Cardiac and peripheral adjustments induced by early exercise training intervention were associated with autonomic improvement in infarcted rats: role in functional capacity and mortality

Abstract

Aims

To test the effects of early exercise training (ET) on left ventricular (LV) and autonomic functions, haemodynamics, tissues blood flows (BFs), maximal oxygen consumption (VO₂ max), and mortality after myocardial infarction (MI) in rats.

Methods and results

Male Wistar rats were divided into: control (C), sedentary-infarcted (SI), and trained-infarcted (TI). One week after MI, TI group underwent an ET protocol (90 days, 50–70% VO₂ max). Left ventricular function was evaluated non-invasively and invasively. Baroreflex sensitivity, heart rate variability, and pulse interval were measured. Cardiac output (CO) and regional BFs were determined using coloured microspheres. Infarcted area was reduced in TI (19 ± 6%) compared with SI (34 ± 5%) after ET. Exercise training improved the LV and autonomic functions, the CO and regional BF changes induced by MI, as well as increased SERCA2 expression and mRNA vascular endothelial growth factor levels. These changes brought about by ET resulted in mortality rate reduction in the TI (13%) group compared with the SI (54%) group.

Conclusion

Early aerobic ET reduced cardiac and peripheral dysfunctions and preserved cardiovascular autonomic control after MI in trained rats. Consequently, these ET-induced changes resulted in improved functional capacity and survival after MI.

Myocardial infarction, Exercise training, Cardiac function, Autonomic function, Blood flow

Introduction

Myocardial infarction (MI) is the most common cause of heart failure (HF) and is an important precursor of left ventricular (LV) systolic and diastolic dysfunctions, leading to high mortality rates and major impairment in quality of life. Furthermore, the period after MI seems to be accompanied by neurohumoral excitation, which initially helps to stabilize patients who have ventricular dysfunction, but becomes deleterious with the persistence of the cardiac dysfunction. Thus, after some time, neurohumoral excitation leads to worsening of the clinical syndrome of cardiac failure and is directly associated with the poor prognosis of HF patients.¹ In this context, La Rovere and Bigger² showed that the reduction of baroreflex sensitivity (BRS) and heart rate variability (HRV) in patients after MI was associated with improvement in mortality rate, independently of ejection fraction (EF) levels.

Accumulating evidence in the last two decades has shown that exercise training (ET) is a remarkable non-pharmacological strategy for the treatment of chronic HF patients.³ Exercise training substantially improves exercise tolerance in animal models of HF⁴ and humans.^5,6 Additionally, there is some evidence that ET significantly reduces the degree of all-cause mortality in HF patients.⁷ In fact, the participation of patients with NYHA class II–IV HF in an ET programme provides a modest but statistically significant improvement in patient-reported health status.⁸ However, the mechanisms involved in the positive effects of ET are still under scrutiny.

Our group has previously reported⁴ that ET was able to increase aortic depressor nerve activity and to reduce renal sympathetic nerve activity; these benefits were associated with the enhancement of BRS in ischaemia-induced HF in rats. However, the effects of early ET intervention on autonomic dysfunction after MI are still not completely understood.

This study was undertaken to test the hypothesis that early ET improves LF function and blood flows (BFs) and, concomitantly, cardiac autonomic function and that this could affect functional capacity and survival. The present investigation was designed to evaluate the effects of early ET (started 1 week after MI) on: (i) LV dysfunction and molecular profile, (ii) haemodynamics and regional BFs, (iii) BRS and cardiac autonomic modulation, (iv) functional capacity (maximum oxygen consumption), and (v) total mortality.

Methods

Experiments were performed in adult male Wistar rats (230–250 g) from the Animal House of the University of São Paulo, São Paulo, Brazil. Rats were fed standard laboratory chow and water ad libitum. The animals were housed in collective polycarbonate cages in a temperature-controlled room (22°C) with a 12 h dark–light cycle (light 07:00–19:00 h). The experimental protocol was approved by the institutional animal care and use committee of the Medical School of the University of São Paulo, and this investigation was conducted in accordance with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1985). The rats were randomly assigned to three groups: control (C, n = 8), sedentary + MI [sedentary-infarcted (SI), n = 30], and MI + ET [trained-infarcted (TI), n = 16]. All-cause mortality was investigated during the last 12 weeks of the protocol (ET period) in all animals, and assessment began after the ET period started. Other evaluations in this study were performed in eight rats from each group.

Myocardial infarction

Anaesthetized rats (80 mg/kg ketamine and 12 mg/kg xylazine, i.p.) underwent surgical occlusion of the left coronary artery, which resulted in MI as described previously.^9,10

Echocardiography

Echocardiographic evaluation was performed by a double-blinded observer, under the guidelines of the American Society of Echocardiography, 2 days (initial evaluation) after MI and after the ET protocol (final evaluation). Rats were anaesthetized (80 mg/kg ketamine and 12 mg/kg xylazine, i.p.), and images were obtained with a 10–14 mHz linear transducer in a SEQUOIA 512 (ACUSON Corporation, Mountain View, CA, USA) for measurements of morphometric parameters: LV mass (corrected by body weight) and LV diastolic diameter (LVDD); systolic function: EF; and diastolic function: LV isovolumetric relaxation time and E/A ratio, as described in detail elsewhere.^9–11

Myocardial infarction area determinations

The infarction area was delimited taking into account the movement of LV walls, by the observation of longitudinal, apical, and transversal views of the LV. Regions with systolic thickness under normal, as well as portions with paradoxal movement, were considered as infarcted. The infarcted area (%) was thus determined by the ratio of these regions by the total area of LV walls,^9,10 at the initial and final periods of the protocol.

Secondly, MI was confirmed by histological evaluation. The hearts were arrested in diastole by perfusion with an NaCl (0.9%) plus 14 mM KCl solution, followed by buffered formalin (4%) for tissue fixation. Hearts were transected 5 mm below coronary ligation, and transversal slices were processed and embedded in paraplast. Sections of 5 µm were stained with Picrosirius (red staining) for fibrosis evaluation. Histo-morphometric analyses were performed blinded regarding the identity of experimental groups. Computerized image acquisition (Leica Imaging Systems, USA) and analysis were used to measure infarcted areas (Image Quant-Leica). The infarcted size was quantified by the percentage of LV perimeter containing infarcted tissue.^9,10

Maximal oxygen consumption (VO₂ max) and exercise training

Sedentary and trained rats were adapted to the treadmill (10 min per day; 0.3 km/h) for 1 week after MI. The VO₂ max was determined by analysing expired gas during a progressive exercise ramp protocol, with 3 m/min increments every 3 min and no grade until exhaustion. Gas analysis was performed using an oxygen (S-3A/I) analyzer (Ametek, Pittsburgh, PA, USA). The VO₂ was calculated using the measured flow through the metabolic chamber, the expired fraction of effluent oxygen, and the fraction of oxygen in room air, as described elsewhere.¹²

Exercise training was performed on a motorized treadmill at low–moderate intensity (∼50–70% of VO₂ max) for 1 h a day, 5 days a week for 12 weeks, with a gradual increase in speed from 0.3 to 1.2 km/h.^4,13

Cardiovascular assessments

One day after the final echocardiographic evaluation, two catheters filled with 0.06 mL of saline were implanted into the femoral artery and femoral vein of the anaesthetized rats (80 mg/kg ketamine and 12 mg/kg xylazine, i.p.). Twenty four hours later, the arterial cannula was connected to a strain-gauge transducer (Blood Pressure XDCR; Kent Scientific, Torrington, CT, USA), and arterial pressure (AP) signals were recorded over a 30 min period in conscious animals by a microcomputer equipped with an analog-to-digital converter board (WinDaq, 2 kHz, DATAQ, Springfield, OH, USA). The recorded data were analysed on a beat-to-beat basis to quantify changes in mean AP (MAP) and HR.^14,15

Sequential bolus injections (0.1 mL) of increasing doses of phenylephrine (0.25–32 µg/kg) and sodium nitroprusside (0.05–1.6 µg/kg) were given to induce increases or decreases in MAP responses (for each drug), ranging from 5 to 40 mmHg. Baroreflex sensitivity was expressed as bradycardic response (BR) and tachycardic response (TR) in beats per minute per millimetre of mercury, as described elsewhere.^14,15

Cardiac autonomic modulation

The overall variability of the pulse interval (PIV) was assessed in the time and frequency domains by spectral estimation. For this, the whole 20 min time series of PI was cubic-spline-interpolated (250 Hz) and decimated to be equally spaced in time. Following linear trend removal, power spectral density was obtained by fast Fourier transformation using Welch's method over 16.384 points with a Hanning window and 50% overlapping. Spectral power for very-low-frequency (VLF: 0.00–0.20), low-frequency (LF: 0.20–0.75 Hz), and high-frequency (HF: 0.75–4.0 Hz) bands were calculated by power spectrum density integration within each frequency bandwidth, using a customized routine (MATLAB 6.0; Mathworks, Natick, MA, USA).¹⁶ The autonomic balance (LF/HF) was calculated by the ratio of LF and HF absolute values.

Left ventricular catheterization and microspheres infusion

After cardiovascular assessments, LV pressure signals were measured in anaesthetized rats (50 mg/kg sodium pentobarbital, i.p.) with a transducer and conditioner (Blood Pressure XDCR, Kent Scientific) and digitally recorded (5 min) with a data acquisition system (WinDaq, 2 kHz, DATAQ). The following indices were obtained: HR, LV systolic pressure, LV end-diastolic pressure (LVEDP), and maximum rate of LV pressure rise and fall (+dP/dt and −dP/dt).¹¹ After LV pressure basal records, yellow (150.000) 15 µm Dye-Trak microspheres (Triton Technology, San Diego, CA, USA) were infused to BF measurements in LV, right ventricle, lungs, kidneys, gastrocnemius muscle, and cardiac output (CO) and peripheral vascular resistance (PVR) determinations. Microspheres infusion and processing were performed as described previously.¹⁷

Reverse transcription (real-time polymerase chain reaction) for vascular endothelial growth factor

Total RNA was obtained from LV (50 mg) by the guanidine isothiocyanate extraction method,^18,19 using Trizol^® Reagent following the manufacturer's protocol. RNA was dissolved in diethylpyrocarbonate-treated water and the concentration and purity of each sample was obtained from A₂₆₀/A₂₈₀ measurements.¹⁸ Total RNA (2 µg) was treated with 1 U DNase I, for 15 min, at 25°C and inactivated with 25 mM EDTA, for 10 min, at 65°C. Afterwards, the cDNA was synthesized in 20 µL of medium containing 10 mM dNTP Mix (10 mM each dATP, dGTP, dCTP, and dTTP), 0.1 M DTT and 200 U RevertAid™ H Minus M-MuLV Reverse Transcriptase (Fermentas Life Science, Glen Burnie, MD, USA), at 42°C, for 50 min. The reaction was interrupted by heating, at 70°C, for 15 min. Vascular endothelial growth factor (VEGF) A (5′ACTGTGAGCCTTGTTCAGAGCG3′; 3′CGGATCTTGGACAAACAAATGC5′) expressions were evaluated by real-time polymerase chain reaction in a Rotor Gene 3000 equipment (Corbett Research, Mortlake, Australia), using Platinum^® SYBR^® Green qPCR SuperMix UDG (Invitrogen, Carlsbad, CA, USA) that contains SYBR^® Green I as fluorescent dye (annealing temperature at 48.1°C). Gene expression was performed by 2^−ΔΔC_T,^19,20 using glyceraldehyde-3-phosphate dehydrogenase (GAPDH—5′ATGGTGAAGGTCGGTGTG3′; 3′GAACTTGCCGTGGGTAGAG5′ gene as an inner control (housekeeping gene-annealing temperature at 60°C), as indicated by geNorm software (http://medgen.ugent.be/genorm/).²¹

Enzyme-linked immunosorbent assay for vascular endothelial growth factor

Measurement of the VEGF was performed in samples of the LV protein by using enzyme-linked immunosorbent assay Duo-set available kits for VEGF (R&D Systems Inc., Minneapolis, MN, USA). The assay was performed accordingly to the manufacturer's protocol. The sensitivity of the assays was 15 pg/mL. The results were normalized by LV total protein extracted for the Bradford method.^22,23

Western blots for SERCA2

Left ventricular homogenates were analysed by western blotting in order to evaluate the expression of sarcoplasmic reticulum calcium pump (SERCA2), as described elsewhere.²⁴ Mouse monoclonal antibody to SERCA2 (1:2500) was obtained from Affinity BioReagents (Golden, CO, USA). Glyceraldehyde-3-phosphate dehydrogenase (1:2000) was obtained from Advanced Immunochemical (Long Beach, CA, USA). Targeted bands were normalized to cardiac GAPDH.

Statistical analysis

Data are reported as means ± SEM. After confirming that all continuous variables were normally distributed using the Kolmogorov–Smirnov test, statistical differences between the groups were obtained by one-way ANOVA followed by the Student–Newman–Keuls post-test. Statistical differences between initial and final evaluations were assessed using paired t-test, and those between the VO₂ max evaluations were assessed using one-way repeated-measures ANOVA. Pearson's correlation was used to study the association between different parameters. The survival curve was estimated by the Kaplan–Meier method and compared by the log-rank test. All tests were two-sided and the significance level was established at P < 0.05. Statistical calculations were performed using SPSS version 12.0.

Results

Body weight and VO₂ max evaluations

Body weight was similar among all studied groups at the beginning of the protocol (∼230 ± 15 g). At the end of the protocol, C, SI, and TI groups increased body weight in comparison with their initial values (C: 508 ± 3 g; SI: 469 ± 10 g; and TI: 478 ± 8 g); however, infarcted groups (SI and TI) had reduced body weight compared with the C group. VO₂ max values obtained at basal period, 15, 60, and 90 days after the start of the ET protocol are presented in Table 1. The infarcted groups (SI and TI) had impaired VO₂ max at basal period, 15, and 60 days compared with that in group C. Importantly, 90 days of ET were effective in increasing VO₂ max in the TI group compared with the SI group.

Table 1

Maximal oxygen consumption (mL/kg/min) at basal period, 15, 60, and 90 days after exercise training in control, sedentary-infarcted, and trained-infarcted rats

	C group	SI group	TI group
Basal	84 ± 4	54 ± 2*	56 ± 4*
15 days	82 ± 3	55 ± 1*	59 ± 3*
60 days	80 ± 3	53 ± 1*	64 ± 3*
90 days	77 ± 3	49 ± 1*	72 ± 3†

Values are expressed as mean ± SEM.

*P < 0.05 vs. C.

^†P < 0.05 vs. SI (n = 8 for each group).

Left ventricular function: non-invasive and invasive evaluations

The akinetic LV area (MI area) was similar at the initial and final evaluations in the SI group (35 ± 3 vs. 34 ± 3%). In contrast, the TI group had a reduction in akinetic LV area after the ET protocol (final evaluation) (19 ± 6%) compared with its initial evaluation (34 ± 5%) and with the SI group, as can be seen in Figure 1. In addition, we observed a strong correlation between the infarcted area evaluated by echocardiography and Picrosirius red staining at the final of the protocol (r = 0.90, P < 0.0001).

Figure 1

Direct and indirect myocardial infarction area measurements. (A) Myocardial infarction area (akinetic area) evaluated by echocardiography in sedentary-infarcted (SI) and trained-infarcted (TI) animals at the beginning and at the final of the protocol. Representative photomicrographies of infarcted area in sedentary (B) and trained (C) groups at the end of the protocol. ^‡P < 0.05 vs. initial evaluation; ^†P < 0.05 vs. SI. Magnification: ×5 (n = 8 for each group).

The echocardiographic parameters are shown in Table 2. Initial evaluation, performed 2 days after MI, showed that LVDD was increased in the MI groups (SI and TI) compared with those in the C group. Furthermore, the E/A ratio was higher at the initial evaluation in the SI and TI groups than in the C group, correspondent to a ‘pseudonormalization’ pattern. Moreover, the SI and TI groups displayed a reduction in EF compared with that in the C group. Isovolumetric relaxation time was similar between studied groups at the initial and final measurements.

Table 2

Initial and final echocardiographic measurements in control, sedentary-infarcted, and trained-infarcted groups

Parameter	C group	SI group	TI group
Morphometric
LV mass (g/kg)
Initial	1.02 ± 0.02	1.06 ± 0.04	1.11 ± 0.04
Final	1.10 ± 0.03	1.22 ± 0.03*	1.25 ± 0.03*
LVDD (cm)
Initial	0.65 ± 0.01	0.75 ± 0.01*	0.79 ± 0.03*
Final	0.71 ± 0.02	0.86 ± 0.03*	0.85 ± 0.03*
Systolic function
EF (%)
Initial	74 ± 2	43 ± 3*	41 ± 2*
Final	71 ± 1	40 ± 1*	59 ± 4*,†,‡
Diastolic function
IVRT (ms)
Initial	33 ± 2	27 ± 2	29 ± 2
Final	30 ± 1	30 ± 2	30 ± 2
E/A ratio
Initial	1.6 ± 0.11	2.5 ± 0.20*	2.6 ± 0.20*
Final	1.6 ± 0.20	2.7 ± 0.42*	1.5 ± 0.03†,‡

Values are expressed as mean ± SEM. LV mass, left ventricular mass corrected by body weight; LVDD, left ventricular diameter during diastole; EF, ejection fraction; IVRT, left ventricular isovolumetric relaxation time; E/A ratio, E-wave and A-wave ratio.

^‡P < 0.05 vs. initial evaluation.

*P < 0.05 vs. C.

^†P < 0.05 vs. SI (n = 8 for each group).

The final echocardiographic evaluations (after ET period) showed that LV mass and LVDD were increased in the SI and TI groups compared with those in the C group. Exercise training benefits were observed by improvement in EF and normalization of the E/A ratio in the TI group in comparison not only with the SI group, but also with the initial evaluation.

Left ventricular catheterization demonstrated a reduction in +dP/dt (4642 ± 457 mmHg/s) and −dP/dt (−3208 ± 481 mmHg/s) and increased LVEDP (16 ± 2 mmHg) in the SI group compared with the C group (9445 ± 420 and −7186 ± 169 mmHg/s and 5 ± 0.3 mmHg, respectively). Exercise training improved systolic and diastolic functions, indicated by the increased +dP/dt and −dP/dt (9439 ± 458 and −8089 ± 437 mmHg/s) and reduced LVEDP (4.6 ± 0.6 mmHg) in the TI group compared with the SI group. In addition, the TI group had similar values as those of the C group.

Haemodynamic and autonomic function evaluations

Haemodynamic measurements were performed at the end of the ET protocol. Systolic AP, diastolic AP, and MAP were reduced in the SI group compared with the C group. However, the TI group had a normalization of these haemodynamic parameters, as well as the classic resting bradycardia after the ET protocol (Table 3). The CO reduction and the PVR increase observed in SI rats in comparison with C where reversed by ET in TI rats (Table 3).

Table 3

Haemodynamic and autonomic parameters evaluated at of the end of the protocol in control, sedentary-infarcted, and trained-infarcted groups

Parameter	C group	SI group	TI group
Haemodynamic
SAP (mmHg)	125 ± 2	114 ± 3*	120 ± 1†
DAP (mmHg)	91 ± 2	86 ± 3*	89 ± 1†
MAP (mmHg)	108 ± 2	98 ± 3*	103 ± 1†
HR (b.p.m.)	352 ± 12	349 ± 6	321 ± 5*,†
CO (mL/min)	111 ± 8	72 ± 7*	100 ± 10†
PVR (mmHg/mL/min)	0.9 ± 0.1	1.5 ± 0.2*	0.9 ± 0.1†
Baroreflex sensibility
BR (b.p.m./mmHg)	−2.08 ± 0.1	−1.45 ± 0.08*	−2.1 ± 0.1†
TR (b.p.m./mmHg)	3.2 ± 0.1	2.0 ± 0.4*	3.2 ± 0.2†
Pulse interval variability
PI Variance (ms2)	100 ± 13	58 ± 10*	128 ± 21†
VLF band (ms2)	30.1 ± 5.9	5.7 ± 0.7*	3.3 ± 1.0*
LF band (ms2)	3.6 ± 0.5	1.5 ± 0.2*	4.5 ± 1.2†
LF band (%)	3.4 ± 0.4	1.8 ± 0.4	4.7 ± 1.7
HF band (ms2)	14.1 ± 0.8	6.2 ± 1.0*	8.9 ± 1.4*,†
HF band (%)	14 ± 0.35	9 ± 0.24*	11 ± 0.9*,†
LF/HF	0.26 ± 0.02	0.26 ± 0.06	0.36 ± 0.04

Values are expressed as mean ± SEM. SAP, systolic arterial pressure; DAP, diastolic arterial pressure; MAP, mean arterial pressure; HR, heart rate; CO, cardiac output; PVR, peripheral vascular resistance; BR, bradycardic response; TR, tachycardic response; PI variance, pulse interval variance; VLF, very-low-frequency band; LF band, low-frequency band; HF band, high-frequency band; LF/HF, low-frequency and high-frequency bands ratio.

*P < 0.05 vs. C.

^†P < 0.05 vs. SI (n = 8 for each group).

The results of autonomic function evaluation are summarized in Table 3. Baroreflex sensitivity evaluated by BR and TR evoked by AP rises and falls was impaired in the SI group but improved after ET, as observed in the TI group. Pulse interval variance and absolute LF and HF bands were reduced in the SI group when compared with the C group. In addition, both infarcted groups (SI and TI) displayed reduction of VLF band in comparison with the C group. Exercise training increased the PI variance, the absolute LF and HF bands, as well as the normalized HF band of PIV in TI animals in comparison with sedentary ones. However, these alterations were not reflected in the LF/HF ratio, an autonomic balance index.

Regional blood flow evaluation

Results of regional BF measurements are shown in Table 4. Myocardial infarction in sedentary rats induced a tissue perfusion reduction, as demonstrated by diminished BF to LV, RV, lungs, left and right kidneys, and gastrocnemius muscles in SI rats when compared with the C group. In contrast, ET improved all regional BFs in TI in comparison with SI rats, except for coronary BF.

Table 4

Regional blood flows in control, sedentary-infarcted, and trained-infarcted rats

Blood flow	C group	SI group	TI group
Left ventricle (mL/min/g)	3.3 ± 0.5	1.4 ± 0.1*	1.4 ± 0.3*
Right ventricle (mL/min/g)	2.1 ± 0.3	1.1 ± 0.5*	0.9 ± 0.4*
Lungs (mL/min/g)	1.3 ± 0.1	0.7 ± 0.2*	1.2 ± 0.3
Right kidney (mL/min/g)	3.7 ± 1	1.9 ± 0.4*	2.3 ± 0.7
Left kidney (mL/min/g)	3.6 ± 1	1.8 ± 0.5*	2.1 ± 0.4
Gastrocnemius (mL/min/g)	0.3 ± 0.01	0.1 ± 0.04*	0.3 ± 0.01†

Values are expressed as mean ± SEM.

*P < 0.05 vs. C.

^†P < 0.05 vs. SI (n = 8 for each group).

Vascular endothelial growth factor gene and protein expression

As Figure 2 illustrates, ET increased VEGF mRNA expression in TI animals when compared with C and SI (Figure 2A), although no differences have been observed in VEGF protein expression between experimental animals (Figure 2B).

Figure 2

(A) Vascular endothelial growth factor (VEGF) mRNA gene and (B) VEGF protein expression in control (C), sedentary-infarcted (SI), and trained-infarcted (TI) groups. *P < 0.001 vs. C; ^†P < 0.001 vs. SI (n = 8 for each group).

SERCA2 protein expression

GAPDH protein levels remained unchanged among all studied groups and were used to normalize SERCA2 protein expression (Figure 3A). Myocardial infarction reduced while ET normalized the expression of the SERCA2 as observed in SI and TI rats, respectively (Figure 3A and B).

Figure 3

(A) Representative blots of SERCA2 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) from control (C), sedentary myocardial infarction (SI) and myocardial infarction associated with exercise training group (TI). (B) SERCA2 expression in studied groups. Targeted bands were normalized to cardiac GAPDH. *P < 0.001 vs. C; ^†P < 0.001 vs. SI (n = 8 for each group).

Mortality rate

Figure 4 shows the total mortality rate (Kaplan–Meier's survival curve) in studied groups throughout the experimental period (90 days). During the ET period, total mortality rate was higher in the SI group (16 deaths among 30 SI rats, 54%) compared with the C group (no deaths). Surprisingly, ET strongly reduced total mortality in the TI group (2 deaths among 16 TI rats, 13%) (P < 0.001) compared with the SI group.

Figure 4

The Kaplan–Meier survival curve from control (C), sedentary-infarcted (SI), and trained-infarcted (TI) groups. *P < 0.001 vs. C; ^†P < 0.001 vs. SI (n = 8 for each group).

Discussion

Since the classical studies by Sullivan et al.²⁵ in the late 1980s, evidence has accumulated supporting the beneficial effects of ET in HF and as a key intervention for preventive cardiology.^26,27 However, the mechanisms by which ET can delay the onset of cardiovascular derangement after MI are not completely understood. In the present investigation, we demonstrated that early ET intervention (1 week) after MI induced: (i) an improvement of systolic and diastolic functions followed by an increase in LV SERCA2 expression; (ii) the normalization of haemodynamic and regional BFs, as well as an increase in mRNA VEGF expression; and (iii) an improvement of cardiovascular autonomic function. These benefits resulted in an increase in functional capacity and a reduction of mortality rate in TI animals.

Besides classical adaptations to ET, such as the improvement in VO₂ max and resting bradycardia, in the present study, we observed a significant reduction of MI size, evaluated by echocardiography. This finding was reinforced by morphometric measurements since a strong correlation was observed between infarcted area evaluated by echocardiography and Picrosirius staining histological method (r = 0.9, P < 0.0001). Moreover, the quantification of the akinetic area of LV by echocardiography has been compared with histological evaluations also in previous reports.^28,29

Since the study of McElroy et al.,³⁰ ET has been considered an effective form of reducing MI area and protecting rat hearts submitted to ischaemic injury.^31,32 The improvement in myocardial vascularization,³³ better maintenance of coronary flow, increase in VEGF mRNA and protein levels,³⁴ and protein kinase C activation during exercise³² have been pointed out as possible mechanisms for the reduction in MI area. In the present investigation, we did not observe any difference in LV BF (evaluated by microspheres infusion) and VEGF protein expression between SI and TI groups; however, mRNA levels of VEGF were increased in trained animals. Many are the factors involved in the protein transcriptional process. In this sense, it is possible that the higher levels of mRNA, observed in this study, associated with changes in transcriptional factors have not been sufficient to modify the synthesis of VEGF protein. However, we cannot exclude that increased levels of VEGF or BF in some time of protocol period, not measured in this study, may have also contributed to better cardiac function and reduced MI area at the end of the experiments. In fact, only the measurement of mRNA and VEGF protein expression may be not sufficient to quantify the angiogenesis processes. Milkiewicz et al.³⁵ comparing the mRNA and VEGF protein expressions after muscle ischaemia concluded that these measurements of VEGF not necessarily are paralleled and the isolated evaluation of these parameters is not an adequate index of angiogenic potential. Additionally, we can suppose that the unchanged VEGF protein could be related to unchanged coronary BF after ET, suggesting that the improvement of cardiac function was more related to an increase in contractility factors than to an increase in flow-mediated mechanisms.

Despite the fact that LV mass and LVDD were not different from SI and TI groups in the present investigation, we hypothesized that LV reverse remodelling may be occurred in the trained group resulting in cardiac physiological adaptation to ET. Confirming our hypothesis, we observed the normalization of systolic and diastolic function in trained rats, represented by improved EF, +dP/dt, −dP/dt, and LVEDP. In fact, Xu et al.³⁶ demonstrated that the cardiac function was significantly preserved and collagen volume fraction was reduced in MI-trained rats in comparison with the sedentary rats. Furthermore, a prospective, randomized, controlled trial showed that in patients, with decreased EF after MI, long-term ET attenuates the unfavourable remodelling process and even improves both global and regional functions over time.³⁷

As cardiac function is strongly associated with a better profile of cardiac proteins related to intracellular calcium homeostasis, we tested the possibility that the amelioration of LV function observed in TI rats could be related with molecular changes related to calcium homeostasis. It was previously reported that HF cardiac dysfunction is, at least in part, a consequence of changes in intracellular Ca²⁺ net balance, which may be related to an altered expression, function, or regulation of myocyte SERCA2.³⁸ In fact, in the present investigation, we observed that SI animals displayed reduction of SERCA2 expression; however, ET normalized the expression of this protein in TI animals. In accordance with these data, our group previously demonstrated that the ET increased SERCA2 expression and SERCA2/sodium–calcium exchange in a genetic model of sympathetic hyperactivity-induced HF. This improvement was also accompanied by an increase in expression of phospholamban phosphorylated at serine 16.²⁴ Thus, it is reasonable to speculate that the similar mechanisms may have occurred in this study, increasing the intracellular calcium net balance. Taken together, our results clearly suggest that early ET intervention (started 1 week after MI) may be favourable to increase cardiac contractility and relaxation that associated with the decrease in PVR could explain the LV function improvement and the decrease in MI area, observed in trained rats.

Indeed, the normalization of CO and PVR observed in the TI group was probably responsible for maintaining the regional BF in this group. Considering that oxygen consumption is related to CO and arterial venous difference, and arterial venous difference is regulated by peripheral BF, the normalization of cardiac and peripheral dysfunctions observed in TI rats can be a key point in determining the improvement in functional capacity in the studied animals.

To further investigate the mechanisms underlying the improved cardiac function and tissue perfusion, and also the reduced mortality rate observed in TI animals, we evaluated BRS and PIV. We confirmed that haemodynamic and autonomic parameters, such as AP, CO, BRS, and PIV, were reduced in SI rats, resulting in reduced functional capacity and a higher mortality rate, reinforcing the role of cardiovascular indexes as prognostic markers and mortality indicators after MI.² Moreover, previous reports have pointed out that many secondary abnormalities associated with MI may reflect in physical deconditioning,^39,40 which itself may be partly responsible for some of the associated abnormalities and exercise limitations of HF, including impairment in autonomic balance.

The mechanisms of neurohumoral excitation after MI are not entirely understood. It is likely that activation of cardiac sympathetic afferent fibres increases sympathetic outflow during the phase of diastolic dysfunction after MI.⁴¹ The later development of LV dysfunction is associated with further increment in neurohumoral excitation, due to arterial and cardiopulmonary baroreceptors abnormalities.⁴² Consequently, these alterations may cause a reduction in peripheral BF, because a constant decrease occurs in CO, compensated by sympathetic overactivity, neurohumoral activation, and PIV impairment, which is an important determinant of mortality in MI patients.²

Regarding the BRS and HRV as potentials indicators of high and low risk for cardiac mortality, Iellamo et al.⁴³ in the first randomized, controlled study observed that ET results in marked enhancement of both BRS and HRV in patients with coronary artery disease. In addition, the authors also suggested that the improvement of BRS associated with ET is not limited to patients with prior MI but extends to coronary patients without MI, in whom measures that could reduce the risk of subsequent lethal events might be of paramount importance. In the present study, early ET restored autonomic control of circulation represented by BRS and PIV. This suggests that ET may not only increase the reflex responses mediated by the parasympathetic nervous system, but also suppress the influence of the sympathetic nervous system in ischaemic heart disease. In fact, after the ET protocol, we observed that infarcted rats presented similar LF band values in comparison with controls, suggesting that ET favourably changed the sympathetic modulation in these animals, since the LF component of PIV reduction has been associated with sympathetic overactivity and poor prognoses.⁴⁴ Moreover, the HF band of PIV increased, but not normalized, after ET, indicating an improvement in parasympathetic modulation on the heart in TI.

Our study corroborates previous investigations that have shown that ET improves autonomic nervous activity and decreases the incidence of cardiac events or sudden death in patients with MI or with chronic HF.^39,43 Cardiovascular autonomic indexes, such as BRS, PIV,² and LF and HF bands of power spectral analyses,⁴⁴ are important prognostic markers and mortality indicators after MI. It is important to highlight that ET normalized all these parameters in the present study. On the basis of these findings and corroborating previous data from our group in which ET reduced the mortality rate in diabetic animals,^13,16 this study confirms that early ET was also effective in reducing the total mortality rate in infarcted animals.

In conclusion, early ET intervention reduced cardiac and peripheral dysfunctions related to coronary occlusion. These benefits were associated with preservation of cardiovascular autonomic control, improvement of functional capacity, and increased survival rate after MI.

Study limitations

Some possible limitations of the present investigation deserve comments. First, the haemodynamic and autonomic parameters were evaluated at the end of the protocol, and comparisons were made by including a control group in the experimental design. Indeed, the direct method to record blood pressure depends on the catheterization of arterial vessels that are functional during a small time period. Consequently, the biological signals were recorded only at the end of the experimental period, leading to the lack of baseline values in the same animals at the starting of the study. Secondly, since the experimental animals (SI and TI) started the ET protocol with similar values of MI area, LF function, and VO₂ max, the prediction of survival (or mortality) based on these parameters becomes difficult and is limited to methods used in this study.

Funding

This study was supported by Fundação de Amparo a Pesquisa do Estado de São Paulo (FAPESP-01/00009-0; 07/57595-5) and Fundação E.J. Zerbini. L.J. held a master scholarship from Fundação de Amparo a Pesquisa do Estado de São Paulo (FAPESP-06/53800-0). B.R. held a post-doctoral fellowship from Conselho Nacional de Pesquisa e Desenvolvimento (CNPq). M.-C.I and K.D.A. hold financial support from Conselho Nacional de Pesquisa e Desenvolvimento (CNPq-BPQ).

Conflict of interest: none declared.