24 (50.0)	22 (91.2)	2 (83.3)	4 (16.7)	20 (83.3)
Control group (n = 60)	34 (29.0–51.0)	35/60 (58.3)	NA	NA	NA	NA

Abbreviations: IQR, interquartile range; NA, not applicable.

Dynamics of Antibody Response

Detection of IgM and IgG Antibody at Different Time Points

We evaluated specificity of IgM and IgG antibodies based on ELISA from 216 serum samples of 85 patients with confirmed COVID-19 pneumonia. The serum was obtained at different times after symptom onset. The IgM and IgG antibodies were detected as early as the fourth day after onset (Table 2). In some cases, IgM (7 patients) and IgG (6 patients) were detected within 7 days after illness onset, respectively. The seropositive rate of IgM increased gradually and notably. IgG increased sharply on the 12th day after onset. We used a log-normal distribution to fit the time distribution of IgM and IgG antibody seropositive rate (Figure 1). Results from the 60 samples in the control group showed that 3 cases were positive for IgG, whereas all cases were negative for IgM.

Table 2.

Time Points of Detection of Immunoglobulin M and Immunoglobulin G Antibodies^a

		IgM Against SARS-CoV-2		IgG Against SARS-CoV-2
Course, days	No. of Patients	Positive, No.	Positive Rate, %	Positive, No.	Positive Rate, %
≤ 5	5	3	60.0	2	40.0
7	9	4	44.4	4	44.4
9	19	9	47.4	8	42.1
11	23	13	56.5	9	39.1
13	20	15	75.0	10	50.0
15	24	20	83.3	20	83.3
17	20	16	80.0	16	80.0
19	16	15	93.8	14	87.5
21	21	14	66.7	17	81.0
23	15	12	80.0	12	80.0
25	12	8	66.7	10	83.3
27	11	7	63.6	10	90.9
29	7	4	57.1	4	57.1
≥ 30	14	12	85.7	14	100

Abbreviations: IgG, immunoglobulin G; IgM, immunoglobulin M; SARS-CoV-2, severe acute respiratory syndrome coronavirus 2.

^aSpecific IgM and IgG antibodies against SARS-CoV-2 from 216 serum samples of 85 confirmed coronavirus disease 2019 pneumonia cases were tested with enzyme-linked immunosorbent assay. Serum samples were obtained at different time points after symptom onset.

Figure 1.

Detection of immunoglobulin M (IgM) and immunoglobulin G (IgG) antibodies at different time points. Log distribution was used to describe the distribution time period of seropositive rate of the 2 types of antibodies. Serological IgM and IgG antibodies tested by enzyme-linked immunosorbent assay in patients with confirmed diagnosis. The IgM and IgG antibodies were detected as positive as early as on the fourth day after onset, and the seropositive rate of IgM increased gradually; however, IgG increased sharply on the 12th day after onset.

Timeline of Initial Seroconversion of IgM and IgG Antibodies

To monitor the kinetics of serological antibodies within COVID-19 patients, serological antibodies were tested consecutively once the initial appearance time of IgM and/or IgG antibody was detected in 29 confirmed patients. A log distribution was used to fit the seroconversion time of the 2 antibodies (Figure 2). IgM cumulative seroconversion increased quickly from the ninth day, and IgG increased from the 11th day after symptom onset. In our investigation, both antibodies were seropositive in nearly all the patients within the illness course for ≥ 30 days.

Figure 2.

Timelines of initial seroconversion of immunoglobulin M (IgM) and immunoglobulin G (IgG) antibodies. Log distribution was used to describe the distribution time period of cumulative seroconversion rate of the 2 antibodies. IgM cumulative seroconversion increased quickly from nearly the eighth day, and IgG increased from nearly the 10th day after symptom onset.

Diagnostic Role of IgM and IgG Antibodies for COVID-19 Pneumonia

To evaluate the diagnostic potential of serological IgM and IgG antibody detection, 66 patients with confirmed COVID-19 pneumonia were evaluated, compared with standard RT-PCR assays. Serum samples were obtained from patients with disease course of ≥ 13 days and < 29 days. The results of serological tests for IgM and IgG are shown in Table 3. Compared with RT-PCR, the sensitivity, specificity, PPV, NPV, and consistency rate of IgM were 77.3% (51/66), 100% (60/60), 100% [51 / (51 + 0)], 80.0% [60 / (15 + 60)], and 88.1% [(51 + 60) / (51 + 15 + 0 + 60)], whereas those of IgG were 83.3% (55/66), 95.0% (57/60), 94.8% [55 / (55 + 3)], 83.8% [57 / (11 + 57)], and 88.9% [(55 + 57) / (55 + 11 + 3 + 57)], respectively.

Table 3.

Diagnostic Roles of Immunoglobulin M and Immunoglobulin G Antibodies for Coronavirus Disease 2019 Pneumonia^a

	IgM Against SARS-CoV-2		IgG Against SARS-CoV-2
Antibody	Confirmed Case Group	Control Group	Confirmed Case Group	Control Group
Positive	51	0	55	3
Negative	15	60	11	57
Total	66b	60	66b	60

Abbreviations: IgG, immunoglobulin G; IgM, immunoglobulin M; SARS-CoV-2, severe acute respiratory syndrome coronavirus 2.

^aDiagnostic value of serological IgM and IgG antibodies for coronavirus disease 2019 pneumonia was evaluated in 66 patients with positive nucleic acid tests. Serum samples were obtained from patients with disease courses ≥13 days and <29 days.

^bSixty-six patients were included in the 85 confirmed cases, and their disease courses were ≥13 days and <29 days.

In the control group with healthy donors and patients with other disease, only 3 healthy donors showed positive for IgG, and no cases for IgM.

Diagnostic Role of IgM and IgG Antibody Detection in Patients With Suspected COVID-19 Pneumonia

As shown in Table 4, 24 patients had COVID-19 pneumonia manifestations while being negative at least twice for respiratory tract nucleic acid tests. Patients were evaluated independently by 2 experienced physicians. For patients with suspected COVID-19, the sensitivity, specificity, PPV, NPV, and consistency rate of IgM were 87.5% (21/24), 100% (60/60), 100% [21 / (21 + 0)], 95.2% [60 / (3 + 60)], and 96.4% [(21 + 60) / (21 + 3 + 0 + 60)], respectively; whereas those for IgG were 70.8% (17/24), 95% (57/60), 85.0% [17 / (17 + 3)], 89.1% [57 / (7 + 57)], and 88.1% [(17 + 57) / (17 + 7 + 3 + 57)], respectively.

Table 4.

Detection of Immunoglobulin M and Immunoglobulin G Seropositivity for Patients With Suspected Coronavirus Disease 2019 Pneumonia^a

	IgM Against SARS-CoV-2		IgG Against SARS-CoV-2
Antibody	Suspected Case Group	Control Group	Suspected Case Group	Control Group
Positive	21	0	17	3
Negative	3	60	7	57
Total	24	60	24	60

Abbreviations: IgG, immunoglobulin G; IgM, immunoglobulin M; SARS-CoV-2, severe acute respiratory syndrome coronavirus 2.

^aDiagnostic value of serological IgM and IgG antibodies for patients with suspected coronavirus disease 2019 pneumonia was evaluated in 24 patients with negative nucleic acid tests.

DISCUSSION

COVID-19 pneumonia was first reported in Wuhan, Hubei Province, China, in December 2019, followed by an outbreak across Hubei Province and other parts of China [5, 6]. An accurate, rapid, and cost-effective laboratory etiologic method is urgently needed for diagnosis of the disease. Serological testing is anticipated to work as a complementary approach to diagnosis. Data from the 2003 severe acute respiratory syndrome (SARS) epidemic show that serological responses, including viral-specific IgM and IgG, are valid for serological diagnosis [7, 8]. Our study characterized the dynamics of serum IgM and IgG antibodies against SARS-CoV-2 as well as evaluated the diagnostic potential of this serological test. The results showed that IgM and IgG antibodies against SARS-CoV-2 can be detected in the middle and later stages of the disease and that ELISA-based IgM and IgG antibody tests for serodiagnosis of COVID-19 have high specificity for diagnosis of COVID-19.

During the immune response against pathogen infection, IgM is usually produced earlier than IgG antibody. However, both IgM and IgG antibodies against SARS-CoV-2 were detected as early as the fourth day after symptom onset, and the appearance of IgM and IgG antibodies in SARS-CoV-2 seems earlier than in SARS, another severe coronavirus pneumonia [9]. In our study, the seropositive rate of IgG was observed to decrease around the 28th day after illness onset. The seropositive rate should not decrease at this time point, so we thought this may be due to small sample size (there were only 7 serum samples collected from 7 patients). Diagnostic value of serological testing was evaluated in patients with confirmed and suspected COVID-19 pneumonia. Depending on patients’ disease course (≥13 days from disease onset), specificity and PPV of IgM antibody were very high, up to 100%, which indicated that IgM can be used as a good marker for diagnosis of COVID-19. However, the sensitivity, NPV, and consistency rate of IgM were 77.3%, 80.0%, and 88.1%, respectively, indicating that acute infection may still be missed based on seronegative IgM. The specificity, PPV, and consistency rate of IgG were 95.0%, 94.8%, and 88.9%, respectively; meaning that patients can be diagnosed with COVID-19 pneumonia based on seropositive IgG. Both seropositive antibodies demonstrate outstanding specificity and PPV, suggesting that seropositive IgM and/or IgG can help to establish the diagnosis of COVID-19 pneumonia, especially in patients with a long course. To avoid misdiagnosis, patients with early seronegative antibodies should be retested after 10 days from onset. The data acquired from patients with suspected diagnosis demonstrate that the serological tests are reliable as they show high specificity, of which IgM tests were up to 100% and IgG tests were 95%. Those testing results were in accordance with physicians’ judgments of the symptoms. Three of 60 controls were found positive by IgG tests. These 3 controls (1 was weak positive) were healthcare providers but did not serve patients who were diagnosed with confirmed or suspected COVID-19 at that time. We think these should noted as be false positive or community asymptomatic infection.

In summary, detection of antibodies against COVID-19–based ELISA appears to be a valid approach to serodiagnosis of COVID-19 pneumonia. The specific circulating antibody can be uniformly detected, therefore avoiding false-negative results due to sampling or potential absence of viruses in the respiratory system. As COVID-19 is an emerging infectious disease, the current population is generally susceptible to it and the background levels of serum-specific antibodies are low. Therefore, COVID-19 pneumonia can be diagnosed based on seropositivity of specific antibodies as an alternative to viral nucleic acid detection, with clear advantages.

Supplementary Data

Supplementary materials are available at Clinical Infectious Diseases online. Consisting of data provided by the authors to benefit the reader, the posted materials are not copyedited and are the sole responsibility of the authors, so questions or comments should be addressed to the corresponding author.

Notes

Acknowledgments. The authors thank Dr Xiang-Ping Yang at the Department of Immunology, School of Basic Medicine, Tongji Medical College, Huazhong University of Science and Technology, for his review of our manuscript.

Financial support. This work was supported by the National Natural Science Foundation of China (grant numbers 81973990 and 91643101) and the Science Foundation of Huazhong University of Science and Technology (grant number 2020kfyXGYJ100).

Potential conflicts of interest. The authors: No reported conflicts of interest. All authors have submitted the ICMJE Form for Disclosure of Potential Conflicts of Interest.

Author notes

P. C. and W.-L. M. contributed equally to this manuscript.