-
PDF
- Split View
-
Views
-
Cite
Cite
Sho Maejima, Yuta Abe, Shohei Yamaguchi, Sergei Musatov, Sonoko Ogawa, Yasuhiko Kondo, Shinji Tsukahara, VGF in the Medial Preoptic Nucleus Increases Sexual Activity Following Sexual Arousal Induction in Male Rats, Endocrinology, Volume 159, Issue 12, December 2018, Pages 3993–4005, https://doi.org/10.1210/en.2018-00804
Close -
Share
Abstract
The central part of the medial preoptic nucleus (MPNc) is associated with sexual arousal induction in male rats. However, it is largely unclear how males are sexually aroused and achieve their first copulation. We previously reported that more MPNc neurons activate during the first copulation than the second copulation. In this study, to explore the molecules responsible for sexual arousal induction, we performed DNA microarray of the MPNc in sexually naive males and males after they copulated for their first and second times. We then performed quantitative PCR analyses to validate the results of the DNA microarray. Six genes were identified. Their expression increased following copulation and was higher in males after they copulated for the first time than after the second time. The genes encode transcription factors (Fos, Nfil3, and Nr4a3), a serine/threonine kinase (Sik1), an antioxidant protein (Srxn1), and a neuropeptide precursor VGF (Vgf), which may be the candidate genes responsible for sexual arousal induction. We examined the effects of Vgf knockdown in the MPNc on sexual partner preference and sexual behavior in sexually inexperienced and experienced males to determine the role of VGF in sexual arousal induction. A preference for estrous female rats was reinforced, and the latency of mount and intromission became short after sexually inexperienced males copulated for the first time. However, Vgf knockdown disrupted these phenomena. Vgf knockdown did not have any significant effect in sexually experienced males. VGF-derived neuropeptides presumably serve as an effector molecule to increase sexual activity following sexual arousal induction.
Adult male rats are intrinsically motivated to copulate; therefore, males attempt to display sexual behavior when they encounter sexually attractive female rats. The sexual motivation of males is reinforced by copulation, which reflects the greater efficiency of sexual behavior in rats for their next opportunity to copulate (1–3). Thus, the sexual activity of males increases in response to successful mating. Male sexual behavior in rodents has been studied for a long time, and the neural systems controlling the display of male sexual behavior have been well described (4). However, it is not well understood how males are sexually aroused and achieve their first copulation.
The medial preoptic nucleus (MPN) plays an essential role in the regulation of male sexual behavior in many species (4, 5). Electrical stimulation of the MPN induces male sexual behavior (6, 7), whereas lesions of the MPN disrupt male sexual behavior in rats (8–10). According to accumulating evidence, the MPN of male rats is considered to be a regulatory center that receives olfactory stimuli from estrous female rats and somatosensory stimuli from genitalia via the medial amygdala and the bed nucleus of the stria terminalis, and then transmits neural signals to the lower brain stem, including the ventral tegmental area, periaqueductal gray, and paragigantocellular nucleus, to control sexual behavior and ejaculation (11, 12). Thus, the MPN is a core part of the system regulating male sexual behavior.
The MPN is anatomically separated into three parts: that is, the central, medial, and lateral parts (13). The central part of the MPN (MPNc) is well known to exhibit morphological sex differences. The MPNc includes a sexually dimorphic nucleus (SDN), which is larger in volume and contains more neurons in male rats than in female rats (14, 15). Additionally, the SDN contains a cluster of neurons expressing calbindin-D28K (Calb), the so-called Calb-SDN, which is larger in volume and contains more Calb-expressing neurons in males than in females of rats and mice (16, 17). Lesions of the MPNc, including the SDN/Calb-SDN, induce delays in sexual behavior and reduce its frequency in sexually naive male rats (18). However, lesions of the MPNc have no significant effect on male sexual behavior in sexually experienced male rats that have ejaculated at least twice (9). These findings suggest that the MPNc of male rats is involved in sexual arousal induction, followed by increased sexual activity dependent on sexual experience. Additionally, lordosis, a female sexual behavior in rodents, occurs in male rats when they are subjected to MPNc lesions and treated with ovarian hormones (19), which suggests that male MPNc also functions to inhibit the sexual behavior of the opposite sex.
Several lines of evidence have demonstrated that sexual experience influences the medial preoptic area (MPA), including the MPN, in male rodents at the molecular and structural levels. In the MPA of male mice, the number of cells expressing the androgen receptor, which contributes to the regulation of male sexual behavior (20, 21), is greater in sexually experienced males compared with sexually naive males (22). Sexual experience increases the density of mushroom spines and the expression of PSD-95, which is involved in synaptic plasticity and dendritic spine stabilization (23), in the MPA of male mice (24). Additionally, sexual experience upregulates the expression of GluN1, a subunit of N-methyl-d-asparate glutamate receptor, and Calb in the MPA of male mice (24). Oxytocin, which serves as a neuropeptide in the MPA, facilitates male sexual behavior in rats (25). The expression of its receptor in the MPA of the male rat increases with sexual experience (26). Nitric oxide acts in the MPA to facilitate male sexual behavior (27), and nitric oxide synthase expression in the MPA of male rats increases with sexual experience (28, 29). Dopamine released in the MPA facilitates sexual behavior in male rats (5, 30). Sexual experience enhances dopamine signaling in the MPA of male rats by increasing the expression of phosphorylated dopamine- and cAMP-regulated phosphoprotein, a downstream molecule for dopamine signaling (31). Taken together, these observations suggest that the alterations of the MPA by sexual experience are related to greater efficiency of male sexual behavior following sensitization of the MPA to sexual stimuli.
Considering the previous studies showing that lesions of the MPNc adversely affect sexual behavior in sexually naive males but not in sexually experienced males (9, 18), the MPNc may be functional during the first copulation to induce sexual arousal and dysfunctional after acquisition of the first copulatory experience. An analysis of c-Fos in our recent study suggested that the MPNc contains a neuronal population that activates during the first copulation and then silences after acquisition of the first copulatory experience (32). However, the molecular mechanisms by which the MPNc is functional during the first copulation to induce sexual arousal are largely unclear. In this study, we performed a genome-wide expression analysis to determine whether copulation and copulatory experiences influence MPNc gene expression in male rats. The analysis results identified several genes, including Vgf coding a neuropeptide precursor VGF, whose expression was induced by copulation and was higher in the first copulation than in the second copulation. It was reported that VGF-derived neuropeptides are involved in the control of sexual behavior and penile erection in male rodents (33, 34). A concomitant increase in the synthesis of a neuropeptide occurs with release of the neuropeptide to compensate for the depletion of stored materials (35–37). Therefore, we hypothesized that VGF-derived neuropeptides released from the MPNc during copulation modulate sexual behavior dependent on copulatory experience. Next, to investigate this hypothesis, we examined the effects of Vgf knockdown (VGF KD) in the MPNc on sexual partner preference and sexual behavior in sexually inexperienced and experienced male rats.
Materials and Methods
Animals
Adult male and female Wistar rats (8 to 13 weeks old) were used in all experiments. The animals were housed in a room maintained at 22°C with a 12-hour light/12-hour dark cycle (lights on from 0800 to 2000 hours) with free access to a standard diet and tap water. All animal procedures were approved by the Animal Care and Use Committee of Saitama University and were conducted in accordance with the Guidelines for the Care and Use of Experimental Animals of Saitama University.
Experimental design
Experiment 1: effects of copulatory experience on copulation-induced gene expression in the MPNc of male rats
A male sexual behavior test was conducted to obtain male rats that ejaculated for their first (E1 males) and second times (E2 males). The behavior tests were conducted a maximum of three times until males ejaculated once or twice (for details, see “Male sexual behavior test”). Male rats were euthanized 90 minutes after ejaculating once or twice to sample their brains for DNA microarray and quantitative PCR (qPCR) analyses. We also obtained brains from sexually naive males to serve as a control. Square-shaped tissue fragments containing the MPNc (630 × 630 μm in each fragment; Fig. 1) were collected from brain sections using a laser microdissection system. Total RNA was extracted from tissue fragments. The quality of total RNA was assessed by using an electrophoresis system (Agilent 2100 bioanalyzer; Agilent Technologies, Santa Clara, CA). The total RNA samples, the RNA integrity number of which was >7.7, were then used for cDNA synthesis. The cDNA samples were used for the DNA microarray analysis (for details, see “DNA microarray analysis”). To validate the results of the DNA microarray analysis, we performed a qPCR analysis using the cDNA samples from the MPNc-containing tissue fragments and specific primers for target genes (Table 1) (for details, see “qPCR analysis”). Additionally, we sampled square-shaped tissue fragments including the ventral part of the MPN (MPNv) (630 × 630 μm in each fragment; Fig. 1) to measure the mRNA levels of the target genes in the MPNv as well as in the MPNc.
The location of brain tissues used for gene expression analyses. (a) Schematic illustrations of a coronal brain section showing the location of the MPNc and the MPNv. (b) A representative photomicrograph of a Nissl-stained brain section before the tissue fragments containing either the MPNc or MPNv were dissected. (c) A representative photomicrograph of the Nissl-stained brain section after the tissue fragments containing either the MPNc or MPNv were dissected. The size of each square-shaped tissue fragment was 630 × 630 μm. Scale bars, 200 μm.
The location of brain tissues used for gene expression analyses. (a) Schematic illustrations of a coronal brain section showing the location of the MPNc and the MPNv. (b) A representative photomicrograph of a Nissl-stained brain section before the tissue fragments containing either the MPNc or MPNv were dissected. (c) A representative photomicrograph of the Nissl-stained brain section after the tissue fragments containing either the MPNc or MPNv were dissected. The size of each square-shaped tissue fragment was 630 × 630 μm. Scale bars, 200 μm.
Sequences of Primers Used for qPCR Analysis
| Gene Symbol . | Accession No. . | Description . | Forward Primer Sequence (5′→3′) . | Reverse Primer Sequence (5′→3′) . |
|---|---|---|---|---|
| Cdkn1a | NM_080782 | Cyclin-dependent kinase inhibitor 1A | CCGGTTAGGACCTAAGCG | GGAGAGCAGCAGATCACCA |
| Crh | NM_031019 | CRH | GGAGAGAGCCTATATACCCCT | ACAACTGGGTGACTTCCAT |
| Dnajb5 | NM_001108004 | DnaJ (Hsp40) homolog, subfamily B, member 5, | GCACATGAAGCACTCGC | CTCCTAAGGGTTGGCTCAC |
| Egr1 | NM_012551 | early growth response 1 | GGAGCCGAGCGAACAACCCT | TCCAGGGAGAAGCGGCCAGT |
| Fos | NM_022197 | FBJ osteosarcoma oncogene | GGAGCCCGGTCAAGAACATT | CCAGTCTGCTGCATAGAAGGA |
| Gapdh | NM_017008 | Glyceraldehyde-3-phosphate dehydrogenase | GTGGAGTCTACTGGCGT | ACAATCTTGAGGGAGTTGTC |
| Hspa1a | NM_031971 | Heat shock 70-kDa protein 1A/heat shock 70-kDa protein 1B (mapped) | GGACAAGGCGCAGATCCA | CAGGTCCTGCACGTTCTC |
| Nfil3 | NM_053727 | Nuclear factor, IL-3 regulated | AAACAAGTCCTCTGCCTGTC | TTGTTCTCCAGAACCAGGTCA |
| Nr4a3 | NM_017352 | Nuclear receptor subfamily 4, group A, member 3 | ATGTAATCAAACGGCGTGC | GGACATCTGGATAGTCATGGG |
| RT1-CE12 | NM_001008835 | RT1 class I, locus CE12 | GGATGGAACCTTCCAGAAGTG | CAGAGATGGCTCCAAGGAC |
| Sik1 | NM_021693 | Salt-inducible kinase 1 | GGAGGGATGAGTACCTTCCACA | TGCTGGTAGTCAGATGAGACG |
| Srxn1 | NM_001047858 | Sulfiredoxin 1 homolog (Saccharomyces cerevisiae) | AATAGTGAGGTCACCAGCTTC | CAGACAGTATGAGTCCTGGTTG |
| Vgf | NM_030997 | VGF nerve growth factor inducible | GGATGAGTTGCCGGACTG | GCGTGATGGAAGTGACGG |
| Gene Symbol . | Accession No. . | Description . | Forward Primer Sequence (5′→3′) . | Reverse Primer Sequence (5′→3′) . |
|---|---|---|---|---|
| Cdkn1a | NM_080782 | Cyclin-dependent kinase inhibitor 1A | CCGGTTAGGACCTAAGCG | GGAGAGCAGCAGATCACCA |
| Crh | NM_031019 | CRH | GGAGAGAGCCTATATACCCCT | ACAACTGGGTGACTTCCAT |
| Dnajb5 | NM_001108004 | DnaJ (Hsp40) homolog, subfamily B, member 5, | GCACATGAAGCACTCGC | CTCCTAAGGGTTGGCTCAC |
| Egr1 | NM_012551 | early growth response 1 | GGAGCCGAGCGAACAACCCT | TCCAGGGAGAAGCGGCCAGT |
| Fos | NM_022197 | FBJ osteosarcoma oncogene | GGAGCCCGGTCAAGAACATT | CCAGTCTGCTGCATAGAAGGA |
| Gapdh | NM_017008 | Glyceraldehyde-3-phosphate dehydrogenase | GTGGAGTCTACTGGCGT | ACAATCTTGAGGGAGTTGTC |
| Hspa1a | NM_031971 | Heat shock 70-kDa protein 1A/heat shock 70-kDa protein 1B (mapped) | GGACAAGGCGCAGATCCA | CAGGTCCTGCACGTTCTC |
| Nfil3 | NM_053727 | Nuclear factor, IL-3 regulated | AAACAAGTCCTCTGCCTGTC | TTGTTCTCCAGAACCAGGTCA |
| Nr4a3 | NM_017352 | Nuclear receptor subfamily 4, group A, member 3 | ATGTAATCAAACGGCGTGC | GGACATCTGGATAGTCATGGG |
| RT1-CE12 | NM_001008835 | RT1 class I, locus CE12 | GGATGGAACCTTCCAGAAGTG | CAGAGATGGCTCCAAGGAC |
| Sik1 | NM_021693 | Salt-inducible kinase 1 | GGAGGGATGAGTACCTTCCACA | TGCTGGTAGTCAGATGAGACG |
| Srxn1 | NM_001047858 | Sulfiredoxin 1 homolog (Saccharomyces cerevisiae) | AATAGTGAGGTCACCAGCTTC | CAGACAGTATGAGTCCTGGTTG |
| Vgf | NM_030997 | VGF nerve growth factor inducible | GGATGAGTTGCCGGACTG | GCGTGATGGAAGTGACGG |
Sequences of Primers Used for qPCR Analysis
| Gene Symbol . | Accession No. . | Description . | Forward Primer Sequence (5′→3′) . | Reverse Primer Sequence (5′→3′) . |
|---|---|---|---|---|
| Cdkn1a | NM_080782 | Cyclin-dependent kinase inhibitor 1A | CCGGTTAGGACCTAAGCG | GGAGAGCAGCAGATCACCA |
| Crh | NM_031019 | CRH | GGAGAGAGCCTATATACCCCT | ACAACTGGGTGACTTCCAT |
| Dnajb5 | NM_001108004 | DnaJ (Hsp40) homolog, subfamily B, member 5, | GCACATGAAGCACTCGC | CTCCTAAGGGTTGGCTCAC |
| Egr1 | NM_012551 | early growth response 1 | GGAGCCGAGCGAACAACCCT | TCCAGGGAGAAGCGGCCAGT |
| Fos | NM_022197 | FBJ osteosarcoma oncogene | GGAGCCCGGTCAAGAACATT | CCAGTCTGCTGCATAGAAGGA |
| Gapdh | NM_017008 | Glyceraldehyde-3-phosphate dehydrogenase | GTGGAGTCTACTGGCGT | ACAATCTTGAGGGAGTTGTC |
| Hspa1a | NM_031971 | Heat shock 70-kDa protein 1A/heat shock 70-kDa protein 1B (mapped) | GGACAAGGCGCAGATCCA | CAGGTCCTGCACGTTCTC |
| Nfil3 | NM_053727 | Nuclear factor, IL-3 regulated | AAACAAGTCCTCTGCCTGTC | TTGTTCTCCAGAACCAGGTCA |
| Nr4a3 | NM_017352 | Nuclear receptor subfamily 4, group A, member 3 | ATGTAATCAAACGGCGTGC | GGACATCTGGATAGTCATGGG |
| RT1-CE12 | NM_001008835 | RT1 class I, locus CE12 | GGATGGAACCTTCCAGAAGTG | CAGAGATGGCTCCAAGGAC |
| Sik1 | NM_021693 | Salt-inducible kinase 1 | GGAGGGATGAGTACCTTCCACA | TGCTGGTAGTCAGATGAGACG |
| Srxn1 | NM_001047858 | Sulfiredoxin 1 homolog (Saccharomyces cerevisiae) | AATAGTGAGGTCACCAGCTTC | CAGACAGTATGAGTCCTGGTTG |
| Vgf | NM_030997 | VGF nerve growth factor inducible | GGATGAGTTGCCGGACTG | GCGTGATGGAAGTGACGG |
| Gene Symbol . | Accession No. . | Description . | Forward Primer Sequence (5′→3′) . | Reverse Primer Sequence (5′→3′) . |
|---|---|---|---|---|
| Cdkn1a | NM_080782 | Cyclin-dependent kinase inhibitor 1A | CCGGTTAGGACCTAAGCG | GGAGAGCAGCAGATCACCA |
| Crh | NM_031019 | CRH | GGAGAGAGCCTATATACCCCT | ACAACTGGGTGACTTCCAT |
| Dnajb5 | NM_001108004 | DnaJ (Hsp40) homolog, subfamily B, member 5, | GCACATGAAGCACTCGC | CTCCTAAGGGTTGGCTCAC |
| Egr1 | NM_012551 | early growth response 1 | GGAGCCGAGCGAACAACCCT | TCCAGGGAGAAGCGGCCAGT |
| Fos | NM_022197 | FBJ osteosarcoma oncogene | GGAGCCCGGTCAAGAACATT | CCAGTCTGCTGCATAGAAGGA |
| Gapdh | NM_017008 | Glyceraldehyde-3-phosphate dehydrogenase | GTGGAGTCTACTGGCGT | ACAATCTTGAGGGAGTTGTC |
| Hspa1a | NM_031971 | Heat shock 70-kDa protein 1A/heat shock 70-kDa protein 1B (mapped) | GGACAAGGCGCAGATCCA | CAGGTCCTGCACGTTCTC |
| Nfil3 | NM_053727 | Nuclear factor, IL-3 regulated | AAACAAGTCCTCTGCCTGTC | TTGTTCTCCAGAACCAGGTCA |
| Nr4a3 | NM_017352 | Nuclear receptor subfamily 4, group A, member 3 | ATGTAATCAAACGGCGTGC | GGACATCTGGATAGTCATGGG |
| RT1-CE12 | NM_001008835 | RT1 class I, locus CE12 | GGATGGAACCTTCCAGAAGTG | CAGAGATGGCTCCAAGGAC |
| Sik1 | NM_021693 | Salt-inducible kinase 1 | GGAGGGATGAGTACCTTCCACA | TGCTGGTAGTCAGATGAGACG |
| Srxn1 | NM_001047858 | Sulfiredoxin 1 homolog (Saccharomyces cerevisiae) | AATAGTGAGGTCACCAGCTTC | CAGACAGTATGAGTCCTGGTTG |
| Vgf | NM_030997 | VGF nerve growth factor inducible | GGATGAGTTGCCGGACTG | GCGTGATGGAAGTGACGG |
Experiment 2: effects of VGF KD in the MPNc on sexual behavior in sexually inexperienced males
In this experiment, male rats that experienced contact with estrous female rats for a maximum of 15 minutes until they showed intromission five times were used to reduce individual differences in the potential of sexual behavior among the test animals. The males that consequently experienced mount and intromission but not ejaculation were subjected to bilateral injection of an adeno-associated virus (AAV) vector to express a short hairpin RNA targeting VGF (shVGF) and enhanced green fluorescent protein (EGFP) into the MPNc (for details, see “AAV vectors” and “Injection of AAV vectors”). Some males were injected with an AAV vector to express a short hairpin RNA targeting luciferase (shLUC) and EGFP to serve as a control. Sexual partner preference tests were conducted 2 weeks after the AAV injection. These tests were conducted four times with four different combinations of stimulus animals (for details, see “Sexual partner preference test”). Sexual behavior tests were then conducted 3 to 4 weeks after the AAV injection. A maximum of three tests for male sexual behavior were conducted until males ejaculated twice (for details, see “Male sexual behavior test”). The sexual partner preference tests were conducted again 5 weeks after the AAV injection.
After the behavior tests were completed, all animals were subjected to an intracerebroventricular injection of colchicine (for details, see “Injection of colchicine”) to visualize the neuronal cell bodies expressing VGF by immunohistochemistry. Colchicine-injected animals were histologically processed. Their brain sections were subjected to double immunohistochemistry for VGF and Calb, which is abundantly expressed in a cluster of neurons located in the central area of the MPNc (16). Therefore, Calb was used as a marker to determine the location of the MPNc and evaluate whether VGF expression in the MPNc was suppressed by AAV vectors (for details, see “Double immunohistochemistry for VGF and Calb” and “Analysis of VGF KD efficiency”).
Experiment 3: effects of VGF KD in the MPNc on sexual behavior in sexually experienced male rats
Male sexual behavior tests were conducted for a maximum of five times to obtain male rats that had ejaculated three times (for details, see “Male sexual behavior test”). The males were subjected to bilateral injection of either an AAV vector to express shVGF and EGFP or an AAV vector to express shLUC and EGFP into the MPNc (for details, see “AAV vectors” and “Injection of AAV vectors”). Two weeks after the AAV injection, the males were subjected to sexual partner preference tests (for details, see “Sexual partner preference test”). Three to 4 weeks after the AAV injection, the sexual behavior tests were conducted again for a maximum of three times until the males ejaculated for the fourth time. The sexual partner preference test was conducted yet again 5 weeks after the AAV injection. Males were then subjected to an intracerebroventricular colchicine injection and a histological analysis of VGF expression in the MPNc using the same procedure as described for experiment 2.
Male sexual behavior test
The sexual behavior of male rats was observed in a dark room under a dimmed red light during the light phase (1400 to 1900 hours) of the light/dark cycle. After acclimation to the room for 10 to 15 minutes, a female rat in estrus was placed in the home cage (depth × width × height, 440 × 280 × 205 mm) of each male rat. Male rats were then observed to record the latency of mount, intromission, and ejaculation, as well as the number of intromissions until ejaculation. The intromission ratio (number of intromissions until ejaculation/total number of mounts and intromissions until ejaculation) and the intromission interval (ejaculation latency/number of intromissions until ejaculation) were calculated. In each male sexual behavior test, males were observed for a maximum of 30 minutes until they ejaculated once. If a male did not ejaculate within 30 minutes, the test was terminated and they were subjected to another test 2 to 4 days later. The female rats used for the behavioral test were ovariectomized (OVX) and subcutaneously injected with estradiol benzoate (EB; 20 μg in 0.2 mL of sesame oil) and progesterone (P; 500 μg in 0.2 mL of sesame oil) 48 and 4 hours before use, respectively.
Sexual partner preference test
The sexual partner preference test was conducted in accordance with the procedure and an acrylic observation box as described previously (38). The box was divided into three compartments with partition panels, which prevented visual and physical interaction between the animals in the middle and side compartments, but an air fan assembled in the box blew air through holes in the panels from the side compartments to the middle compartment. A hollow transparent cylinder was attached to each hole in the panels facing the middle compartment. A test animal was held in the middle compartment for 5 minutes for acclimation. Stimulus animals were then put into the side compartments and the behavior of the test animals was recorded by a video camera for 5 minutes per day. The tests were conducted for 4 consecutive days with different combinations of stimulus animals: (i) OVX female and EB- and P-treated OVX female; (ii) castrated (Cast) male and EB- and P-treated OVX female; (iii) Cast male and OVX female; and (iv) EB- and P-treated Cast male and EB- and P-treated OVX female. OVX and Cast animals were used for the test >2 weeks after gonadectomy. EB- and P-treated animals were used 48 and 4 hours after subcutaneous injections of EB and P, respectively. To determine sexual partner preference, the time spent by test animals poking their nose into the left and right transparent cylinders was measured with an event recorder on a computer.
DNA microarray analysis
The DNA microarray analysis was performed using a GeneChip Rat Genome 230 2.0 Array (Affymetrix, LA Jolla, CA). Square-shaped tissue fragments including the MPNc (630 × 630 μm in each fragment; Fig. 1) were collected from Nissl-stained coronal brain sections (thickness, 40 μm) using a laser microdissection system (LMD 7000; Leica Microsystems, Wetzlar, Germany) as reported previously (39). Total RNA was extracted from tissue fragments and purified using an RNeasy micro kit (Qiagen, Hilden, Germany). Total RNA used for the DNA microarray analysis was prepared by combining equal amounts of total RNA from five animals in each group. cDNA was synthesized using an Ovation Pico WTA System v2 (NuGEN Technologies, San Carlos, CA) and labeled with biotin using an Encore biotin module (NuGEN). Hybridization, washing, staining, and scanning were conducted following standard Affymetrix protocols. Scanned images were analyzed by GeneChip operating software (Affymetrix). Data were compared among samples using DNA microarray viewer software (Kurabo, Osaka, Japan).
qPCR analysis
To measure the mRNA levels of specific genes in the MPNc and MPNv, we collected square-shaped tissue fragments including the MPNv as well as those including the MPNc using the previously mentioned procedure (see “DNA microarray analysis”; Fig. 1). Total RNA was extracted and purified using an RNeasy micro kit (Qiagen). First-strand cDNA was synthesized using a PrimeScript reverse transcriptase reagent kit (Takara Bio, Shiga, Japan). Standardized samples for quantification were prepared by mixing unknown cDNA samples and serially diluting them in EASY Dilution (Takara Bio). qPCR was performed using a LightCycler ST300 (Roche Diagnostics, Mannheim, Germany). Two microliters of standards or unknown samples was amplified in a 20-μL reaction mixture containing 200 nM of each gene-specific primer (Table 1) and 10 μL of 2× SYBR Premix Ex Taq (Takara Bio), according to the manufacturer’s protocol. The mRNA levels of the target genes were normalized with the amount of Gapdh mRNA.
AAV vectors
An AAV vector to express shVGF (5′-CTAGAGGGAGGAGGATGAGGTGTTTAGTGCTCCTGGTTGAACACCUCAUCCUCCUCCCTTTTTTA-3′ and 5′-CTAGTAAAAAAGGGAGGAGGATGAGGTGTTCAACCAGGAGCACTAAACACCUCAUCCUCCUCCCT-3′; the nucleotides specific to VGF are underlined) and EGFP (AAV2.CMV.EGFP.U6.shVGF, 1.9 × 1012 genomic copies per mL) was prepared by Takara Bio. An AAV vector to express shLUC (5′-GATCCCCCCGCTGGAGAGCAACTGCATCTTCCTGTCAATGCAGTTGCTCTCCAGCGGTTTTTGGAA-3′ and 5′-CTAGTTCCAAAAACCGCTGGAGAGCAACTGCATTGACAGGAAGATGCAGTTGCTCTCCAGCGGGGG-3′; the nucleotides specific to luciferase are underlined) and EGFP (AAV2.CBA.EGFP.H1.shLUC, 1.0 × 1012 genomic copies per mL) was prepared as reported previously (40).
Injection of AAV vectors
Animals were anesthetized by inhaling isoflurane gas (concentration, 1.5% in air; flow rate, 1 L/min) and placed in a stereotaxic apparatus for brain surgery (SM-15; Narishige, Tokyo, Japan) assembled with a microinjector (IMS-10; Narishige) and a NeuroSyringe (7001KH; Hamilton, Reno, NV). For bilateral injection of AAV vectors into the MPNc, the needle of the syringe was inserted into the brain so that the tip was lowered to a point 0.48 mm caudal to the bregma, ±0.4 mm lateral to the midline, and 7.4 mm below the dura. After inserting the needle, 0.5 μL of AAV vector solution was infused at a flow rate of 0.1 μL/min into each side.
Injection of colchicine
Animals were anesthetized with an intraperitoneal injection of medetomidine hydrochloride (0.3 mg/kg body weight), midazolam (4 mg/kg body weight), and butorphanol tartrate (5 mg/kg body weight) and then placed in the stereotaxic apparatus to inject colchicine into the lateral ventricle. The needle of a syringe filling with colchicine dissolved with saline was inserted into the lateral ventricle (location of the needle tip: 0.8 mm caudal to the bregma, 1.4 mm lateral to the midline, 3.6 mm below the dura). After inserting the needle, colchicine (100 μg in 35 μL of saline) was infused at a flow rate of 3.5 μL/min into the lateral ventricle.
Double immunohistochemistry for VGF and Calb
Two days after the colchicine infusion, the animals were euthanized by intraperitoneal injection of sodium pentobarbital (64.8 mg/kg body weight). They were transcardially perfused with 0.05 M ice-cold PBS (pH 7.4), followed by perfusion fixation with ice-cold 4% paraformaldehyde in 0.05 M phosphate buffer (pH 7.4). Brains were postfixed with the same fixative at 4°C overnight and immersed in 30% sucrose in phosphate buffer at 4°C for 3 to 4 days. Frozen brains were cut at a thickness of 30 μm using a cryostat. The brain sections were blocked with 5% normal goat serum (NGS) in 0.05 M PBS containing 0.1% Triton X-100 (PBST; pH 7.4) for 1 hour at room temperature, reacted with a rabbit anti-VGF antibody [1:3000; catalog no. ab74140, RRID: AB_1524551; Abcam, Cambridge, United Kingdom (41)] and a mouse anti-Calb antibody [1:5000; catalog no. C9848, RRID: AB_476894; Sigma-Aldrich, St. Louis, MO (42)] in 5% NGS-PBST at 4°C overnight, and then reacted with a goat anti-rabbit IgG conjugate with Alexa Fluor 568 [1:400; catalog no. A-11036, RRID: AB_10563566; Thermo Fisher Scientific, Waltham, MA (43)] and a goat anti-mouse IgG conjugate with Alexa Fluor 647 [1:400; catalog no. A-21236, RRID: AB_2535805; Thermo Fisher Scientific (44)] in 5% NGS-PBST for 2 hours at room temperature.
Analysis of VGF KD efficiency
Brain sections immunostained for VGF and Calb were observed under a fluorescence microscope (BZ-9000; Keyence, Osaka, Japan) to determine the location of the AAV-infected region. Additionally, photomicrographs of the brain sections were taken to analyze the efficiency of VGF KD by AAV vectors. The numbers of VGF-immunopositive cells (VGF+ cells), EGFP-expressing cells (EGFP+ cells), and VGF-immunopositive and EGFP-expressing cells (VGF+/EGFP+ cells) in AAV-injected regions of the MPNc were counted using a computer running BZ-II Analyzer software (Keyence). The percentage of VGF+/EGFP+ cells in total EGFP+ cells was then calculated in each animal. The percentage values in animals infected with AAV vector to express shVGF were compared with those in animals infected with AAV vector to express shLUC.
Statistical analysis
One-way ANOVA was performed to determine the differences in the data from qPCR analysis conducted among sexually naive, E1, and E2 males and the differences in the data from male sexual behavior tests conducted among E1 and E2 males. When significant overall effects were detected by one-way ANOVA, a Tukey post hoc test was performed. The sexual partner preference test data were analyzed using the Wilcoxon signed-rank test. A paired t test was used to assess the differences in the performance of male sexual behavior between males after their first and second ejaculations and between males before and after AAV injection. The differences in the percentage of VGF+/EGFP+ cells in total EGFP+ cells between AAV vector–infected males to express shLUC and AAV vector–infected males to express shVGF were analyzed by Welch test following an F-test.
Results
Experiment 1: effects of copulatory experience on copulation-induced gene expression in the MPNc of male rats
In the DNA microarray analysis of MPNc tissues, 42 and 25 genes, whose expression levels in the MPNc were twofold more than those of sexually naive males, were detected in E1 and E2 males, respectively [Fig. 2(a); see online repository (45) for details]. Of these genes, 20 were common to E1 and E2 males. Thirty-four and 56 genes, whose expression levels in the MPNc were 0.5-fold less than those of sexually naive males, were detected in E1 and E2 males respectively, and 13 were common to both males [Fig. 2(b); see online repository (46) for details].
The number of genes whose expression in the MPNc of male rats was changed by copulation and affected by the number of ejaculations. (a) The number of genes whose expression levels in the MPNc of E1 and E2 male rats were twice as high compared with the gene expression levels in sexually naive males. (b) The number of genes whose expression levels in the MPNc of E1 and E2 males were less than half of those in sexually naive males. See online repository (45, 46) for the details of these genes.
The number of genes whose expression in the MPNc of male rats was changed by copulation and affected by the number of ejaculations. (a) The number of genes whose expression levels in the MPNc of E1 and E2 male rats were twice as high compared with the gene expression levels in sexually naive males. (b) The number of genes whose expression levels in the MPNc of E1 and E2 males were less than half of those in sexually naive males. See online repository (45, 46) for the details of these genes.
Next, we quantified the mRNA levels of 12 genes (Cdkn1a, Crh, Dnajb5, Egr1, Fos, Hspa1a, Nfil3, Nr4a3, RT1-CE12, Sik1, Srxn1, and Vgf) that showed higher signals in the DNA microarray analysis. Of the 12 genes, there were 5 genes (Crh, Dnajb5, Nfil3, Sik1, and Vgf) whose expression levels in E1 males, but not in E2 males, were twofold more than those in sexually naive males, 6 genes (Cdkn1a, Egr1, Fos, Hspa1a, Nr4a3, and Srxn1) whose expression levels in both E1 and E2 males were twofold more than those in sexually naive males, and only 1 gene (RT1-CE12) whose expression level in E1 males, but not in E2 males, was 0.5-fold less than that in sexually naive males [see Refs. (45, 46) for details]. One-way ANOVA revealed that the mRNA levels of these genes in the MPNc, except RT1-CE12 [Fig. 3(i)], were significantly different among sexually naive, E1, and E2 males (Cdkn1a, F(2,12) = 29.65, P = 0.000023; Crh, F(2,12) = 7.21, P = 0.0089; Dnajb5, F(2,12) = 7.10, P = 0.0092; Egr1, F(2,12) = 40.49, P = 0.0000046; Fos, F(2,12) = 26.52, P = 0.000039; Hspa1a, F(2,12) = 9.61, P = 0.0032; Nfil3, F(2,12) = 22.41, P = 0.000089; Nr4a3, F(2,12) = 80.50, P = 0.00000011; Sik1, F(2,12) = 31.37, P = 0.000017; Srxn1, F(2,12) = 71.25, P = 0.00000022; and Vgf, F(2,12) = 38.76, P = 0.0000058). In the post hoc test, the mRNA levels of Cdkn1a [Fig. 3(a)], Crh [Fig. 3(b)], Dnajb5 [Fig. 3(c)], Egr1 [Fig. 3(d)], Fos [Fig. 3(e)], Hspa1a [Fig. 3(f)], Nfil3 [Fig. 3(g)], Nr4a3 [Fig. 3(h)], Sik1 [Fig. 3(j)], Srxn1 [Fig. 3(k)], and Vgf [Fig. 3(l)] were significantly (P < 0.05) higher in E1 and E2 males than in sexually naive males, although the mRNA level of Crh in E2 males was not significantly different from sexually naive and E1 males. The mRNA levels of Fos, Nfil3, Nr4a3, Sik1, Srxn1, and Vgf in the MPNc were significantly (P < 0.05) lower in E2 males compared with those in E1 males [Fig. 3(e), 3(g), 3(h), and 3(j)–3(l)].
The effects of copulation and the number of ejaculations on gene expression in the MPNc of male rats. mRNA levels of (a) Cdkn1a, (b) Crh, (c) Dnajb5, (d) Egr1, (e) Fos, (f) Hspa1a, (g) Nfil3, (h) Nr4a3, (i) RT1-CE12, (j) Sik1, (k) Srxn1, and (l) Vgf in the MPNc of sexually naive males (N) and E1 and E2 males. Data are means ± SEM; n = 5 for each group. Values with different letters differ significantly (P < 0.05).
The effects of copulation and the number of ejaculations on gene expression in the MPNc of male rats. mRNA levels of (a) Cdkn1a, (b) Crh, (c) Dnajb5, (d) Egr1, (e) Fos, (f) Hspa1a, (g) Nfil3, (h) Nr4a3, (i) RT1-CE12, (j) Sik1, (k) Srxn1, and (l) Vgf in the MPNc of sexually naive males (N) and E1 and E2 males. Data are means ± SEM; n = 5 for each group. Values with different letters differ significantly (P < 0.05).
In the MPNv, the mRNA levels of Cdkn1a (F(2,12) = 10.85, P = 0.0020), Dnajb5 (F(2,12) = 6.53, P = 0.012), Egr1 (F(2,12) = 6.94, P = 0.0099), Fos (F(2,12) = 6.54, P = 0.012), Hspa1a (F(2,12) = 8.31, P = 0.0054), Nfil3 (F(2,12) = 11.93, P = 0.0014), Nr4a3 (F(2,12) = 8.02, P = 0.0061), Srxn1 (F(2,12) = 8.53, P = 0.0050), and Vgf (F(2,12) = 7.51, P = 0.0077) were significantly different among sexually naive, E1, and E2 males. The MPNv in E1 and E2 males showed significantly higher (P < 0.05) mRNA levels of Cdkn1a [Fig. 4(a)], Dnajb5 [Fig. 4(c)], Hspa1a [Fig. 4(f)], Nfil3 [Fig. 4(g)], and Srxn1 [Fig. 4(k)] than did the MPNv in sexually naive males. The mRNA levels of Egr1 [Fig. 4(d)], Fos [Fig. 4(e)], Nr4a3 [Fig. 4(h)], and Vgf [Fig. 4(l)] in the MPNv of E1 males were significantly (P < 0.05) higher than those of sexually naive males, although these mRNA levels in E2 males did not significantly differ from those of sexually naive and E1 males. There was no significant difference in the mRNA levels of Crh [Fig. 4(b)], RT1-CE12 [Fig. 4(i)], and Sik1 [Fig. 4(j)] in the MPNv among the groups.
The effects of copulation and the number of ejaculations on gene expression in the MPNv of male rats. mRNA levels of (a) Cdkn1a, (b) Crh, (c) Dnajb5, (d) Egr1, (e) Fos, (f) Hspa1a, (g) Nfil3, (h) Nr4a3, (i) RT1-CE12, (j) Sik1, (k) Srxn1, and (l) Vgf in the MPNv of sexually naive males (N) and E1 and E2 males. Data are means ± SEM; n = 5 for each group. Values with different letters differ significantly (P < 0.05).
The effects of copulation and the number of ejaculations on gene expression in the MPNv of male rats. mRNA levels of (a) Cdkn1a, (b) Crh, (c) Dnajb5, (d) Egr1, (e) Fos, (f) Hspa1a, (g) Nfil3, (h) Nr4a3, (i) RT1-CE12, (j) Sik1, (k) Srxn1, and (l) Vgf in the MPNv of sexually naive males (N) and E1 and E2 males. Data are means ± SEM; n = 5 for each group. Values with different letters differ significantly (P < 0.05).
In the E1 males, the number of sexual behavior tests until first ejaculation was observed was 2.8 ± 0.2. In the E2 males, the number of behavior tests until first and second ejaculations were observed were 1.2 ± 0.2 and 2.4 ± 0.2, respectively. There was no significant difference in the performance of male sexual behavior among E1 males and E2 males that ejaculated for their first or second times (Table 2).
Parameters of Male Sexual Behavior
| Experimental Groups . | E1 . | E2 . | |
|---|---|---|---|
| First Ejaculation . | Second Ejaculation . | ||
| Mount latency, s | 8.8 ± 3.8 | 62.8 ± 20.1 | 104.0 ± 59.0 |
| Intromission latency, s | 34.4 ± 26.2 | 107.4 ± 31.2 | 164.4 ± 64.8 |
| Ejaculation latency, s | 1094.8 ± 129.2 | 757.8 ± 127.3 | 990.8 ± 205.8 |
| Intromission number until ejaculation was observed | 21.4 ± 2.3 | 16.4 ± 2.1 | 18.4 ± 4.5 |
| Intromission ratio | 0.48 ± 0.026 | 0.55 ± 0.073 | 0.56 ± 0.102 |
| Interintromission interval, s | 51.6 ± 5.3 | 47.4 ± 7.7 | 64.3 ± 15.2 |
| Experimental Groups . | E1 . | E2 . | |
|---|---|---|---|
| First Ejaculation . | Second Ejaculation . | ||
| Mount latency, s | 8.8 ± 3.8 | 62.8 ± 20.1 | 104.0 ± 59.0 |
| Intromission latency, s | 34.4 ± 26.2 | 107.4 ± 31.2 | 164.4 ± 64.8 |
| Ejaculation latency, s | 1094.8 ± 129.2 | 757.8 ± 127.3 | 990.8 ± 205.8 |
| Intromission number until ejaculation was observed | 21.4 ± 2.3 | 16.4 ± 2.1 | 18.4 ± 4.5 |
| Intromission ratio | 0.48 ± 0.026 | 0.55 ± 0.073 | 0.56 ± 0.102 |
| Interintromission interval, s | 51.6 ± 5.3 | 47.4 ± 7.7 | 64.3 ± 15.2 |
Values are means ± SEM of data from male sexual behavior tests when E1 males ejaculated for their first time and when E2 males ejaculated for their first and second times.
Parameters of Male Sexual Behavior
| Experimental Groups . | E1 . | E2 . | |
|---|---|---|---|
| First Ejaculation . | Second Ejaculation . | ||
| Mount latency, s | 8.8 ± 3.8 | 62.8 ± 20.1 | 104.0 ± 59.0 |
| Intromission latency, s | 34.4 ± 26.2 | 107.4 ± 31.2 | 164.4 ± 64.8 |
| Ejaculation latency, s | 1094.8 ± 129.2 | 757.8 ± 127.3 | 990.8 ± 205.8 |
| Intromission number until ejaculation was observed | 21.4 ± 2.3 | 16.4 ± 2.1 | 18.4 ± 4.5 |
| Intromission ratio | 0.48 ± 0.026 | 0.55 ± 0.073 | 0.56 ± 0.102 |
| Interintromission interval, s | 51.6 ± 5.3 | 47.4 ± 7.7 | 64.3 ± 15.2 |
| Experimental Groups . | E1 . | E2 . | |
|---|---|---|---|
| First Ejaculation . | Second Ejaculation . | ||
| Mount latency, s | 8.8 ± 3.8 | 62.8 ± 20.1 | 104.0 ± 59.0 |
| Intromission latency, s | 34.4 ± 26.2 | 107.4 ± 31.2 | 164.4 ± 64.8 |
| Ejaculation latency, s | 1094.8 ± 129.2 | 757.8 ± 127.3 | 990.8 ± 205.8 |
| Intromission number until ejaculation was observed | 21.4 ± 2.3 | 16.4 ± 2.1 | 18.4 ± 4.5 |
| Intromission ratio | 0.48 ± 0.026 | 0.55 ± 0.073 | 0.56 ± 0.102 |
| Interintromission interval, s | 51.6 ± 5.3 | 47.4 ± 7.7 | 64.3 ± 15.2 |
Values are means ± SEM of data from male sexual behavior tests when E1 males ejaculated for their first time and when E2 males ejaculated for their first and second times.
Experiments 2 and 3: effects of AAV vector injection on VGF expression in the brain
The expression of VGF in the MPNc was suppressed in VGF KD males that were injected with AAV vector to express shVGF and EGFP, whereas VGF remained in the control males injected with AAV vector to express shLUC and EGFP. AAV-infected regions that were visualized by EGFP were observed in the MPNc, which contained a cluster of Calb-immunopositive cells in the center of the MPNc (Fig. 5a and 5e), in the control and VGF KD groups (Fig. 5b and 5f). In the control males, the MPNc contained many VGF+ cells (Fig. 5c), and some AAV-infected cells (EGFP+ cells) showed VGF immunoreactivity (Fig. 5d). In VGF KD males, VGF immunoreactivity became weak, and the number of VGF+ cells decreased compared with the control males (Fig. 5g). EGFP+ cells in the MPNc of VGF KD males did not show VGF immunoreactivity (Fig. 5h).
Effects of AAV vector injection on the protein expression of VGF in the brain. (a–d) Representative photomicrographs of the MPNc infected with AAV vector to express EGFP and shLUC (AAV-EGFP-shLUC). (e–h) Representative photomicrographs of the MPNc infected with AAV vector to express EGFP and shVGF (AAV-EGFP-shVGF). Photomicrographs show (a and e) the MPNc immunostained for Calb, (b and f) the MPNc containing cells infected with AAV vectors and expressing EGFP, (c and g) the MPNc immunostained for VGF, and (d and h) the merged images of (a)–(c) and (e)–(g). Scale bars, 200 μm.
Effects of AAV vector injection on the protein expression of VGF in the brain. (a–d) Representative photomicrographs of the MPNc infected with AAV vector to express EGFP and shLUC (AAV-EGFP-shLUC). (e–h) Representative photomicrographs of the MPNc infected with AAV vector to express EGFP and shVGF (AAV-EGFP-shVGF). Photomicrographs show (a and e) the MPNc immunostained for Calb, (b and f) the MPNc containing cells infected with AAV vectors and expressing EGFP, (c and g) the MPNc immunostained for VGF, and (d and h) the merged images of (a)–(c) and (e)–(g). Scale bars, 200 μm.
Approximately half of the total EGFP+ cells (49.5%) showed VGF immunoreactivity in the MPNc injected with AAV vector to express shLUC. Alternatively, only 3.7% of total EGFP+ cells were VGF+ cells in the MPNc injected with AAV vector to express shVGF. The percentage of VGF+/EGFP+ cells in total EGFP+ cells in the VGF KD males was significantly lower (t(11) = 21.26, P = 0.00000000014) than that of the control males (Fig. 6).
Effect of VGF KD by AAV vectors on the expression of VGF protein in the MPNc. The values are expressed as the percentage of VGF+/EGFP+ cells in the total EGFP+ cells in the control group injected with AAV vector to express EGFP and shLUC, and the VGF KD group injected with AAV vector to express EGFP and shVGF. Data are means ± SEM; n = 10 for the control group; n = 11 for the VGF KD group. **P < 0.01.
Effect of VGF KD by AAV vectors on the expression of VGF protein in the MPNc. The values are expressed as the percentage of VGF+/EGFP+ cells in the total EGFP+ cells in the control group injected with AAV vector to express EGFP and shLUC, and the VGF KD group injected with AAV vector to express EGFP and shVGF. Data are means ± SEM; n = 10 for the control group; n = 11 for the VGF KD group. **P < 0.01.
Experiment 2: effects of VGF KD in the MPNc on sexual behavior in sexually inexperienced male rats
Sexual partner preference tests
In males injected with AAV vector to express shLUC (control males), the preference for estrous females as a sexual partner was not strong before they acquired copulatory experience. They equally smelled the odors from OVX females and EB- and P-treated OVX females and odors from Cast males and EB- and P-treated OVX females [Fig. 7(a)]. The control males’ preference for estrous females was reinforced after they had copulated and ejaculated twice. They smelled the EB- and P-treated OVX females significantly more often than they smelled the OVX females (P = 0.043) and Cast males (P = 0.043) [Fig. 7(b)]. The control males equally smelled odors of the Cast males and the OVX females before and after their copulatory experience and odors of the EB- and P-treated Cast males and the EB- and P-treated OVX females before and after their copulatory experience [Fig. 7(a) and 7(b)].
Effects of VGF KD by AAV vector and copulatory experience on sexual partner preference in male rats. (a–d) Percentage of time invested in smelling odors from stimulators during the sexual partner preference test (a and c) before and (b and d) after copulatory experience in (a and b) control males and (c and d) VGF KD males. Data are means ± SEM; n = 5 for control group; n = 6 for VGF KD group. *P < 0.05 vs counterparts.
Effects of VGF KD by AAV vector and copulatory experience on sexual partner preference in male rats. (a–d) Percentage of time invested in smelling odors from stimulators during the sexual partner preference test (a and c) before and (b and d) after copulatory experience in (a and b) control males and (c and d) VGF KD males. Data are means ± SEM; n = 5 for control group; n = 6 for VGF KD group. *P < 0.05 vs counterparts.
Alternatively, this preference for estrous females was not reinforced in males injected with AAV vector to express shVGF (VGF KD males) after they copulated with estrous females and ejaculated twice. Before their copulatory experience, VGF KD males equally smelled odors of the OVX females and the EB- and P-treated OVX females, although they significantly invested more time in smelling the EB- and P-treated OVX females instead of the Cast males (P = 0.043) [Fig. 7(c)]. Unlike the control males, the VGF KD males equally smelled odors of the OVX females and the EB- and P-treated OVX females and odors of the Cast males and the EB- and P-treated OVX females after their copulatory experience [Fig. 7(d)]. Similar to the control males, the VGF KD males equally smelled odors of the Cast males and the OVX females before and after their copulatory experience and odors of the EB- and P-treated Cast males and the EB- and P-treated OVX females before and after their copulatory experience [Fig. 7(c) and 7(d)].
Male sexual behavior tests
The latency of mount and intromission in the control males significantly shortened with copulatory experience (mount latency, t(4) = 4.84, P = 0.0084; intromission latency, t(4) = 5.94, P = 0.0040) [Fig. 8(a) and 8(b)]. However, the latency of mount and intromission in VGF KD males did not shorten significantly with copulatory experience [Fig. 8(a) and 8(b)]. Other endpoints of male sexual behavior, that is, the latency of ejaculation [Fig. 8(c)], intromission ratio [Fig. 8(d)], interintromission interval [Fig. 8(e)], and number of intromissions until ejaculation was observed [Fig. 8(f)], were not significantly affected by copulatory experience or VGF KD.
Effects of VGF KD by AAV vector and copulatory experience on sexual behavior in male rats. (a) Mount latency, (b) intromission latency, (c) ejaculation latency, (d) intromission ratio, (e) interintromission interval, and (f) intromission number until ejaculation was observed in control and VGF KD males when they ejaculated for their first (open bars) and second times (filled bars). Data are means ± SEM; n = 5 for control group; n = 6 for VGF KD group. **P < 0.01.
Effects of VGF KD by AAV vector and copulatory experience on sexual behavior in male rats. (a) Mount latency, (b) intromission latency, (c) ejaculation latency, (d) intromission ratio, (e) interintromission interval, and (f) intromission number until ejaculation was observed in control and VGF KD males when they ejaculated for their first (open bars) and second times (filled bars). Data are means ± SEM; n = 5 for control group; n = 6 for VGF KD group. **P < 0.01.
Experiment 3: effects of VGF KD in the MPNc on sexual behavior in sexually experienced male rats
Sexual partner preference tests
In males injected with AAV vectors after they ejaculated three times, their preference for estrous females and sexual behavior remained unchanged by VGF KD.
Control males significantly invested more time in smelling EB- and P-treated OVX females instead of OVX females (P = 0.046) and Cast males (P = 0.028) after they ejaculated three times [Fig. 9(a)]. After the control males ejaculated four times, they also significantly invested more time in smelling the EB- and P-treated OVX females instead of the OVX females (P = 0.046) and Cast males (P = 0.028) [Fig. 9(b)]. Similar to the control males, VGF KD males significantly (P = 0.046) invested more time in smelling the EB- and P-treated OVX females instead of the OVX females after they ejaculated three times [Fig. 9(c)]. They more frequently smelled the EB- and P-treated OVX females than they smelled the Cast males, although this was not significant. After the VGF KD males ejaculated four times, they smelled the EB- and P-treated OVX females significantly more often compared with the OVX females (P = 0.046) and Cast males (P = 0.046) [Fig. 9(d)].
Sexual partner preference is not affected by VGF KD after copulatory experience. (a–d) Percentage of time invested in smelling odors from stimulators in the sexual partner preference test after the (a and c) third and (b and d) fourth ejaculations in (a and b) control males and (c and d) VGF KD males. Data are means ± SEM; n = 6 for control group; n = 6 for VGF KD group. *P < 0.05 vs counterparts.
Sexual partner preference is not affected by VGF KD after copulatory experience. (a–d) Percentage of time invested in smelling odors from stimulators in the sexual partner preference test after the (a and c) third and (b and d) fourth ejaculations in (a and b) control males and (c and d) VGF KD males. Data are means ± SEM; n = 6 for control group; n = 6 for VGF KD group. *P < 0.05 vs counterparts.
The control males and VGF KD males equally smelled the odors of the Cast males and OVX females after they ejaculated three and four times and odors of the EB- and P-treated Cast males and the EB- and P-treated OVX females after they ejaculated three and four times [Fig. 9(a)–9(d)].
Male sexual behavior tests
The latency of mount and intromission as well as other endpoints of male sexual behavior tests before AAV injection were not significantly different from those after AAV injection in both the control and VGF KD males that had experienced ejaculation three times before AAV injection (Fig. 10).
Sexual behavior performance is not affected by VGF KD after copulatory experience. (a) Mount latency, (b) intromission latency, (c) ejaculation latency, (d) intromission ratio, (e) interintromission interval, and (f) intromission number until ejaculation was observed in control and VGF KD males when they ejaculated for their third (open bars) and fourth times (filled bars). Data are means ± SEM; n = 6 for control group; n = 6 for VGF KD group.
Sexual behavior performance is not affected by VGF KD after copulatory experience. (a) Mount latency, (b) intromission latency, (c) ejaculation latency, (d) intromission ratio, (e) interintromission interval, and (f) intromission number until ejaculation was observed in control and VGF KD males when they ejaculated for their third (open bars) and fourth times (filled bars). Data are means ± SEM; n = 6 for control group; n = 6 for VGF KD group.
Discussion
The current study showed that the gene expression patterns of the MPNc in male rats after their first copulation were different from those in males after their second copulation. This finding indicates that copulation-induced gene expression in the MPNc is affected by copulatory experience. Of the genes whose expression increased with copulation in the MPNc and were affected by copulatory experience, Vgf prompted us to further assess the role of this gene in the MPNc of male rats because Vgf codes a precursor that yields several polypeptides serving as neuropeptides and hormones (47, 48). Additionally, VGF-derived neuropeptides have been demonstrated to act in the brain to induce penile erection (33). VGF knockout male mice have been shown to be infertile, which is mainly due to abnormal sexual behavior (34). VGF knockout female mice also show infertility resulting from dysfunction of the neuroendocrine control of the ovaries by the hypothalamus and pituitary (34). In this study, VGF KD of the MPNc disturbed the enhancement of sexual preference for estrous females and the reduction in the latency of the mount and intromission after the first copulatory experience in sexually inexperienced male rats that had not experienced ejaculation, although VGF KD of the MPNc in sexually experienced males that had experienced ejaculation three times and exhibited increased sexual preference for estrous females and higher performance of sexual behavior did not further improve the preference for estrous females and performance of sexual behavior. It is largely unclear why VGF KD was effective in sexually inexperienced male rats, but not in sexually experienced males. Considering that a concomitant increase in the synthesis of a neuropeptide occurs with release of the neuropeptide to compensate for depletion of stored materials (35–37), a reasonable explanation may be that the MPNc releases a larger amount of VGF during the first copulation than during the later copulation. Thus, VGF neurons in the MPNc may not be stimulated much in males with copulation experience. We previously found that the number of c-Fos–expressing cells in the MPNc of male rats increases following copulation (49) and that the increased number of c-Fos–expressing cells in the MPNc by copulation is greater in sexually inexperienced males than in sexually experienced males (32). These findings may support the idea that more VGF neurons are activated during the first copulation than the later copulation. Taken together, the findings of our current study suggest that VGF synthesized in the MPNc serves as an effector molecule during the first copulation, resulting in increasing preferences for estrous females as a sexual partner and increasing motivation to copulate at the next opportunity.
Vgf has been identified as a gene whose expression is induced in pheochromocytoma (PC12) cells by nerve growth factor (50). Vgf codes a precursor polypeptide VGF, which is released from dense core vesicles into the extracellular space after cleavage into several biologically active peptides in neuronal and neuroendocrine cells, and it is associated with physiological functions, including energy metabolism, pain, reproduction, and cognition (47, 51). VGF-derived neuropeptides having specific bioactivities include TLQP-62, TLQP-21, HHPD-41, AQEE-30, AQEE-11, LQEQ-19, and neuroendocrine regulatory peptides-1 and -2 (47). Our current study showed that suppression of VGF expression in the MPNc of sexually inexperienced male rats disrupted the reinforcement of their preference for estrous female rats and increasing sexual behavior after they experienced their first copulation. These findings indicate that VGF expressed in the MPNc plays an essential role in these phenomena, although which VGF-derived neuropeptides act as an effector molecule remains to be discovered. In adult rats, Vgf mRNA is expressed widely in brain regions, including the medial hypothalamus, especially in preoptic, periventricular, supraoptic, suprachiasmatic, and arcuate nuclei (52). Similar distribution patterns of VGF protein expression in the brain were identified by immunohistochemical studies (53, 54). Many cell bodies and fiber of VGF neurons are observed in the medial hypothalamus and some VGF neuronal fibers terminated at the median eminence and neurohypophysis (54). This indicates that VGF-derived neuropeptides act not only as a neurotransmitter but also a hormone. The projection site of VGF neurons in the MPNc requires further investigation.
The DNA microarray analysis of the MPNc showed that the expression of >100 genes in the MPNc increased or decreased following copulation and that the gene expression patterns of the MPNc after the first copulation were different from those after the second copulation. Based on the results of the DNA microarray analysis, we performed qPCR analysis of 11 genes (Cdkn1a, Crh, Dnajb5, Egr1, Fos, Hspa1a, Nfil3, Nr4a3, RT1-CE12, Sik1, and Srxn1) in addition to Vgf to validate the result of the DNA microarray analysis. Additionally, we assessed the effects of copulation and the number of times of copulation on the mRNA levels of these genes in the MPNv as well as the MPNc. As a result, in 5 of the 11 genes (Fos, Nfil3, Nr4a3, Sik1, and Srxn1), the mRNA and Vgf mRNA levels in the MPNc were increased by copulation. The mRNA levels were higher in male rats that copulated for the first time than those that copulated for the second time. Alternatively, the mRNA levels of the five genes and Vgf in the MPNv increased after copulation, but the increased mRNA levels did not significantly differ between male rats that copulated for their first and second times. These findings suggest that copulatory experience–dependent changes in copulation-induced gene expression are confined to the MPNc. Fos is an immediate early gene encoding transcription factor c-Fos, which is widely used as a marker of neuronal activity (55). As mentioned earlier, our previous studies demonstrated that c-Fos expression in the MPNc of male rats increased after copulation (49) and the expression level is higher in males that copulated for the first time than those that copulated for the second time (32). Our previous and current studies support the notion that the MPNc contains a neuronal cell group that transiently activates during the first copulation and silences after the first copulation. Similar to Vgf and Fos, the mRNA expression of Nfil3 [the protein encoded by this gene acts as a transcriptional factor (56)], Nr4a3 [the protein encoded by this gene acts as a transcriptional factor (57)], Sik1 [this gene encodes a serine/threonine kinase (58)], and Srxn1 [this gene encodes an antioxidant protein (59)] increased with copulation and were affected by copulatory experience. Regarding the molecules encoded by these genes and expressed in the MPNc, the involvement in the regulation of male sexual behavior requires further investigation.
The qPCR analysis for validating the DNA microarray analysis showed that the mRNA levels of Cdkn1a, Crh, Dnajb5, Egr1, and Hspa1a in the MPNc of male rats were significantly increased after copulation independently of copulatory experience. Crh codes a polypeptide CRH that has various biological actions, such as the regulation of a stress-related endocrine system, social behavior, and metabolism (60, 61). Intracerebroventricular injection of CRH suppresses sexual behavior in sexually experienced male rats (62). Psychological stress decreases sexual behavior in male rats, but injection of a nonselective CRH receptor antagonist partially recovers the decreased performance of male sexual behavior (63). Accordingly, it is considered that CRH acts in the brain to suppress sexual behavior in male rats. CRH neurons are concentrated in the paraventricular nucleus of the hypothalamus and secrete CRH into the hypothalamohypophyseal portal vessels to stimulate ACTH section from the anterior pituitary. Additionally, CRH neurons are widely distributed in the hypothalamus, including the MPA and the extrahypothalamic regions, and CRH functions as a neurotransmitter (64, 65). Our present study suggests that the MPNc contains CRH neurons, which may contribute to exhibition of CRH actions, although further studies are needed to clarify the roles of CRH neurons in the MPNc. Additionally, little is known about the roles of Cdkn1a, Dnajb5, Egr1, and Hspa1a in the regulation of male sexual behavior. The roles of these genes in sexual behavior in male rats remain to be uncovered.
In the result of the DNA microarray analysis of the MPNc, RT1-CE12 was found as a gene whose expression in E1 males, but not in E2 males, was 0.5-fold less than that in sexually naive males. RT1-CE12 may be of interest, because RT1-CE12 was only one gene whose expression level in the MPNc of male rats was relatively higher than other genes and was downregulated by their first copulation but not by their second copulation. However, the qPCR analysis for validating the DNA microarray analysis showed that the expression of RT1-CE12 did not significantly differ among sexually naive males, as well as E1 and E2 males. One reason why the qPCR analysis was not able to validate the DNA microarray analysis could be that variation of samples used in the qPCR analysis was large, and the differences in gene expression among the groups may be therefore masked.
In summary, the current study demonstrates that copulation-induced gene expression of the MPNc in male rats changed with copulatory experience. Vgf was determined as a gene whose expression in the MPNc was induced by copulation and affected by copulatory experience. Furthermore, the loss of function of VGF in the MPNc inhibited the promotion of sexual behavior and the rise in sexual motivation following sexual arousal induction in sexually inexperienced male rats, but this was not observed in sexually experienced males. These findings suggest that the MPNc of male rats functions during their first copulation and significantly contributes to sexual arousal induction and the subsequent increase in sexual behavior.
Abbreviations:
- AAV
adeno-associated virus
- Calb
calbindin-D28K
- Cast
castrated
- E1
male rat that ejaculated for its first time
- E2
male rat that ejaculated for its second time
- EB
estradiol benzoate
- EGFP
enhanced green fluorescent protein
- KD
knockdown
- MPA
medial preoptic area
- MPN
medial preoptic nucleus
- MPNc
central part of the medial preoptic nucleus
- MPNv
ventral part of the medial preoptic nucleus
- NGS
normal goat serum
- OVX
ovariectomized
- P
progesterone
- PBST
0.05 M PBS containing 0.1% Triton X-100
- qPCR
quantitative PCR
- SDN
sexually dimorphic nucleus
- shLUC
short hairpin RNA targeting luciferase
- shVGF
short hairpin RNA targeting VGF
Acknowledgments
Financial Support: This work was supported by Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science, and Technology of Japan (Grants 23310043, 25670114, 15K14556, and 17K08567 to S.T.).
Disclosure Summary: The authors have nothing to disclose.
References
RRID:AB_1524551.
RRID:AB_476894.
RRID:AB_10563566.
RRID:AB_2535805.










