https://orcid.org/0000-0002-0037-0402
Abstract
Group 3 innate lymphoid cells [ILC3s] sense environmental signals and are critical in gut homeostasis and immune defence. G-protein-coupled receptors [GPCRs] mediate cellular responses to diverse environmental signals. However, the GPCRs’ regulation mechanisms of ILC3s is largely unknown.
We used wild-type [WT] and GPRC6A-/- mice to investigate the role of GPRC6A in the population and the function of ILC3s. We then purified ILC3s from WT and GPRC6A-/- mice. Colitis was induced in WT mice and GPRC6A-/- mice through dextran sodium sulphate [DSS] administration or C. rodentium infection. Furthermore L-arginine, a selective GPRC6A agonist, was administered to mice with colitis.
We found that colonic ILC3s expressed GPRC6A. The deficiency of GPRC6A decreased ILC3-derived interleukin-22 [IL-22] production and the number of proliferating ILC3s, which led to increased susceptibility to colon injury and pathogen infection and impaired inflamed mucosal healing. Further studies showed that L-arginine, a GPRC6A agonist, promoted colonic ILC3 expansion and function via the mammalian target of rapamycin complex 1 [mTORC1] signalling in vitro. In addition, L-arginine attenuated DSS-induced colitis in vivo. This was associated with a significant increase in IL-22 secretion by ILC3s.
Our findings unveil a role for the nutrient-sensing receptor GPRC6A in colonic ILC3 function and identify a novel ILC3 receptor signalling pathway modulating inflamed mucosal healing.
1. Introduction
Inflammatory bowel disease [IBD] is a chronic and immunologically inflammatory disorder in the gastrointestinal tract1 that is prevalent globally, especially in Western countries.2 As a chronic inflammatory disease, IBD is mainly induced by immune dysfunction in the intestinal immune system. Gut-resident immune cells, such as T cells, innate lymphoid cells [ILCs], macrophages, and dendritic cells, regulate intestinal homeostasis by producing multiple cytokines.3 Cytokines have direct links with the pathogenesis of IBD and are implicated in the modulation of intestinal inflammation and clinical symptoms of IBD.3 The key objective of IBD therapy is to heal the inflamed mucosa in order to improve clinical symptoms, disease recurrence, and resection-free survival in patients.4–6 Biologic therapeutic treatment [TNF-a inhibitor, etc.] accelerates inflamed mucosal healing in only a portion of IBD patients.7 Unfortunately, the cross-talk among intestinal epithelial cells and immune cells complicates the maintenance and regeneration [such as mucosal healing] of the epithelial barrier.
ILCs contribute to innate and adaptive immune responses against these stimuli and play a critical role in maintaining barrier function and intestinal homeostasis.8–10 The function of ILCs is regulated by a wide range of environmental signals, such as nutrients and gut microbiota. Gut-resident ILC3s are enriched in the intestinal lamina propria [LP], where they maintain gut homeostasis by orchestrating immunomodulation, microbiota balance, and tissue repair.8,11 RORγt-expressing ILC3s are the key source of innate IL-22,12,13 although IL-22 expression is not limited to these cell types.14 IL-22 in the intestine accelerates epithelial cell repair and secretion of antimicrobial peptides that limit intestinal inflammation.15–17 IL-22-deficient mice are more susceptible to colitis,18 and IL-22 production is increased in the intestine of patients with Crohn’s disease or ulcerative colitis.19 In addition, IL-22 promotes intestinal stem cell-mediated epithelial regeneration through signal transducer and activator of transcription 3 [STAT3] signals.20,21
GPCRs are proteins with seven transmembrane-spanning domains that bind to many ligands to receive and process diverse environmental signals.22 GPCRs regulate various gut functions, including digestion, immunity, and tissue repair.23 Many studies have shown that GPCR repair can accelerate mucosal wound healing rather than just downregulate inflammation, similar to most anti-inflammatory drugs.23 GPCRs may become an important therapeutic target to promote the repair of acute and chronic intestinal inflammation. Nutrient metabolites regulate ILC3 function by activating specific GPCRs. The antimicrobial functions of ILC3s in the intestine are regulated by GPR183.24 Moreover, oxysterol sensing through the receptor GPR183 regulates the functions of ILC3s.25 GPR43 regulates colonic ILC3 proliferation and function.26 GPRC6A, a widely expressed GPCR, is proposed to be a master regulator of complex metabolic processes. GPRC6A is activated by multiple ligands, including L-arginine and calcium.27 However, whether GPRC6A regulates the function of ILC3s and mucosal wound healing remains unknown.
2. Materials and Methods
2.1. Mice
C57BL/6J (wild-type, specific-pathogen-free [SPF]) mice were purchased from Vital River Laboratories [Vital River Laboratory Animal Technology, Beijing, China]. GPRC6A-/- mice were supported by the Institute of Subtropical Agriculture, Chinese Academy of Sciences. Male mice were used at 6-12 weeks of age. In independent experiments, all mice were age-matched. The exact numbers of animals used per experiment are indicated in the figure legends. The mice were maintained according to the Guide for the Care and Use of Laboratory Animals [Institute for Learning and Animal Research at China Agricultural University; SYXK-2015-0028]. All procedures were approved by the Chinese Agricultural University Laboratory Animal Welfare and Animal Experimental Ethical Committee with the permission number AW16109102-1-2.
2.2. DSS-induced colitis model
Consistent with previous publications, mice were orally administered L-arginine supplementation [1.5 g/kg body weight/day] for 2 weeks.28,29 According to the daily water consumption by mice, we calculated that the concentration of L-arginine added to the drinking water was approximately 7 mg/ml. Eight-week-old WT or GPRC6A-/-mice were fed drinking water containing 7 mg/ml L-arginine for 2 weeks. Mice were given 2% or 3% dextran sodiun sulphate [DSS; molecular weight: 36 000-50 000; MP Biomedicals] in their drinking water for 5 days, followed by regular drinking water for 2 days. Mice were weighed daily. Where indicated, mice were given one intrapperitoneal [i.p.] dose of 500 μg anti–IL-22 [AF582; R&D Systems]. In some experiments, mice were treated every day with an i.p dose of 500 ng mouse rIL-22 [R&D Systems]. The colon’s length was measured, and sections from the ascending colon of each mouse were analysed using a haematoxylin and eosin [H&E] staining kit [Beijing Leagene Biotechnology]. The remaining colonic tissues were used to isolate colonic immune cells or colonic crypts as described above. Colitis severity was assessed by a combined score of colon cellular infiltration [0–3, according to the number and localisation of the inflammatory cells] and tissue disruption [0–3, according to the severity of mucosal and crypt damage] as described previously.30 Histological scoring was performed in a blinded fashion.
2.3. Citrobacter rodentium infection model
GPRC6A-/-mice or WT mice were orally infected with 2 × 109 colony-forming units [CFUs] of Citrobacter rodentium [C. rodentium] [DBS100 strain] in a volume of 0.2 ml phosphate-buffered saline [PBS].31 Mice were weighed daily. On Day 8 after infection, the colon, liver, or spleen was collected. Colon was fixed with 4% paraformaldehyde for histology. Sections from the ascending colon of each mouse were analysed using haematoxylin and eosin [H&E] staining. Colitis severity was assessed as describe above. For assessment of bacterial translocation, the spleen and liver were weighed and homogenised identically. Serial dilutions of homogenates were plated on MacConkey agar and counted after 20 h of incubation at 37°C under aerobic conditions.
2.4. Murine intestinal organoids isolation and culture
Isolation of colonic crypts was largely performed as previously described.32 In brief, after euthanising mice with CO2 and collecting the colons, organs were opened longitudinally and washed with sterile PBS and then incubated in PBS containing 1 mg/ml collagenase type 4 [Worthington] for 30 min at 37°C to isolate the crypts. For mouse organoids, depending on the experiments, 200 crypts per well in 24-well plates [Jet Biofil] were suspended in 50 μl Matrigel composed of 50% advanced DMEM/F12 medium [Gibco] and 50% growth-factor-reduced Matrigel [Corning]. The Matrigel suspension was allowed to polymerise at 37°C for 30 min before adding 500 μl fresh complete medium (advanced DMEM/F12 [Gibco] supplemented with 100 U/ml penicillin-0.1 mg/ml streptomycin [Solarbio], 10 mM HEPES [Gibco], N-2 [Gibco], B-27 [Gibco], 50 ng/mL mouse EGF [Peprotech], 100 ng/ml mouse Noggin [Peprotech], 500 ng/ml mouse R-spondin1 [Peprotech], 100 ng/ml Wnt3a [RD Systems], and 10 μM Y-27632 [Molnova]). The culture medium and growth factors were replaced every 3-4 days. Clonogenicity [colony-forming efficiency] was calculated by plating 200 crypts and assessing organoid formation after 5-7 days.
2.5. ILC3s isolation and culture
ILC3s were isolated from colonic and small intestinal lamina propria [LP], mesenteric lymph nodes [MLNs], spleens and Peyer’s patches [PPs] as previously described.26 In brief, colons and small intestines were collected from mice, opened longitudinally, and washed with PBS. Epithelial cells were removed by incubating with DPBS containing 5 mM ethylenediamine tetraacetic acid [EDTA], 0.154 mg/mL dithiothreitol [Sigma], 5% foetal bovine serum [FBS] [Shanghai Lian Shuo Biotechnology], and 100 U/ml penicillin-0.1 mg/ml streptomycin [Solarbio] for 30 min in a 37°C shaker. For the isolation of lamina propria lymphocytes [LPLs], the remaining intestinal tissues were washed twice in PBS, cut into 1 mm in length, and digested in a collagenase solution (AMMS®HY01 Immune Cell Culture Medium [Beijing T&L Biological Technology], 10 mM HEPES [Gibco], 100 U/ml penicillin-0.1 mg/ml streptomycin [Solarbio], 1% glutamine, 5% certified FBS [VivaCell, Shanghai], 0.5 mg/mL collagenase/dispase [Roche], and 1 U/ml DNase 1 [Roche]) for 30 min in a 37°C shaker. Afterward, the digested tissues were strained [40 μm] and washed twice in PBS. The LPL fractions were purified by a 40/80% Percoll [Solarbio] gradient. To isolate immune cells from spleens, MLNs, and PPs, spleens, MLNs, and PPs were carefully removed and crushed through 40-μm strainers and resuspended in PBS.
To sort ILC3s, colonic and small intestinal LPLs, splenocytes, MLN, cells or PP cells were obtained from six mice per sorting session. For sorting experiments, single-cell suspensions were stained with a Live/Dead Fixable yellow dead cell stain kit [Invitrogen, L34959] to exclude dead cells. Live cells were stained with anti-mouse CD45 APC-Cy7 [30-F11, BioLegend, 103116], anti-mouse lineage marker Pacific Blue [17A2/RB6-8C5/RA3-6B2/Ter-119/M1/70, Biolegend, 133310], anti-mouse CD90.2 FITC [53-2.1, BioLegend, 140304], anti-mouse KLRG1 PE [2F1, BioLegend, 138408], and anti-mouse NK1.1 PE/Cy7 [PK136, Biolegend, 08714]. Live CD45+Lineage-CD90.2+KLRG1-NK 1.1- ILC3s from wild-type [WT] mice and GPRC6A-/- mice were sorted by FACS [BD FACSMelody]. The gating strategy for ILC3 sorting experiments is provided in Supplementary Figure S1C. Colonic ILC3s were cultured in complete RPMI 1640 medium (RPMI 1640 [BBI], 10% FBS [HAKATA], 10 mM HEPES, 1% penicillin/streptomycin, and 1% glutamine). ILC3s were cultured in 24-well plates [104 cells per well]. To activate and maintain ILC3s in culture, rmIL-23 [40 ng/ml] and rmIL-1β [100 ng/ml] were added to complete RPMI 1640 medium. In some experiments, ILC3s were stimulated with L-arginine, L-glycine, L-tryptophan, L-glutamate, and L-lysine supplementation [2 mM dissolved in medium] for 48 h. In the mTOR signalling blocking experiment, ILC3s were unstimulated or stimulated with 50 nM rapamycin [MedChemExpress] for 24 h. Then, the ILC3 samples and their culture supernatant were harvested for reverse transcription polymerase chain reaction [RT–PCR], flow cytometry, and enzyme-linked immunosorbent assay [ELISA].
2.6. Flow cytometry
For gating for live cells, cells were stained with a Live/Dead Fixable yellow dead cell stain kit [Invitrogen, L34959] before staining of the cell surface. For surface marker staining, cells were stained with anti-mouse CD45 APC-Cy7 [30-F11, BioLegend, 103116], anti-mouse lineage marker Pacific Blue [17A2/RB6-8C5/RA3-6B2/Ter-119/M1/70, BioLegend, 133190], and anti-mouse CD90.2 FITC [53-2.1, BioLegend, 140304], anti-mouse KLRG1 PE [2F1, BioLegend, 138408], anti-mouse NK1.1 PE/Cy7 [PK136, BioLegend, 08714], anti-mouse CD45 Pacific Blue [30-F11, BioLegend, 103126], anti-mouse CD3ε PE/Cy7 [145-2C11, BD, 561100] and anti-mouse CD4 APC/Cy7 [GK1.5, BioLegend, 100414] antibodies were used. For intracellular cytokine staining, colonic ILC3s were stimulated with rmIL-23 [40 ng/ml], rmIL-1β [100 ng/ml], PMA [50 ng/ml], and ionomycin [1000 ng/ml] in the presence of Brefeldin A [5 μg/ml] for 6 h. Then cells were fixed, permeabilised, and subsequently stained with anti-mouse IL-22 APC [IL22JOP, eBioscience, 17-7222-82], anti-mouse IL-17A APC [eBio17B7, eBioscience, 17-4321-81], and anti-mouse IFNγ APC [XMG1.2, eBioscience, 17-7311-82]. Samples were detected with a CytoFLEX S [Beckman Coulter] and analysed with CytExpert software, with isotype or unstained controls to determine gating. For analysis of intracellular signalling in ILC3s, sorted colonic ILC3s were fixed with a Fixation/Permeabilization Solution Kit [BD] and stained with anti-mouse RORγt PE [B2D, eBioscience, 12-6981-82], anti-mouse Ki-67 PerCP-eFluor 710 [SolA15, eBioscience, 46-5698-80], and anti-mouse phospho-S6 PE [Ser235/236] [D57.2.2E, CST, 5316s]. Samples were detected with a BD FACSCanto™ II [BD]/CytoFLEX S [Beckman Coulter] and analysed with FlowJo/CytExpert software, with isotype or unstained controls to determine gating. The gating strategy for flow cytometry analysis is provided in Supplementary Figure S1A and B.
2.7. Immunofluorescence assay
ILC3s were fixed in 4% paraformaldehyde for 30 min, permeabilised with 0.5% Triton X-100 for 20 min, washed three times with PBS, and incubated for 1 h in 3% BSA in PBS to reduce non=specific background signals. Sections of the colon [0.5 cm each] were collected and fixed overnight in 4% paraformaldehyde, embedded in OCT [optimal cutting temperature compound], sectioned at 8-μm thickness and rinsed in PBS. For immunofluorescence [IF] staining, ILC3s or tissue sections were incubated overnight with primary antibodies [rabbit anti-GPRC6A, Abcam, 1:100; Rabbit anti-Muc2, Abcam, 1:400]. The samples were then incubated with Alexa-647–conjugated anti-rabbit IgG [Xinyu Biology, 1:500, xy-0295G-AF647] for 1 h followed by DAPI [1:5000, Invitrogen™, D1306] for 5 min at room temperature. The samples were examined with a Leica TCS SP8 laser-scanning confocal microscope. Fluorescence images were collected for further qualitative and quantitative analyses. Quantification of the mean fluorescence intensity [MFI] was performed by ImageJ.
2.8. EdU retention assay
Cell proliferation was assessed by a Cell-Light EdU DNA cell proliferation kit [RiboBio; C103102] according to the manufacturer’s instructions. In brief, mice were injected with 50 mg/kg 5-ethynyl-2’-deoxyuridine [EdU, RiboBio] for 2 h and then sacrificed. Colonic tissues were fixed with 4% paraformaldehyde, embedded in OCT, and sliced. The frozen slices were reacted with 1×Apollo reaction cocktail [RiboBio] for 30 min. Subsequently, the DNA contents of the cells were stained with Hoechst 33342 for 30 min and visualised under a Leica TCS SP8 Laser Scanning confocal microscope.
2.9. Western blot
The colonic crypts were lysed in RIPA buffer [Solarbio] containing a protease inhibitor cocktail [Solarbio]. Protein concentrations were detected using a Pierce™ BCA Protein Assay Kit [Thermo Scientific]. Equal amounts of protein were separated by SDS–PAGE and electrophoretically transferred onto PVDF membranes [Millipore]. After blocking with 5% non-fat milk in TBST, the membrane was probed with primary antibodies: rabbit anti-GPRC6A [Abcam, 1:1000; ab96504], mouse anti-STAT3 [Tyr705] [Bioss, 1:1000, bsm-33223 M], mouse anti-STAT3 [Sangon Biotech, 1:1000; D190759], and mouse anti-GAPDH [Boster, 1:1000; BA2931]. After washing, the membranes were incubated with goat anti-rabbit secondary antibodies [FineTest, 1:5000; FNSA-0003] and goat anti-rabbit secondary antibodies [Life-iLab, 1:5000; AP31L303]. Signals were detected using Super Enhanced Chemiluminescence [Beyotime] and quantified using ImageJ software.
2.10. Cytokine and L-arginine detection
The ILC3 culture media were obtained, and IL-22 levels were measured using ELISA kits [R&D Systems, M2200] according to the manufacturer’s instructions. Colon tissues [1 cm] were washed using PBS and then homogenised in 0.5 ml PBS with 1 mM PMSF. Samples were then centrifuged for 10 min at 12000 rpm/min, and total protein within the supernatant was quantified using a Pierce™ BCA Protein Assay Kit [Thermo Scientific]. Supernatant [0.5 mg protein in 0.1 mL] was assayed for cytokines using mouse IL-1β [MultiSciences, 70-EK201B], IL-6 [Solarbio, SEKM-0007], IL-17 [R&D Systems, M1700], IFNγ [BlueGene, E03I0345], and IL-22 [R&D Systems, M2200] ELISA kits according to the manufacturer’s instructions. L-arginine concentrations in serum or colonic tissues were measured using an L-arginine assay kit [Abcam, ab241028] according to the manufacturer’s instructions.
2.11. Quantitative RT-PCR
For quantitative PCR [qPCR], colonic crypts were collected from euthanised mice and stored at −80°C. Total RNA from colonic crypts was extracted using Automated Nucleic Acid Extractor [Scientz-NP-2032]. Total RNA from ILC3s was isolated using the RNeasy Micro Kit [Qiagen]. Reverse transcription of RNA was performed with the primers listed in Table 1. For a final volume of 20 µl, 20 µl of template RNA was reacted with SYBR PCR Master Mix [Genstar]. Reaction reagents were added to 96-well PCR plates [NEST Biotechnology]. The thermal cycling conditions were 5 min at 95°C, followed by 40 cycles of 15 s at 95°C and 34 s at 60°C using an Applied Biosystems 7500 real-time PCR system.
Primer sequences used for qRT-PCR
| Target genes | Primer sense [5’-3’] | Primer antisense [5’-3’] | Product size [bp] |
|---|---|---|---|
| mGPRC6A | CATGATTGGTGGCTTGTTTG | GCTGCTGTGACTTCGGTACA | 219 |
| mMuc2 | CAATGACAAGGTGTCCTGCC | GTGCTCTCCAAACTCTCTGG | 889 |
| mMuc5b | GTGGCCTTGCTCATGGTGT | GGACGAAGGTGACATGCCT | 139 |
| mReg3α | TCACCTGGTCCTCAACAGTATT | GGAGCGATAAGCCTTGTAACC | 139 |
| mReg3β | CAGACCTGGTTTGATGCAGA | GAAGCCTCAGCGCTATTGAG | 83 |
| mReg3γ | TTCCTGTCCTCCATGATCAAAA | CATCCACCTCTGTTGGGTTCA | 101 |
| mActinβ | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT | 154 |
| Target genes | Primer sense [5’-3’] | Primer antisense [5’-3’] | Product size [bp] |
|---|---|---|---|
| mGPRC6A | CATGATTGGTGGCTTGTTTG | GCTGCTGTGACTTCGGTACA | 219 |
| mMuc2 | CAATGACAAGGTGTCCTGCC | GTGCTCTCCAAACTCTCTGG | 889 |
| mMuc5b | GTGGCCTTGCTCATGGTGT | GGACGAAGGTGACATGCCT | 139 |
| mReg3α | TCACCTGGTCCTCAACAGTATT | GGAGCGATAAGCCTTGTAACC | 139 |
| mReg3β | CAGACCTGGTTTGATGCAGA | GAAGCCTCAGCGCTATTGAG | 83 |
| mReg3γ | TTCCTGTCCTCCATGATCAAAA | CATCCACCTCTGTTGGGTTCA | 101 |
| mActinβ | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT | 154 |
qRT-PCR, quantitative reverse transcription polymerasr chain reaction.
Primer sequences used for qRT-PCR
| Target genes | Primer sense [5’-3’] | Primer antisense [5’-3’] | Product size [bp] |
|---|---|---|---|
| mGPRC6A | CATGATTGGTGGCTTGTTTG | GCTGCTGTGACTTCGGTACA | 219 |
| mMuc2 | CAATGACAAGGTGTCCTGCC | GTGCTCTCCAAACTCTCTGG | 889 |
| mMuc5b | GTGGCCTTGCTCATGGTGT | GGACGAAGGTGACATGCCT | 139 |
| mReg3α | TCACCTGGTCCTCAACAGTATT | GGAGCGATAAGCCTTGTAACC | 139 |
| mReg3β | CAGACCTGGTTTGATGCAGA | GAAGCCTCAGCGCTATTGAG | 83 |
| mReg3γ | TTCCTGTCCTCCATGATCAAAA | CATCCACCTCTGTTGGGTTCA | 101 |
| mActinβ | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT | 154 |
| Target genes | Primer sense [5’-3’] | Primer antisense [5’-3’] | Product size [bp] |
|---|---|---|---|
| mGPRC6A | CATGATTGGTGGCTTGTTTG | GCTGCTGTGACTTCGGTACA | 219 |
| mMuc2 | CAATGACAAGGTGTCCTGCC | GTGCTCTCCAAACTCTCTGG | 889 |
| mMuc5b | GTGGCCTTGCTCATGGTGT | GGACGAAGGTGACATGCCT | 139 |
| mReg3α | TCACCTGGTCCTCAACAGTATT | GGAGCGATAAGCCTTGTAACC | 139 |
| mReg3β | CAGACCTGGTTTGATGCAGA | GAAGCCTCAGCGCTATTGAG | 83 |
| mReg3γ | TTCCTGTCCTCCATGATCAAAA | CATCCACCTCTGTTGGGTTCA | 101 |
| mActinβ | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT | 154 |
qRT-PCR, quantitative reverse transcription polymerasr chain reaction.
2.12. Statistical analysis
The results were presented as means ± standard deviation [SD]. One-way analysis of varience [ANOVA] was employed to determine significant differences among multiple groups, and a t test was employed to determine the same between two groups [*p <0.05, **p <0.01, ***p <0.001]. Data are representative of two or three independent experiments unless otherwise stated.
2.13. Data availability
Data supporting the findings of this work are available from the corresponding author upon reasonable request.
3. Results
3.1. GPRC6A regulates colonic ILC3 proliferation and function
GPRC6A is a widely expressed GPCR proposed to be a master regulator of complex metabolic processes.33 However, whether GPRC6A regulates the function of RORγt+ ILC3s [hereinafter referred to as ILC3s] remains unknown. To investigate the role of GPRC6A in ILC3s, we first tested GPRC6A mRNA expression. ILC3s of the colonic and ileal LP more highly expressed GPRC6A than ILC3s of the MLN, spleen, and PP [Figure 1A]. In this study, we focused on the role of GPRC6A in colonic ILC3 populations rather than in other tissues. To confirm the role of GPRC6A in colonic ILC3s, we analysed colonic ILC3s in GPRC6A-/-versus littermate control WT [GPRC6A+/+] mice. GPRC6A was highly expressed in purified ILC3s from WT mice but not in GPRC6A-/- mice [Figure 1B, C]. GPRC6A deficiency reduced the population frequencies and numbers of colonic ILC3s and IL-22+ ILC3s, indicating that GPRC6A affects colonic ILC3 expansion and function [Figure 1D]. These data led us to ask whether GPRC6A affects the level of ILC3 proliferation. The frequency and number of Ki-67+ ILC3s decreased in GPRC6A-/- mice [Figure 1E]. ILC3s can produce IL-22, IL-17A, and INFγ.34,35 In addition, we examined whether GPRC6A regulates IL-22, IL-17A, or INFγ production in purified ILC3s in vitro. Colonic ILC3s produced IL-22, IL-17A, or INFγ after stimulation with IL-1β and IL-23 [Figure 1F–H]. The expression of IL-22 was decreased in colonic ILC3s of GPRC6A-/- mice [Figure 1F], whereas the expression of IL-17A [Figure 1G] and INFγ [Figure 1H] was not altered in colonic ILC3s of GPRC6A-/- mice. Meanwhile, we found that the frequency of IL-22+ ILC3s was decreased in GPRC6A-/- mice [Figure 1I]. The frequency of IL-17A+ and IFNγ + ILC3s has a downward trend in GPRC6A-/- mice; however, there was no statistically significant difference [Figure 1I]. Overall, we demonstrated that GPRC6A regulates colonic ILC3 proliferation and IL-22 production.
![GPRC6A regulates colonic ILC3 proliferation and function. [A] ILC3s were purified from colonic and ileal LP, MLNs, spleens and PPs of WT mice, relative mRNA expression of GPRC6A was quantified by RT-PCR, n = 6 mice pooled per cell type per experiment. [B] ILC3s were purified from colonic LP of WT or GPRC6A-/-mice, protein levels [β-actin and GPRC6A] in colonic ILC3s were measured by western blotting. [C] Immunostaining of GPRC6A [red] and DAPI [blue] in colonic ILC3s. Scale bar, 5 μm. [D] Flow cytometry analysis of colonic ILC3 and IL-22+ ILC3 frequency and number, n = 6. [E] Flow cytometry analysis of colonic Ki67+ ILC3 frequency and number, n = 6. [F, G, H] The concentration of IL-22, IL-17A, and IFNγ in colonic ILC3 culture supernatant was detected by ELISA, n = 6. [I] Flow cytometry analysis of IL-22+, IL-17A+, and IFNγ + ILC3 frequency, n = 4. Data are the mean ± SD; comparisons performed with t tests [two groups] or analysis of variance [ANOVA] [multiple groups]; *p <0.05, **p <0.01, ***p <0.001. Results are representative of two or three independent experiments. LP, lamina propria; MLN, mesenteric lymph nodes; PP, Peyer’s patches; WT, wild-type; RT-PCR, reverse transcription polymerase chain reaction; ELISA, enzyme-linked immunosorbent assay; SD, standard deviation.](https://oup.silverchair-cdn.com/oup/backfile/Content_public/Journal/ecco-jcc/16/8/10.1093_ecco-jcc_jjac020/1/m_jjac020f0001.jpeg?Expires=1747881269&Signature=Fqq-LHaJxP4AOnzGQrW~y39Go-Ou0UewnerHTzK~VwdscAF6ZXT74d1jUzzbZ2L6e7~svD7Gr4hiycVGMzA9yYlFTW2doDII9PwYR7FiKWK2Fg4qBcRbBnF8oab7ZF-j2gO-vrzhPbzXXaow9XZ7KqGdwpPxUyNDCpFxZ9-UxQcLCv~F6IUfQ8MwH26rLPMZvRFiD2M0cXR2MRgd0VIH0vCUbr2zrFrLQhzCzISEL-MwoRwBCh548~NrllWQ6YZXafzr8XlG5JwOSUtODh9nlvNjUgWKHb5W7tU4IpBNOsUcxJRWipEbGDzevtfOIsDRCSdOLv6ROlea32f3-9T2og__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA)
GPRC6A regulates colonic ILC3 proliferation and function. [A] ILC3s were purified from colonic and ileal LP, MLNs, spleens and PPs of WT mice, relative mRNA expression of GPRC6A was quantified by RT-PCR, n = 6 mice pooled per cell type per experiment. [B] ILC3s were purified from colonic LP of WT or GPRC6A-/-mice, protein levels [β-actin and GPRC6A] in colonic ILC3s were measured by western blotting. [C] Immunostaining of GPRC6A [red] and DAPI [blue] in colonic ILC3s. Scale bar, 5 μm. [D] Flow cytometry analysis of colonic ILC3 and IL-22+ ILC3 frequency and number, n = 6. [E] Flow cytometry analysis of colonic Ki67+ ILC3 frequency and number, n = 6. [F, G, H] The concentration of IL-22, IL-17A, and IFNγ in colonic ILC3 culture supernatant was detected by ELISA, n = 6. [I] Flow cytometry analysis of IL-22+, IL-17A+, and IFNγ + ILC3 frequency, n = 4. Data are the mean ± SD; comparisons performed with t tests [two groups] or analysis of variance [ANOVA] [multiple groups]; *p <0.05, **p <0.01, ***p <0.001. Results are representative of two or three independent experiments. LP, lamina propria; MLN, mesenteric lymph nodes; PP, Peyer’s patches; WT, wild-type; RT-PCR, reverse transcription polymerase chain reaction; ELISA, enzyme-linked immunosorbent assay; SD, standard deviation.
3.2. GPRC6A agonist promotes colonic ILC3-driven IL-22 via mTOR activation
GPRC6A is known to be a receptor for basic amino acids such as L-arginine, L-lysine, and L-ornithine.36–38 We sorted colonic ILC3s from WT mice and stimulated the cells in vitro with L-arginine, L-glycine, L-tryptophan, L-glutamate, and L-lysine. As expected, L-arginine, and L-lysine increased the production of ILC3-derived IL-22 upon stimulation with IL-1β and IL-23 [Figure 2A, B]. Moreover, L-arginine was the most effective among these L-amino acids [Figure 2B]. Hence, we selected L-arginine as a GPRC6A agonist to elucidate a potential role for GPRC6A in ILC3s. To investigate whether GPRC6A was involved in the increased ILC3-derived IL-22 induced by L-arginine stimulation, we sorted colonic ILC3s from GPRC6A-/- and WT mice and stimulated the cells in vitro with L-arginine. L-arginine increased IL-22 production in WT ILC3s in collaboration with IL-1β and IL-23 [Figure 2C, D]. As expected, treatment of GPRC6A-/- ILC3s with L-arginine had no effect [Figure 2D]. To evaluate further how GPRC6A signalling regulates colonic ILC3-derived IL-22, we analysed the protein phosphorylation of candidate GPRC6A downstream effectors by flow cytometry. L-arginine promotes diverse physiological effects, such as immune cell activation and protein synthesis, largely mediated through activation of mTORC1.39–41 IL-1β and IL-23 enhanced the phosphorylation of S6 protein in both WT and GPRC6A-/- ILC3s [Figure 2E]. In addition, L-arginine enhanced the phosphorylation of S6 protein in WT ILC3s [Figure 2E]. However, treatment of GPRC6A-/- ILC3s with L-arginine had no effect [Figure 2E]. In addition, we examined the roles of mTORC1 in L-arginine-mediated ILC3 proliferation and ILC3-derived IL-22 using an mTOR inhibitor rapamycin. Rapamycin decreased not only colonic ILC3-derived IL-22 production [Figure 2F] but also suppressed L-arginine-induced colonic ILC3 proliferation [Figure 2G]. These results indicate that L-arginine, a GPRC6A agonist, enhanced colonic ILC3-derived IL-22 production and ILC3 proliferation. In addition, mTORC1 signalling was involved in the regulation of ILC3s by L-arginine.
![GPRC6A agonist promotes colonic ILC3-drived IL-22 via mTOR activation. [A, B] Colonic ILC3s from WT mice were stimulated with the L-arginine, L-glycine, L-tryptophan, L- glutamate, and L-lysine supplementation in the presence of rmIL-23 and rmIL-1β or PBS. The concentration of IL-22 in ILC3 culture supernatant was detected by ELISA, n = 6. [C-E] Colonic ILC3s from WT or GPRC6A-/-mice were unstimulated or stimulated with L-arginine in the presence of IL-1β and IL-23 or PBS. [C, D] The concentration of IL-22 in colonic ILC3 culture supernatant was detected by ELISA, n = 3. [E] Flow cytometry analysis of colonic P-S6+ ILC3 frequency and number, n = 4. [F, G] Colonic ILC3s from WT mice were unstimulated or stimulated with L-arginine and rapamycin in the presence of IL-1β and IL-23. [F] The concentration of IL-22 in colonic ILC3 culture supernatant was detected by ELISA, n = 6. [G] Flow cytometry analysis of colonic P-S6+ ILC3 frequency, n = 6. Data are the mean ± SD; comparisons performed with t tests [two groups] or analysis of variance [ANOVA] [multiple groups]; *p <0.05, **p <0.01, ***p <0.001. Results are representative of two or three independent experiments. WT, wild-type; PBS, phosphate-buffered saline; ELISA, enzyme-linked immunosorbent assay.](https://oup.silverchair-cdn.com/oup/backfile/Content_public/Journal/ecco-jcc/16/8/10.1093_ecco-jcc_jjac020/1/m_jjac020f0002.jpeg?Expires=1747881269&Signature=n2ojo9ll1RTJOGTwfrq6mrKB0jt2RZRUKBCeHIlRelcz4lV9UAQJxCnmL-hstNx7HuFcgIRTboBGnjxI8fXw8UVSIz9ba6faK5WoDXhtZMQbe7tYZwmSujwWyAySFp3ywmY4e844ZvWYfb2GiZxhbfZMYvgzkPYZQYxFSDmsR35r2KlJdjzUrTCm71KSGg1V8uo2vSXkdWovfgli2XDRZZhkXIm9V-FgUqfb~ZUWeY37TJbtvh5XXvoQCsqx2xWWeBj9uPRX0nwvNRINVzjpO7b7I4XBHC4Y~uvbnBr6OrD7CzYuDETrRUSoCCQd3cyl6yV8r-J0pHpWmUVI3P4L1A__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA)
GPRC6A agonist promotes colonic ILC3-drived IL-22 via mTOR activation. [A, B] Colonic ILC3s from WT mice were stimulated with the L-arginine, L-glycine, L-tryptophan, L- glutamate, and L-lysine supplementation in the presence of rmIL-23 and rmIL-1β or PBS. The concentration of IL-22 in ILC3 culture supernatant was detected by ELISA, n = 6. [C-E] Colonic ILC3s from WT or GPRC6A-/-mice were unstimulated or stimulated with L-arginine in the presence of IL-1β and IL-23 or PBS. [C, D] The concentration of IL-22 in colonic ILC3 culture supernatant was detected by ELISA, n = 3. [E] Flow cytometry analysis of colonic P-S6+ ILC3 frequency and number, n = 4. [F, G] Colonic ILC3s from WT mice were unstimulated or stimulated with L-arginine and rapamycin in the presence of IL-1β and IL-23. [F] The concentration of IL-22 in colonic ILC3 culture supernatant was detected by ELISA, n = 6. [G] Flow cytometry analysis of colonic P-S6+ ILC3 frequency, n = 6. Data are the mean ± SD; comparisons performed with t tests [two groups] or analysis of variance [ANOVA] [multiple groups]; *p <0.05, **p <0.01, ***p <0.001. Results are representative of two or three independent experiments. WT, wild-type; PBS, phosphate-buffered saline; ELISA, enzyme-linked immunosorbent assay.
3.3. GPRC6A protects the gut epithelial barrier from intestinal inflammation
GPCRs regulate various gut functions, including digestion, immunity, and tissue repair.23 IL-22-producing ILC3s play critical roles in regulating intestinal mucosal barrier functions such as cytokine, antimicrobial peptide, and mucus production.42 We have demonstrated that GPRC6A regulates colonic ILC3 expansion and function. These findings raise the question of whether GPRC6A expression in ILC3s affords protection from intestinal inflammation. Analysis of gene expression in the colon of GPRC6A-/- mice revealed decreased Muc2, Muc5b, Reg3α, Reg3β, and Reg3γ expression [Figure 3A]. Moreover, we observed a lower percentage of EdU+ proliferating cells and Muc2+ goblet cells in the colon of GPRC6A-/- mice [Supplementary Figure S2D]. However, body weight [Supplementary Figure S2A], tissue morphology [Supplementary Figure S2B], and colon length [Supplementary Figure S2C] were not significantly affected in GPRC6A-/- mice under steady-state conditions.
![GPRC6A protects gut epithelial barrier from intestinal inflammation. [A] Gene expression in colonic epithelial cells from GPRC6A-/- compared with littermate WT [GPRC6A+/+] mice, n = 6. [B-H] WT and GPRC6A-/- mice were treated with 2% DSS for 5 days, n = 5. [B] Body weight changes. [C] Percent survival. [D] Colon length. [E] Pathology and pathology score of colons by H&E staining. Scale bar, 200 μm. [F] Organoid frequency of colonic crypts. Scale bar, 1000 μm. [G, H] Flow cytometry analysis of colonic ILC3 and IL-22+ ILC3 frequency and number. Data are the mean ± SD; comparisons performed with t tests [two groups] or analysis of variance [ANOVA] [multiple groups]; *p <0.05, **p <0.01, ***p <0.001. Results are representative of two or three independent experiments. DSS, dextran sodium sulphate; H&E, haematoxylin and eosin; WT, wild-type; SD, standard deviation.](https://oup.silverchair-cdn.com/oup/backfile/Content_public/Journal/ecco-jcc/16/8/10.1093_ecco-jcc_jjac020/1/m_jjac020f0003.jpeg?Expires=1747881269&Signature=qR3O1yP2H5EDNbKPVXU0l9QgECpOH~kqsDtX--DCHx-oEnk~3F3n8Qtg1bBK02S58slsIryu8DesexUi5mvpDjTCVFCPlIhWZ0cTBnCndkaACH2hxLQhy-4oPEUDomkfU-9Ex1u6nSsCx6yy0cx75M497Hfku4u1sHQCMZdKGOG6zy-Lb3d3WjzUnGbkeQGbIuyii3HYwwGBYLA--ZxH~1ak4F5mqMRx-~xvjsu2kZlLHsbAIDbl6jtsukSUDquA3Hy~26gnhZe9U0iuCBmGrqd7zr33ihEZiayNM04Jjez2h2n9s1SgQfl40OlDl65eoVXJDWGFbhcgpdCyyFekJA__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA)
GPRC6A protects gut epithelial barrier from intestinal inflammation. [A] Gene expression in colonic epithelial cells from GPRC6A-/- compared with littermate WT [GPRC6A+/+] mice, n = 6. [B-H] WT and GPRC6A-/- mice were treated with 2% DSS for 5 days, n = 5. [B] Body weight changes. [C] Percent survival. [D] Colon length. [E] Pathology and pathology score of colons by H&E staining. Scale bar, 200 μm. [F] Organoid frequency of colonic crypts. Scale bar, 1000 μm. [G, H] Flow cytometry analysis of colonic ILC3 and IL-22+ ILC3 frequency and number. Data are the mean ± SD; comparisons performed with t tests [two groups] or analysis of variance [ANOVA] [multiple groups]; *p <0.05, **p <0.01, ***p <0.001. Results are representative of two or three independent experiments. DSS, dextran sodium sulphate; H&E, haematoxylin and eosin; WT, wild-type; SD, standard deviation.
Given the impaired gut epithelial barrier functions and decreased IL-22+ ILC3s [Figure 1D] in GPRC6A-/- mice, we investigated the role of GPRC6A in colonic host repair and defence. We built a DSS-induced colitis model and determined whether GPRC6A expression in ILC3s contributes to the regulation of intestinal inflammation. GPRC6A-/- mice treated with 2% DSS exhibited more weight loss [Figure 3B], lower percent survival [Figure 3C], shorter colon length [Figure 3D], and worse histological colitis scores [Figure 3E] than WT mice. Notably, the population frequencies and numbers of colonic ILC3s and IL-22+ ILC3s decreased in GPRC6A-/- mice treated with DSS compared with WT mice [Figure 3G, H]. To investigate the role of GPRC6A in inflamed mucosal healing, we tested the potential of isolated crypts to form clonal organoid bodies in vitro. GPRC6A-/- mice treated with DSS exhibited fewer crypt-formed organoids than WT mice [Figure 3F]. Moreover, disease symptoms such as body weight loss [Supplementary Figure S2E], colon shortening [Supplementary Figure S2F], and intestinal mucosal damage [Supplementary Figure S2G] were ameliorated by treatment with IL-22 in GPRC6A-/- mice treated with DSS. These results demonstrated that susceptibility to colonic injury was increased in GPRC6A-/- mice.
ILC3-derived IL-22 could clear C. rodentium in the early stage of infection.15,26 To evaluate the effect of GPRC6A on host defence, we used the C. rodentium infection model. Similarly to our observations with the DSS model, GPRC6A deficiency increased disease severity, including body weight change [Supplementary Figure S3A], colon length [Supplementary Figure S3B], and histological colitis scores [Supplementary Figure S3C] in the C. rodentium infection model. In addition, there was increased C. rodentium translocation to the liver and spleen in GPRC6A-/- mice compared with WT mice [Supplementary Figure S3D]. Moreover, the population frequencies, numbers of colonic ILC3s, and IL-22+ ILC3s decreased in C. rodentium-infected GPRC6A-/- mice compared with conditional control mice [Supplementary Figure S3E]. Collectively, these data support that GPRC6A contributes to host defence against enteric bacterial infection.
3.4. L-arginine protects against intestinal inflammation
We have demonstrated that L-arginine is an efficient GPRC6A agonist and that GPRC6A protects the gut epithelial barrier from intestinal inflammation. These findings raise the question of whether L-arginine protects against gut injury. Consistent with previous studies,28,43 WT mice were fed drinking water containing 7 mg/ml L-arginine for 2 weeks. The L-arginine concentration was higher in colonic tissue and serum after L-arginine treatment in WT mice [Supplementary Figure S4A]. To induce typical acute colitis, mice were given a higher dose of DSS [3%] in their drinking water for 5 days in the second week. The L-arginine-treated WT mice exhibited reduced body weight loss [Figure 4A], improved percent survival [Figure 4B], increased colon length [Figure 4C], and decreased histological colitis scores [Figure 4D] compared with controls. Furthermore, we assessed whether L-arginine treatment accelerated inflamed wound healing in DSS-induced colitis. Notably, the percentage of EdU+ proliferating cells and Muc2+ goblet cells increased in the colon of L-arginine-treated WT mice [Figure 4F]. Furthermore, L-arginine treatment resulted in more crypt-formed organoids in DSS-induced colitis [Figure 4E]. We confirmed in vitro that L-arginine enhanced colonic ILC3-derived IL-22 production. Hence, we speculated that L-arginine could accelerate ILC3-derived IL-22 production in vivo.
![L-arginine affords protection from intestinal inflammation. [A-G] WT mice were given normal water or 7 mg/ml L-arginine in their drinking water for 2 weeks, and in the last week mice were treated with 3% DSS for 5 days, n = 6. [A] Body weight changes. [B] Percent survival. [C] Colon length. [D] Pathology and pathology score of colons by H&E staining. Scale bar, 200 μm. [E] Organoid frequency of colonic crypts. Scale bar, 1000 μm. [F] Immunostaining of EdU [red], Muc2[green] and DAPI [blue] in colon. Scale bar, 50 μm. [G] Flow cytometry analysis of colonic ILC3 and IL-22+ ILC3 frequency and number. Data are the mean ± SD; comparisons performed with t tests [two groups] or analysis of variance [ANOVA] [multiple groups]; *p <0.05, **p <0.01, ***p <0.001. Results are representative of two or three independent experiments. DSS, dextran sodium sulphate; H&E, haematoxylin and eosin; WT, wild-type; SD, standard deviation.](https://oup.silverchair-cdn.com/oup/backfile/Content_public/Journal/ecco-jcc/16/8/10.1093_ecco-jcc_jjac020/1/m_jjac020f0004.jpeg?Expires=1747881269&Signature=0ZARmvCKM1044Xz3A7TQct-bfFOtHuKdyeIpJCj8EvrXovrAq-8bc0Tjh3lyZt0El97UDXrv~u2O7rw1z2kqyrJhQOMmztjsN-9FaEWEJDVygSlXjKdctV4QvLFBKccK5NLSrAYLC3~7X5g8-g8hKGSOH~6Ny9eRBMLc3~pAGP~SRLFoGId48Z5mJZUuDiDtsu4MhAk~aiiPje2-2Zv8BQjB1yK0xUeKOaRNPf0yvys6slGZsHJQsJ2vSadm9NcCFQKMCnlk0kiuJXYeWthJU1Nk4WVSgeyu6Ek1ssiyui9Evph4Ip-8jLN-vwy3vPcDAbLdGYZzGGJh-rw4AFuexg__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA)
L-arginine affords protection from intestinal inflammation. [A-G] WT mice were given normal water or 7 mg/ml L-arginine in their drinking water for 2 weeks, and in the last week mice were treated with 3% DSS for 5 days, n = 6. [A] Body weight changes. [B] Percent survival. [C] Colon length. [D] Pathology and pathology score of colons by H&E staining. Scale bar, 200 μm. [E] Organoid frequency of colonic crypts. Scale bar, 1000 μm. [F] Immunostaining of EdU [red], Muc2[green] and DAPI [blue] in colon. Scale bar, 50 μm. [G] Flow cytometry analysis of colonic ILC3 and IL-22+ ILC3 frequency and number. Data are the mean ± SD; comparisons performed with t tests [two groups] or analysis of variance [ANOVA] [multiple groups]; *p <0.05, **p <0.01, ***p <0.001. Results are representative of two or three independent experiments. DSS, dextran sodium sulphate; H&E, haematoxylin and eosin; WT, wild-type; SD, standard deviation.
Here, we found that the evolution of DSS-induced colitis was associated with increased expression of IL-1β, IL-6, and IL-22 [Supplementary Figure S4B]. Interestingly, treatment with L-arginine inhibited the expression of IL-1β and IL-6 but significantly enhanced the expression of IL-22 in DSS-induced colitis [Supplementary Figure S4B]. Furthermore, L-arginine treatment increased the frequency and number of IL-22-secreting colonic LPLs [Supplementary Figure S4C]. In the intestinal mucosa, IL-22 is mainly produced by T helper cells and ILC3s.14 Subsequently, we detected the frequency of IL-22-secreting T helper cells [Supplementary Figure S4D] and ILC3s [Figure 4F] from colonic LP. We found that L-arginine treatment did not alter the IL-22+ T helper cells [Supplementary Figure S4D]. However, L-arginine treatment increased the frequency and numbers of ILC3s and IL-22+ ILC3s [Figure 4F]. The mRNA expression of Muc2, Muc5b, Reg3α, Reg3β, and Reg3γ was also increased in the colonic tissues of L-arginine-treated mice [Supplementary Figure S4E].
Furthermore, we used GPRC6A-/- mice to investigate the role of GPRC6A in L-arginine-mediated gut repair in DSS-induced colitis. Consistent with WT mice, GPRC6A-/- mice were fed drinking water containing 7 mg/ml L-arginine for 2 weeks and then given 3% DSS in their drinking water for 5 days in the second week. GPRC6A knockout reversed the protective effect of L-arginine on DSS-induced colonic injury, including survival percentage [Supplementary Figure S5A], colon length [Supplementary Figure S5B], numbers of EdU+ proliferating cells and Muc2+ goblet cells [Supplementary Figure S5C], histological colitis scores [Supplementary Figure S5D], crypt-formed organoids [Supplementary Figure S5E], and ILC3 and IL-22+ ILC3 frequency and numbers [Supplementary Figure S5F]. Overall, it is evident that the protective effect of L-arginine during inflammation is mediated, at least in part, by ILC3-derived IL-22. Moreover, GPRC6A was involved in the protective effect of L-arginine in intestinal inflammation.
3.5. IL-22 mediates the protective effect of L-arginine in intestinal inflammation
To confirm that IL-22 plays an anti-inflammatory role in DSS-induced colitis, we examined the effect of direct administration of IL-22. Mice treated with DSS developed colitis, and disease symptoms such as colon shortening and intestinal mucosal damage were ameliorated by treatment with IL-22 [Figure 5A, B]. Moreover, IL-22 treatment resulted in more crypt-formed organoids under pathological and physiological conditions [Figure 5C]. These results indicated that IL-22 promoted inflamed wound healing and ameliorated intestinal inflammation. We demonstrated that L-arginine increased ILC3-derived IL-22 production and afforded protection from intestinal inflammation.
![IL-22 mediates the protective effect of L-arginine in intestinal inflammation. [A-C, G] WT mice were treated with 3% DSS in their drinking water for 5 days and were treated with 500 ng IL-22 or PBS as a control [mice were treated every day for 5 days], n = 6. [A] Colon length. [B] Pathology and pathology score of colons by H&E staining. Scale bar, 200 μm. [C] Organoid frequency of colonic crypts. Scale bar, 250 μm. [D-F, H] WT mice were given normal water or 7 mg/ml L-arginine in their drinking water for 2 weeks. In the last week mice were treated with 3% DSS for 5 days and given 500 μg anti-IL-22 once on Day 1, n = 6. [A] Colon length. [B] Pathology and pathology score of colons by H&E staining. Scale bar, 200 μm. [C] Organoid frequency of colonic crypts. Scale bar, 250 μm. [G, H, I] Protein levels [GAPDH, STAT3, and p-STAT3] in colonic tissues were measured by western blotting, n = 3. Data are the mean ± SD; comparisons performed with t tests [two groups] or analysis of variance [ANOVA] [multiple groups]; *p <0.05, **p <0.01, ***p <0.001. Results are representative of two or three independent experiments. DSS, dextran sodium sulphate; H&E, haematoxylin and eosin; WT, wild-type; SD, standard deviation; PBS, phosphate-buffered saline.](https://oup.silverchair-cdn.com/oup/backfile/Content_public/Journal/ecco-jcc/16/8/10.1093_ecco-jcc_jjac020/1/m_jjac020f0005.jpeg?Expires=1747881269&Signature=I-rDXMtndJ6R3WpmqWAdvaCRQgeo2kk8maU~54PaUzrfp66BJlNZ~NcO-Fo~GYOqW4NYhOGmnpzfKk5MvkdywHsLhuFkZkto58L8VG-Cie8c8i~rmZGyeGpl8BsgzTEN3SEn~xex8DHmHlaELKW7SaN14rs6XUIz1rewccl2AzCyeFx3eVNaA2EbvT~O5VfpQKrrpXzANw9DH9oeJrj-smlmh-mipgGDXt3g8V892sRuyH73dKGaRokcZXPFPlFNmZyDl-dCbiGishwsTSOTNB5nnaxLZyLz7lG-PEGu0vYiDQFxAJiHzPc4jiUbozXQXkd8yso3cybUnvEoepLXYQ__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA)
IL-22 mediates the protective effect of L-arginine in intestinal inflammation. [A-C, G] WT mice were treated with 3% DSS in their drinking water for 5 days and were treated with 500 ng IL-22 or PBS as a control [mice were treated every day for 5 days], n = 6. [A] Colon length. [B] Pathology and pathology score of colons by H&E staining. Scale bar, 200 μm. [C] Organoid frequency of colonic crypts. Scale bar, 250 μm. [D-F, H] WT mice were given normal water or 7 mg/ml L-arginine in their drinking water for 2 weeks. In the last week mice were treated with 3% DSS for 5 days and given 500 μg anti-IL-22 once on Day 1, n = 6. [A] Colon length. [B] Pathology and pathology score of colons by H&E staining. Scale bar, 200 μm. [C] Organoid frequency of colonic crypts. Scale bar, 250 μm. [G, H, I] Protein levels [GAPDH, STAT3, and p-STAT3] in colonic tissues were measured by western blotting, n = 3. Data are the mean ± SD; comparisons performed with t tests [two groups] or analysis of variance [ANOVA] [multiple groups]; *p <0.05, **p <0.01, ***p <0.001. Results are representative of two or three independent experiments. DSS, dextran sodium sulphate; H&E, haematoxylin and eosin; WT, wild-type; SD, standard deviation; PBS, phosphate-buffered saline.
These results led us to ask whether the protective effect of L-arginine is mediated through IL-22. To test this, we neutralised IL-22 in vivo. In contrast, treatment with IL-22 neutralising antibodies reversed the protective effect of L-arginine in DSS-induced colitis [Figure 5D, E]. Moreover, anti–IL-22 inhibited the stimulative effect of L-arginine treatment on crypt-formed organoids in mice treated with DSS [Figure 5F]. Previous studies demonstrated that STAT3 links IL-22 signalling in intestinal epithelial cells to mucosal wound healing.16,20,44 We evaluated STAT3 signals in the colonic epithelium and found that IL-22 increased the phosphorylation of STAT3 Tyr705 [Figure 5G]. Furthermore, L-arginine supplementation increased the phosphorylation of STAT3 Tyr705 in colonic crypts from mice treated with DSS, which could be reversed by IL-22 neutralising antibodies [Figure 5H] and GPRC6A knockout [Figure 5I]. Collectively, these data support that IL-22 mainly mediates the protective effect of L-arginine in intestinal inflammation.
4. Discussion
Dietary feeding regulates the immune response and influences gastrointestinal health. Some nutrients and their metabolites directly activate metabolite-sensing GPCRs, and these engagements induce immunological responses that contribute to various gut functions, including digestion, immunity, and tissue repair.23 ILC3s sense environmental signals that play crucial roles in gut homeostasis and repair. However, the mechanism by which GPCRs regulate ILC3s is mainly unknown. GPRC6A, a widely expressed GPCR, is proposed to be a master regulator of complex metabolic processes.27 Our study unveiled a heretofore unknown role for the nutrient-sensing receptor GPRC6A in colonic ILC3 function and identified a novel ILC3 receptor signalling pathway modulating inflamed mucosal healing.
Gut resident ILC3s are enriched in intestinal LP, where they maintain gut homeostasis by orchestrating immunomodulation, microbiota balance, and tissue repair.8 RORγt-expressing ILC3s are the key source of innate IL-22,12,13 although IL-22 expression is not limited to these cell types.14 Recent studies demonstrated that ILC3s highly expressed GPR43 and GPR183, and GPCR agonists selectively promoted colonic ILC3 populations and their functions.24–26,45 To investigate the role of GPRC6A in ILC3s, we purified colonic ILC3s from WT mice and GPRC6A-/- mice. We found that colonic ILC3s highly expressed GPRC6A. GPRC6A deficiency reduced the population frequencies and numbers of colonic ILC3s and IL-22+ ILC3s, indicating that GPRC6A affects colonic ILC3 expansion and function. In addition, the frequency and number of Ki-67+ proliferating ILC3s decreased in GPRC6A-/- mice. Overall, we demonstrated that GPRC6A is highly expressed in colonic ILC3s and GPRC6A could be a positive regulator of colonic ILC3 expansion and ILC3-derived IL-22.
Furthermore, we explored how GPRC6A regulated colonic ILC3 function. Over the past two decades, various agonists of GPRC6A have been reported, including cations such as calcium, the basic amino acids L-arginine and L-lysine, the bone-derived peptide osteocalcin, and testosterone.27 Moreover, L-arginine stimulates the functional activities of different cell types in the immune system, including macrophages, T cells, and B cells.28,41,46–49 We speculated that L-arginine might be a highly efficient GPRC6A agonist for ILC3 regulation. As expected, our data demonstrated that L-arginine enhanced colonic ILC3-derived IL-22 production and ILC3 proliferation. L-arginine promotes diverse physiological effects, such as immune cell activation and protein synthesis, largely mediated through activation of mTORC1.39–41 Further studies showed that L-arginine stimulation of IL-22 secretion in ILC3s is mediated, at least in part, through GPRC6A activation of mTORC1 pathways. Natural ligands, such as L-arginine and osteocalcin, require high doses and the response is transient. Moreover, L-arginine and osteocalcin have other biological functions that limit their utility as highly selective agonists of GPRC6A. There is an urgent need to develop small molecule drugs that bind to and activate GPRC6A. DJ-V-159 was identified as a small molecule drug that selectively activates GPRC6A, leading to stimulation of insulin secretion in vitro, with potency similar to L-arginine.50 Heretofore, DJ-V-159 is the only selective agonist for GPRC6A in drug libraries. GPRC6A is a potential therapeutic target in human diseases, but research is still a long way from developing more drugs to target GPRC6A.
New data showed that inflamed mucosa healing could be a new target for improving clinical symptoms, disease recurrence, and resection-free survival in IBD-treated patients.4–6 Many studies have shown that GPCR repair can accelerate mucosal wound healing rather than downregulate inflammation, similar to most anti-inflammatory drugs.23 GPCRs may become an important therapeutic target to promote the repair of acute and chronic intestinal inflammation. We found that GPRC6A plays critical role regulating intestinal epithelial barrier functions such as mucus and antimicrobial peptide production. Moreover, GPRC6A-/- mice were more susceptible to DSS- or C. rodentium-induced colonic injury than WT mice.
We have demonstrated that L-arginine is an efficient GPRC6A agonist for ILC3 functions. We next investigated the role of GPRC6A agonists in intestinal inflammation. Some evidence indicates that L-arginine uptake by colonic cells is defective in ulcerative colitis []patients, contributing to the pathogenesis of colitis.51,52 Dietary L-arginine ameliorated intestinal inflammation in experimental colitis.53–55 However, the mechanism by which L-arginine protects against gut inflammation is still unclear. Consistently with previous studies, L-arginine reduced disease severity and promoted intestinal epithelial regeneration in the DSS model. Moreover, treatment with L-arginine inhibited the production of IL-1β, IL-6, and IL-17 but significantly enhanced the expression of IL-22 in DSS-induced colitis. L-arginine treatment increased the frequency and number of IL-22-secreting colonic LPLs in the DSS model. In the intestinal mucosa, IL-22 is mainly produced by T helper cells and ILC3s.14 Subsequently, we detected the frequency of IL-22-secreting T helper cells and ILC3s from colonic LP. We found that L-arginine treatment did not alter the frequency and number of IL-22+ T helper cells but increased the frequency and number of IL-22+ ILC3s. However, GPRC6A knockout reversed the protective effect of L-arginine on gut injury in the DSS model. We have demonstrated that L-arginine increased ILC3-derived IL-22 production and afforded protection from intestinal inflammation. These results led us to ask whether the protective effect of L-arginine is mediated through IL-22.
To test this, we neutralised IL-22 in vivo. As expected, treatment with IL-22 neutralising antibodies reversed the protective effect of L-arginine in DSS-induced colitis. Collectively, these data demonstrated that the protective effect of L-arginine during inflammation is mediated, at least in part, by ILC3-derived IL-22. Moreover, GPRC6A was involved in the protective effect of L-arginine in intestinal inflammation. However, whether the GPRC6A-ILC3-IL22 axis is involved in the protective effect of L-arginine during inflammation needs to be further verified in GPRC6A ILC3-specific conditional knockout mice.
The present study showed that colonic ILC3s express GPRC6A and that loss of GPRC6A decreased ILC3-derived IL-22 production and the number of proliferating ILC3s. Moreover L-arginine, a GPRC6A agonist, promoted colonic ILC3 expansion and function via mTORC1 signalling. L-arginine enhanced IL-22 production by ILC3s, which corresponded with accelerated inflamed mucosal healing in DSS-induced colitis. Our findings unveil a role for the nutrient-sensing receptor GPRC6A in colonic ILC3 function and identify a novel ILC3 receptor signalling pathway modulating inflamed mucosal healing. We also predict that GPRC6A could thus be an interesting target for new drugs in IBD therapeutic areas. What merits attention is that L-arginine supplementation can ameliorate the inflamed mucosal healing of IBD in a mouse model. However, what kinds of patients are the best candidates for L-arginine treatment? What will be the optimum dose of L-arginine in the treatment of IBD? There is still a long way to go to establish the safety and efficacy of L-arginine in clinical trials in human IBD diseases. Before these questions are answered, food supplements of L-arginine should be cautiously taken to treat human IBD diseases.
Funding
This work was supported by the National Key R&D Program of China [2017YFE0129900] and by the 2115 Talent Development Program of China Agricultural University.
Conflicts of Interest
The authors have declared that no conflict of interest exists.
Author Contributions
QH was responsible for the design of the study, performing the experiments, data analysis, and writing the manuscript; JH helped write the manuscript; YG and XX helped design the experiment; BZ was responsible for the concept and design of the study, drafting the article, and final approval of the version submitted.
