Low folate status, with associated increases of plasma homocysteine concentrations, has been implicated as a cause of neural tube defects and premature cardiovascular disease (1)(2). The production of 5-methyltetrahydrofolate by methylenetetrahydrofolate reductase (MTHFR) enables remethylation of homocysteine to methionine, which thereby reduces homocysteine concentrations. A common mutation in the MTHFR gene (C677T) (3) produces an enzyme with partially reduced activity, which may be characterized by thermolability in vitro (4). Homozygotes (TT) are prone to developing mild to moderate hyperhomocysteinemia if dietary folate intake is below average (5). This may constitute an interaction between inheritance and diet for neural tube defects and cardiovascular disease.

The original technique described for C677T genotyping was restriction digestion, which exploits the creation of a restriction site for HinfI (6). We have developed an alternative method based on heteroduplex technology and applied this to genotyping studies in a healthy population.

The principle of heteroduplex analysis is production of double-stranded DNA containing a short mismatched sequence, which will differ in conformation depending on the specific base sequence (7). A 147-bp region containing the mutation site (position 677) is amplified from genomic DNA in PCR, which includes an additional fragment of DNA known as a heteroduplex generator (HG). The HG is identical to the genomic PCR product except for a 3-bp deletion one nucleotide upstream from the mutation site. During PCR, genomic DNA and HG are both amplified. The genotyping PCR contains 0.4 μmol/L upstream primer MTHFR1 (5′AGGGAGCTTTGAGGCTGACCTGAA3′), 0.4 μmol/L downstream primer MTHFR2 (5′ACGATGGGGCAAGTGATGCCCATG3′), 0.2 mmol/L each dNTP, 2.5 μL of 10× reaction buffer, 1.25 units of Taq polymerase, genomic DNA (0.5 μL for blood DNA and 5 μL for buccal cell DNA), and 1 μL of an appropriate dilution of HG in a total volume of 25 μL. The PCR program comprises 95 °C for 5 min for one cycle, followed by 95 °C for 30 s, 71 °C for 30 s, and 72 °C for 1 min for 35 cycles. The dilution of HG used in the PCR was established by titration. Serial dilutions of the HG were amplified in a PCR also containing 0.5 μL of genomic DNA. A 1:55 000 dilution produced similar amplification of both genomic DNA and HG target sequences and has been used for all genotyping with this HG preparation.

The heteroduplexes formed by annealing between amplified HG and genomic PCR product give profiles of DNA bands characteristic of each genotype, which can be visualized on a 10% polyacrylamide gel. The PCR appears to be tolerant of a wide range of concentrations of patient DNA such that it is not necessary to estimate the DNA concentration before setting up the reaction. The first-time success rate is ∼96%.

The HG was constructed using site-directed mutagenesis by PCR using a modification of a method described previously (8). Briefly, primers MTHFR1 and MTHFR2 were used in an initial PCR (PCR I) to amplify a 147-bp fragment from genomic DNA. In a second reaction (PCR II), a mutagenic upstream primer, MTHFR3 (5′GAAGGAGAAGGTGTCTGCGGCCGATTTCATCATCA3′), specifying a 3-bp deletion in the HG was used in combination with MTHFR2 to amplify a 114-bp fragment spanning the mutation site from genomic DNA. Both fragments were electrophoresed and isolated from a 2% agarose gel. The 114- and 147-bp fragments were mixed and amplified in PCR III using all three primers MTHFR1, MTHFR2, and MTHFR3. This reaction yielded a number of products, one of which corresponded to the HG of size 144 bp containing the specified 3-bp deletion. The HG was extracted after polyacrylamide gel electrophoresis, and a uniform stock of HG was produced by cloning into Escherichia coli. The sequence was confirmed in both directions, and aliquots were stored frozen (available from I.F.W.M.).

Genotyping by restriction enzyme digestion was carried out using different primers (MTHFR1 and MTHFR2) as described by Frosst et al (6). Restriction fragments (96 bp and 51 bp) and/or undigested product were separated by electrophoresis on a 1% SeaKem–3% Nusieve agarose gel and visualized using ethidium bromide (Fig. 1).

Figure 1.

MTHFR genotyping.

Electrophoretic patterns of samples analyzed by restriction enzyme digestion (top) or heteroduplex analysis (bottom) for MTHFR genotype. (CC, homozygous wild-type; TT, homozygous variant; CT, heterozygous).

In the comparison of the restriction digestion and heteroduplex techniques on 97 consecutive DNA samples, there was complete agreement (TT, 6; CT, 42; and CC, 49). Both methods can give reliable results; however, the restriction enzyme gels are more difficult to interpret and do carry a risk of error should the restriction enzyme digestion not be complete. The heteroduplex genotyping technique is straightforward to perform and produces gel patterns that are easily interpreted without ambiguity. In heterozygotes both alleles are visualized to the same extent. Heteroduplex analysis requires only three steps to obtain a result (DNA extraction, PCR, and electrophoresis). The speed, economy, and robustness of the method make it particularly suitable for screening studies requiring large sample throughput. Although this method requires the initial synthesis of the HG, once it is synthesized and cloned theoretically unlimited supplies are available. Whole EDTA blood or buccal cells are both suitable sources of DNA for genotyping. The recovery of cells from the cheek lining using a “cytobrush” is a convenient method for both patients and laboratory.

In a study of 605 healthy subjects from South Wales, the genotype frequency was TT, 73 (12.1%); CT, 242 (40.0%); and CC, 290 (47.9%). The gene frequency for the T allele (0.32 ± 0.03, 95% confidence interval) is similar to that described in other Northern European studies (9)(10)(11) and confirms the high prevalence of this genetic variant in the general population. This economical and rapid method for MTHFR genotyping will facilitate further research on the role of folate and homocysteine in human disease.

This work was supported by The British Heart Foundation. We thank Moira Brownlee for assistance with sample collection and Rima Rozen (Montreal Children’s Hospital Research Institute, Montreal, Canada) for providing unpublished DNA sequence information for the MTHFR gene.

References

1

Boushey CJ, Beresford SAA, Omenn GS, Motulsky AG. A quantitative assessment of plasma homocysteine as a risk factor for vascular disease–probable benefits of increasing folic acid intake.

JAMA
1995
;
274
:
1049
-1057.

2

Wilcken DE. MTHFR 677C→T mutation, folate intake, neural tube defect, and risk of cardiovascular disease.

Lancet
1997
;
350
:
603
-604.

3

Goyette P, Sumner JS, Milos R, Duncan AMV, Rosenblatt DS, Matthews RG, Rozen R. Human methylenetetrahydrofolate reductase: isolation of cDNA, mapping and mutation identification.

Nat Genet
1994
;
7
:
195
-200.

4

Kang SS, Passen EL, Ruggie N, Wong APWK, Sora H. Thermolabile defect of methylenetetrahydrofolate reductase in coronary artery disease.

Circulation
1993
;
88
:
1463
-1469.

5

Jacques PF, Bostom AG, William RR, Ellison RC, Eckfeldt JH, Rosenberg IH, et al. Relation between folate status, a common mutation in methylene tetrahydrofolate reductase, and plasma homocysteine concentrations.

Circulation
1996
;
93
:
7
-9.

6

Frosst P, Blom HL, Milos R, Goyette P, Sheppard CA, Matthews TH, et al. A candidate genetic risk factor for vascular disease: a common mutation in methylene tetrahydrofolate reductase.

Nat Genet
1995
;
10
:
111
-113.

7

Wood N, Bidwell J. Genetic screening and testing by induced heteroduplex formation.

Electrophoresis
1996
;
17
:
247
-254.

8

Bowen DJ, Standen GR, Granville S, Bowley S, Wood NAP, Bidwell J. Genetic diagnosis of factor V Leiden using heteroduplex technology.

Thromb Haemost
1997
;
:
77119
-77122.

9

Ankri A, Bonnefont JP, Chadefauz-Vekemans B, Mostefa AK, Aupetit J, Couty MC, et al. The 677C→T mutation in the methylene tetrahydrofolate reductase gene is not related to hyperhomocysteinaemia in thrombotic disease [Abstract].

Thromb Haemost Suppl
1997
;
:
2160
.

10

Harmon DL, Woodside JV, Yarnell JWG, McMaster D, Young IS, McCrum EE, et al. The common thermolabile variant of methylene tetrahydrofolate reductase is a major determinant of mild hyperhomocysteinaemia.

Q J Med
1996
;
89
:
571
-577.

11

Kluijtmans LAJ, Kastelein JJP, Lindemans J, Boers GHJ, Heil SG, Bruschke AVG, et al. Thermolabile methylene tetrahydrofolate reductase in coronary artery disease.

Circulation
1997
;
96
:
2573
-2577.

This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)