Abstract

Alterations in the human gut microbiota caused, for example, by diet, functional foods, antibiotics, or occurring as a function of age are now known to be of relevance for host health. Therefore, there is a strong need for methods to detect such alterations in a rapid and comprehensive manner. In the present study, we developed and validated a high-throughput real-time quantitative PCR-based analysis platform, termed ‘GUt Low-Density Array’ (GULDA). The platform was designed for simultaneous analysis of the change in the abundance of 31 different microbial 16S rRNA gene targets in fecal samples obtained from individuals at various points in time. The target genes represent important phyla, genera, species, or other taxonomic groups within the five predominant bacterial phyla of the gut, Firmicutes, Bacteroidetes, Actinobacteria, Proteobacteria, and Verrucomicrobia and also Euryarchaeota. To demonstrate the applicability of GULDA, analysis of fecal samples obtained from six healthy infants at both 9 and 18 months of age was performed and showed a significant increase over time of the relative abundance of bacteria belonging to Clostridial cluster IV (Clostridia leptum group) and Bifidobacterium bifidum and concurrent decrease in the abundance of Clostridium butyricum and a tendency for decrease in Enterobacteriaceae over the 9-month period.

Introduction

The term ‘microbial metagenomics’ denotes any culture-independent study of the collective set of genomes of mixed microbial communities present in a given environment such as the human intestinal tract (Petrosino et al., 2009). Within the last couple of decades, the microbial composition of the human gut microbiota has been extensively explored both quantitatively and qualitatively using a variety of molecular technologies including denaturing gradient gel electrophoresis of PCR-amplified 16S rRNA genes, terminal restriction fragment length polymorphism, quantitative PCR (qPCR), microarray gene chips, and fluorescent in situ hybridization (McCartney, 2002; Zoetendal et al., 2006). In later years, the development of high-throughput metagenome sequencing platforms has provided a remarkable acceleration of data generation and consequently much new insight into this complex ecosystem (Eckburg et al., 2005; Ley et al., 2005; Turnbaugh et al., 2009; Larsen et al., 2011). Although all the above techniques have proved highly useful, they have various inherent limitations including dynamic range, discriminatory power (Lock et al., 2010), sensitivity to low-abundant taxa (Wagner et al., 2007), and PCR bias. Additionally, cost and speed vary considerably between the different methodologies. The choice of method or combination of methods should consequently reflect a careful consideration of the study hypothesis and what kind of data would be most suited to address this.

Studies of the gut microbial composition may in general be divided into two main categories, namely (1) static studies that focus on determining the abundances of specific genetic components, such as 16S rRNA genes, within a study group at a defined point in time; and (2) dynamic studies that focus on determining the effect of a defined and controlled intervention, for example, a dietary intervention, on the genetic composition of the microbiota in terms of changes in abundance of specific phylogenetic taxa or functional genes. Microbiological data obtained from both these types of studies may be correlated with other parameters and end points, such as clinical observations and biological risk markers, in order to associate host physiology with the observed differences and changes in the microbiota. To achieve sufficient power in low-impact dietary intervention studies, it is often required to recruit and sample a fairly large number of participants resulting in a large number of intestinal samples to be analyzed. This coupled to the fact that certain taxa within the gut environment, which are known to be relevant for host health, such as the Enterobacteriaceae, normally represent < 1% of the total bacterial community (Zoetendal et al., 1998), calls for methods with both high sensitivity toward low-abundant taxa and a high dynamic range. Real-time qPCR analysis has these properties and is a relatively simple and affordable technique, which offers a high degree of reproducibility and specificity and has thus found extensive use in the quantitative analysis of gut bacterial populations (Huijsdens et al., 2002; Bartosch et al., 2004; Gueimonde et al., 2004; Matsuki et al., 2004; Haarman & Knol, 2006; Larsen et al., 2010; Petersen et al., 2010; Combes et al., 2011; Vigsnæs et al., 2011). Analysis of multiple bacterial targets using qPCR is, however, to some extent technically limited by the fact that each primer set is associated with specific temperature cycling conditions, necessitating separate qPCR setup for each target. Furthermore, because of varying PCR efficiency, amplicon lengths, and GC-content (Colborn et al., 2008), the generation of standard curves for each target gene is normally required in order to provide absolute quantification. In many metagenomic studies however, such absolute quantifications may not be essential, as focus may primarily be placed on identifying specific changes occurring in microbial communities of the individuals undergoing a certain intervention (e.g. the individuals in a group given probiotics as compared to a control group), rather than obtaining information on absolute quantities or abundances of different bacterial taxonomical groups (Larsen et al., 2011).

In the present study, we develop and validate a real-time qPCR platform, GUt Low-Density Array (GULDA), that allows the simultaneous relative quantification of 31 relevant microbial 16S rRNA gene targets in two extracted community DNA samples, with four technical replicates all performed on one 384-well plate using a universal thermocycling program. Relative quantities of specific rRNA genes are calculated using a universal bacterial 16S rRNA gene as reference, and fold-changes for each microbial group are determined without the use of standard curves.

Materials and methods

Genomic DNA from pure culture strains and human fecal samples

Genomic DNA from a total of 27 bacterial strains and one archaeal strain was either obtained directly from Deutsche Sammlung von Mikroorganismen und Zellkulturen gmbH, Germany (DSM), as extracted DNA or extracted from pure cultures originating from either DSM or The American Type Culture Collection, USA (ATCC; Fig. 1). Fecal samples obtained from six randomly selected infants from the SKOT cohort (Madsen et al., 2010) at both 9 and 18 months of age were selected, and community DNA was extracted on the Maxwell® 16 system using the Maxwell® 16 DNA Tissue DNA purification kit (Promega Biotech AB, Sweden). In all cases, the DNA concentrations were determined fluorometrically (Qubit® dsDNA HS assay; Invitrogen) and adjusted to 1 ng µL−1 prior to use as template in qPCR.

Difference between the Ct-value determined by qPCR on pure culture DNA for specific primers and for the universal bacterial primer (U1) targeting the V3 of all bacterial 16S rRNA genes. A color spectrum ranging from green through yellow to red is used to highlight the differences in Ct-value, with a green color indicating that the specific primer amplifies with a Ct-value close to the universal primer and a red color indicating a large difference in Ct-value. A maximum Ct-value of 35 was used for the calculations. The marked negative ΔCt-value associated with primer E1 for the amplification of Methanobrevibacter smithii signifies lower amplification efficiency of this strain with the universal bacterial primer set U1 as compared to primer E1 caused by mismatches of primer set U1 toward the archaeal DNA target.

Difference between the Ct-value determined by qPCR on pure culture DNA for specific primers and for the universal bacterial primer (U1) targeting the V3 of all bacterial 16S rRNA genes. A color spectrum ranging from green through yellow to red is used to highlight the differences in Ct-value, with a green color indicating that the specific primer amplifies with a Ct-value close to the universal primer and a red color indicating a large difference in Ct-value. A maximum Ct-value of 35 was used for the calculations. The marked negative ΔCt-value associated with primer E1 for the amplification of Methanobrevibacter smithii signifies lower amplification efficiency of this strain with the universal bacterial primer set U1 as compared to primer E1 caused by mismatches of primer set U1 toward the archaeal DNA target.

Initial primer selection for real-time qPCR

A total of 118 primer sets were either selected from the literature or designed de novo, to represent bacterial species, genera, phyla, or other taxonomical groups of relevance, that is, either being abundant in the human microbiota or being particularly interesting in the context of gut ecosystem function or impact on human health. Almost all primer sets target regions within the 16S rRNA gene with a few exceptions targeting the 16S–23S rRNA gene intergenic spacer region and/or the 23S rRNA gene. For simplicity, only the term ‘16S’ is used in the following. The specificity of all primer sets was initially evaluated in silico using nucleotide blast (Altschul et al., 1990) and the Ribosomal Database Project (RDP; Cole et al., 2009). One hundred and ten primer sets found to be suitable after this screening process were synthesized commercially by Eurofins MWG operon GmbH (Ebersberg, Germany).

Real-time qPCR conditions

Quantitative real-time PCR was performed on an ABI prism 7900HT from Applied Biosystems (Nærum, Denmark). All amplification reactions were carried out in transparent 384-well MicroAmp® Optical reaction plates (Applied Biosystems) and sealed with MicroAmp® Optical Adhesive Film in a total volume of 11 µL containing 5.5 µL 2× SYBR Green PCR Master Mix (Applied Biosystems), 0.4 µL of each primer (10 µM), 2 µL template DNA (2 ng), and 2.7 µL nuclease-free water (Qiagen GmbH, Hilden, Germany). Liquid handling was performed with an epMotion 5075 (Eppendorf, Hørsholm, Denmark). The amplification program was identical for all amplifications and consisted of one cycle of 50 °C for 2 min; one cycle of 95 °C for 10 min; 40 cycles of 95 °C for 15 s and 60 °C for 1 min; and finally dissociation curve analysis for assessing amplicon specificity (95 °C for 15 s, 60 °C for 15 s, then increasing to 95 °C at 2% ramp rate). Initial qPCR screening on extracted mixed human fecal DNA from healthy volunteers was used in order to identify and remove primer sets, which did not amplify the expected target from this matrix. Fecal DNA was obtained from the control group of a previously conducted study and was extracted using the QIAamp DNA Stool Mini Kit (Qiagen) preceded by a bead-beater step as previously described (Leser et al., 2000; Licht et al., 2006). A subset of 58 primer sets (of the 110), selected based on their ability to generate amplification products from the complex fecal DNA template material, was used for further evaluation of target specificity on pure culture DNA.

qPCR primer validation on pure culture DNA

The 58 primer sets were tested against extracted DNA from 27 bacterial strains, and one archaeal strain, using the PCR conditions listed above. Reactions were performed in duplicate using 2 ng of DNA as template and always including the universal bacterial primers (reference gene) on the same plate. The generated PCR products were assessed by dissociation curve analysis and 2% agarose gel electrophoresis, stained with SYBR Green, to determine the homogeneity and length of the amplification product, respectively. For each qPCR on pure culture DNA, the mean Ct-value was determined based on a set threshold value of 0.2 and using the automatic baseline correction setting in the qPCR software (sds 2.2; Applied Biosystems, CA). Differences in Ct-values for each target strain were calculated between those obtained with the universal primer set and those obtained using every other primer set on the array in order to assess primer specificity. A maximum Ct-value of 35 was used for these calculations. A total of 31 specific primer sets as well as one universal bacterial reference primer set were selected for the GULDA based on their specificity toward target bacterial microbial groups (Fig. 1). The RDP ProbeMatch tool was used to assess the binding potential of the universal primer set within the five predominant bacterial phyla of the gut separately. Visualization of amplification products by agarose gel electrophoresis following amplification on fecal DNA template showed that all 31 primer sets generated single and distinct bands of the expected length (data not shown).

GULDA on DNA from human fecal samples

Extracted DNA from 12 human fecal samples, representing six infants sampled 9 and 18 months, respectively, was used as template for GULDA using the 31 validated primer sets with four technical replicas of each amplification. Following the thermocycling program, the raw fluorescence data recorded by the sds software were exported to the linregpcr program (Ramakers et al., 2003; Ruijter et al., 2009). The linregpcr software was used to perform baseline correction and calculate the mean PCR efficiency per amplicon group. This was used to calculate the initial quantities N0 (arbitrary fluorescence units) for each amplicon by the formula N0 = threshold/(graphic), where Effmean denotes the mean PCR efficiency per amplicon, threshold is the optimal ‘cutoff’ in the exponential region, and Ct is the cycle number, where each sample exceeds this threshold. The relative abundance of the 31 specific amplicon groups was obtained by normalization to the N0-value obtained for the universal bacterial amplicon group determined in the same array. A detection limit of 10−5 (N0,specific/N0,universal) was applied to the normalized N0-values due to qPCR analysis limitations, and the normalized N0-value was set to this value for specific amplicon groups below this detection limit to allow further analysis.

Principal component analysis, fold-change calculations, and statistical analysis

The normalized N0-values (log10-transformed) obtained from each bacterial amplicon group were used as input for multivariate principal component analysis (PCA) using latentix version 2.11. Lines between the same individuals (at 9 and 18 months) were included in the PCA score plot. Fold-changes for specific amplicon groups were calculated as the (log 2) ratio of normalized abundances at 18 and 9 months. Statistical analysis was performed using the graphpad prism software (version 5.03; GraphPad Software Inc., La Jolla, CA). Indicated P-values refer to significance in Wilcoxon's signed rank test.

Results and discussion

The identification, selection, and validation of specific qPCR primers that target relevant groups of common gut bacteria and which are able to perform well during a universal thermocycling program was the primary focus of this study. Numerous primer sets targeting different bacterial taxonomical groups including species, genera, and phyla of the gut microbiota have been published during the last decades; however far from all have been evaluated in depth for their specificity to the taxonomical group that they were designed to amplify. Primer validation may be performed either in silico with reference to, for example, the RDP or by laboratory tests against a panel of DNA extracted from related bacteria. In the present study, extracted DNA from a total of 28 microbial species was used for the specificity validation of 58 qPCR primer sets all targeting the 16S rRNA gene of gut bacteria. One universal primer set was included designed to target the V3 variable regions (positions 339–539 in the Escherichia coli gene) of all known bacteria (Walter et al., 2000; Chakravorty et al., 2007). This primer set was shown in silico to match on average 99.1% ± 0.88% of a total of 931 412 good-quality (> 1200 bp) 16S rRNA gene sequences representing Firmicutes, Bacteroidetes, Actinobacteria, Proteobacteria, and Verrucomicrobia, respectively, found in RDP, with allowance for two mismatches. In some cases, unspecific amplification or lack of amplification was observed, which may to some extent be caused by the requirement for primers to perform in the applied universal two-step qPCR, with both annealing and elongation at 60 °C. Following the final screening, a total of 32 primer sets collectively representing the five dominating bacterial phyla of the gut microbiota, as well as the Euryarcheota (Methanobrevibacter smithii) and one universal bacterial primer set, were selected for the GULDA (Table 1). The specificity of these primers was overall consistent with the expected target groups, and amplification efficiencies were comparable to those observed for the universal bacterial primer set, as determined by differences in Ct-values following amplification on pure culture DNA (Fig. 1). It was recently shown that it is possible to optimize qPCR assay efficiency by primer modification, in order to run 16S rRNA gene primers displaying optimal specificities at different annealing temperatures on the same PCR plate under the same experimental conditions (Bacchetti De Gregoris et al., 2011). In the present study, the PCR efficiency for each amplicon group was calculated separately from the slope of the amplification curve by linear regression within the window of linearity (logarithmic scale) by the use of the linregpcr software. The mean calculated efficiencies for each amplicon group were then used to determine the initial concentration, N0, of the DNA target, that is, specific 16S rRNA gene, in arbitrary fluorescence units (Ramakers et al., 2003; Ruijter et al., 2009). All N0-values for specific bacterial taxa were normalized to the calculated universal bacterial N0-value amplified on the same plate. Normalized N0-values obtained from the same amplicon group, for example phylum Bacteroidetes, are directly comparable to each other and may thus be used to determine the fold-change of specific groups of bacteria between two or more samples. Direct comparisons between different amplicon groups may, however, be biased due to, for example, differences in amplicon length and GC-content causing nonequal binding of SYBR Green. Analysis of the fecal samples obtained from six infants at both 9 and 18 months was performed by PCA of normalized N0-values calculated from GULDA (Fig. 2). The score plot shows that all six individuals migrated from left to right along the PC#1 with generally little movement vertically along the PC#2. The initial grouping appeared more confined for the individuals at 9 months as compared to 18 months, which is consistent with the development of a more complex and individual gut microbiota. The loading plot indicates which bacterial taxa drive this migration, which was further studied by calculating the fold-changes for specific amplicon groups (Fig. 3). The latter shows a significant (P < 0.05) increase in the relative abundance of Clostridial cluster IV (Clostridia leptum group) and Bifidobacterium bifidum and concurrent significant decrease in the abundance of Clostridium butyricum (Clostridial cluster I) and a tendency for decrease in Enterobacteriaceae and E. coli (P < 0.10) from 9 to 18 months of age. These findings are consistent with some of the results of a previous study using both qPCR and Northern blotting to characterize intestinal bacteria in infant stools (Hopkins et al., 2005), which showed a significant decrease in Enterobacteria and increase in Faecalibacterium prausnitzii (Clostridial cluster IV) rRNA after 6 months of age. No other significant changes were observed within the remaining 26 amplification groups in the present study. Although a fairly small dataset, n = 6 infants, was used in this study, the methodological protocol of calculating the changes in a microbial community over a time period by the use of relative qPCR determinations performed under universal temperature cycling conditions was successfully demonstrated. In the present study, multiple bifidobacterial species were included in the array as this genus is known to be highly represented during infancy (Roger et al., 2010). Modification of GULDA for other purposes by incorporating other primer sets is, however, easily achieved and provides a high degree of flexibility to the qPCR array. We expect GULDA to be a very useful tool to study induced changes in the composition of the gut microbiota and consequently further elucidate the causal relationships between the vast numbers of bacterial species present in the human gut microbiota.

PCA of the relative quantitative abundance (N0) of 29 microbial taxa in fecal samples obtained from six infants at both 9 months (1–9 to 6–9) and 18 months (1–18 to 6–18) of age, using the first and second principal components (PC#1, 29.7%; PC#2, 16.0%). (a) Score plot showing the individual communities at 9 and 18 months with connecting lines between the same infants, showing that all communities migrated in the same direction along PC#1 between the first and the second samplings. (b) Loading plot indicating each of the measured microbial taxa labeled with primer ID. Underlined primer sets show those associated with significant fold-changes over time (Fig. 3). Primer sets F3 and F4 were omitted due to very low or absent N0-values.

PCA of the relative quantitative abundance (N0) of 29 microbial taxa in fecal samples obtained from six infants at both 9 months (1–9 to 6–9) and 18 months (1–18 to 6–18) of age, using the first and second principal components (PC#1, 29.7%; PC#2, 16.0%). (a) Score plot showing the individual communities at 9 and 18 months with connecting lines between the same infants, showing that all communities migrated in the same direction along PC#1 between the first and the second samplings. (b) Loading plot indicating each of the measured microbial taxa labeled with primer ID. Underlined primer sets show those associated with significant fold-changes over time (Fig. 3). Primer sets F3 and F4 were omitted due to very low or absent N0-values.

Ratio (fold-change) of selected 16S rRNA gene targets in fecal samples from 18-month-old infants compared to the same individual at 9 months. Columns show means (n = 6), and error bars represent the standard errors of the means. Different shadings of columns represent the four phyla Firmicutes (white), Bacteroidetes (light gray), Actinobacteria (gray), and Proteobacteria (dark gray). Significant differences from a hypothetical value of 0 (no change) are indicated with *P < 0.05 or #P < 0.10.

Ratio (fold-change) of selected 16S rRNA gene targets in fecal samples from 18-month-old infants compared to the same individual at 9 months. Columns show means (n = 6), and error bars represent the standard errors of the means. Different shadings of columns represent the four phyla Firmicutes (white), Bacteroidetes (light gray), Actinobacteria (gray), and Proteobacteria (dark gray). Significant differences from a hypothetical value of 0 (no change) are indicated with *P < 0.05 or #P < 0.10.

1

List of primer sets used in GULDA

ID Phylum Class/Family/Genus Species/Group Primer sequence (5′-3′) Approximately amplicon size (bp) References 
U1 Universal All All ACTCCTACGGGAGGCAGCAGT
GTATTACCGCGGCTGCTGGCAC 
174–199 Walter et al. (2000) 
F1 Firmicutes All All TGAAACTYAAAGGAATTGACG
ACCATGCACCACCTGTC 
157 Bacchetti De Gregoris et al. (2011) 
F1b Firmicutes All All GGAGYATGTGGTTTAATTCGAAGCA
AGCTGACGACAACCATGCAC 
126 Guo et al. (2008) 
F2 Firmicutes Lactobacillus spp. AGCAGTAGGGAATCTTCCA
CACCGCTACACATGGAG 
341 Walter et al. (2001), Heilig et al. (2002) 
F3 Firmicutes Lactobacillus plantarum CTCTGGTATTGATTGGTGCTTGCAT
GTTCGCCACTCACTCAAATGTAAA 
54 Matsuda et al. (2009) 
F4 Firmicutes Lactobacillus acidophilus GCAGATCGCATGATCAGCTTATA
TCAGTCTCTCAACTCGGCTATG 
129 Firmesse et al. (2008) 
F5 Firmicutes Clostridium butyricum GTGCCGCCGCTAACGCATTAAGTAT
ACCATGCACCACCTGTCTTCCTGCC 
213 Bartosch et al. (2004) 
F6 Firmicutes Clostridia Cluster IV (C. leptum group) GCACAAGCAGTGGAGT
CTTCCTCCGTTTTGTCAA 
239 Matsuki et al. (2004) 
F7 Firmicutes Clostridia Cluster XIVa (C. coccoidesE. rectale group) AAATGACGGTACCTGACTAA
CTTTGAGTTTCATTCTTGCGAA 
438–441 Matsuki et al. (2002) 
F8 Firmicutes Eubacterium hallii GCGTAGGTGGCAGTGCAA
GCACCGRAGCCTATACGG 
278 Ramirez-Farias et al. (2009) 
F9 Firmicutes Roseburia spp. TACTGCATTGGAAACTGTCG
CGGCACCGAAGAGCAAT 
230 Larsen et al. (2010) 
F10 Firmicutes Enterococcus spp. CCCTTATTGTTAGTTGCCATCATT
ACTCGTTGTACTTCCCATTGT 
144 Rinttila et al. (2004) 
B1 Bacteroidetes All All GGARCATGTGGTTTAATTCGATGAT
AGCTGACGACAACCATGCAG 
126 Guo et al. (2008) 
B2 Bacteroidetes Bacteroides/Prevotella spp. GAGAGGAAGGTCCCCCAC
CGCTACTTGGCTGGTTCAG 
106 Layton et al. (2006) 
B3 Bacteroidetes Bacteroides spp. CGATGGATAGGGGTTCTGAGAGGA
GCTGGCACGGAGTTAGCCGA 
238 This study 
B4 Bacteroidetes Bacteroides fragilis group CTGAACCAGCCAAGTAGCG
CCGCAAACTTTCACAACTGACTTA 
230 Liu et al. (2003) 
B5 Bacteroidetes Bacteroides vulgatus GCATCATGAGTCCGCATGTTC
TCCATACCCGACTTTATTCCTT 
287 Wang et al. (1996) 
B6 Bacteroidetes Bacteroides thetaiotaomicron GGCAGCATTTCAGTTTGCTTG
GGTACATACAAAATTCCACACGT 
423 Wang et al. (1996) 
B7 Bacteroidetes Bacteroides eggerthii GTCATATTAACGGTGGCG
GGGTTBCCCCATTCGG 
250 Liu et al. (2003) 
B8 Bacteroidetes Parabacteroides distasonis TGATCCCTTGTGCTGCT
ATCCCCCTCATTCGGA 
220 Liu et al. (2003) 
B9 Bacteroidetes Prevotella spp. CACCAAGGCGACGATCA
GGATAACGCCYGGACCT 
283 Larsen et al. (2010) 
B10 Bacteroidetes Alistipes spp. TTAGAGATGGGCATGCGTTGT
TGAATCCTCCGTATT 
320 Vigsnæs et al. (2012) 
A1 Actinobacteria Bifidobacterium spp. GCGTGCTTAACACATGCAAGTC
CACCCGTTTCCAGGAGCTATT 
126 Penders et al. (2005) 
A1b Actinobacteria Bifidobacterium spp. CGCGTCYGGTGTGAAAG
CCCCACATCCAGCATCCA 
244 Delroisse et al. (2008) 
A2 Actinobacteria Bifidobacterium bifidum CCACATGATCGCATGTGATTG
CCGAAGGCTTGCTCCCAAA 
278 Matsuki et al. (1998) 
A3 Actinobacteria Bifidobacterium adolescentis CTCCAGTTGGATGCATGTC
CGAAGGCTTGCTCCCAGT 
279 Matsuki et al. (1998) 
A4 Actinobacteria Bifidobacterium catenulatum/psudocatenulatum CGGATGCTCCGACTCCT
CGAAGGCTTGCTCCCGAT 
289 Matsuki et al. (1998) 
A5 Actinobacteria Bifidobacterium longum GGATGTTCCAGTTGATCGCATGGTC
AGCCGGTGCTTATTCAACGGGTAA 
312 This study 
A6 Actinobacteria Bifidobacterium breve AATGCCGGATGCTCCATCACAC
GCCTTGCTCCCTAACAAAAGAGG 
286 Rinne et al. (2005) 
P1 Proteobacteria Enterobacteriaceae group CATTGACGTTACCCGCAGAAGAAGC
CTCTACGAGACTCAAGCTTGC 
195 Bartosch et al. (2004) 
P2 Proteobacteria Escherichia coli CATGCCGCGTGTATGAAGAA
CGGGTAACGTCAATGAGCAAA 
96 Huijsdens et al. (2002) 
P3 Proteobacteria Desulfovibrio spp. CCGTAGATATCTGGAGGAACATCAG
ACATCTAGCATCCATCGTTTACAGC 
136 Fite et al. (2004) 
V1 Verrucomicrobia Akkermansia muciniphila CAGCACGTGAAGGTGGGGAC
CCTTGCGGTTGGCTTCAGAT 
329 Collado et al. (2007) 
E1 Euryarchaeota Methanobrevibacter Smithii CCGGGTATCTAATCCGGTTC
CTCCCAGGGTAGAGGTGAAA 
123 Dridi et al. (2009) 
ID Phylum Class/Family/Genus Species/Group Primer sequence (5′-3′) Approximately amplicon size (bp) References 
U1 Universal All All ACTCCTACGGGAGGCAGCAGT
GTATTACCGCGGCTGCTGGCAC 
174–199 Walter et al. (2000) 
F1 Firmicutes All All TGAAACTYAAAGGAATTGACG
ACCATGCACCACCTGTC 
157 Bacchetti De Gregoris et al. (2011) 
F1b Firmicutes All All GGAGYATGTGGTTTAATTCGAAGCA
AGCTGACGACAACCATGCAC 
126 Guo et al. (2008) 
F2 Firmicutes Lactobacillus spp. AGCAGTAGGGAATCTTCCA
CACCGCTACACATGGAG 
341 Walter et al. (2001), Heilig et al. (2002) 
F3 Firmicutes Lactobacillus plantarum CTCTGGTATTGATTGGTGCTTGCAT
GTTCGCCACTCACTCAAATGTAAA 
54 Matsuda et al. (2009) 
F4 Firmicutes Lactobacillus acidophilus GCAGATCGCATGATCAGCTTATA
TCAGTCTCTCAACTCGGCTATG 
129 Firmesse et al. (2008) 
F5 Firmicutes Clostridium butyricum GTGCCGCCGCTAACGCATTAAGTAT
ACCATGCACCACCTGTCTTCCTGCC 
213 Bartosch et al. (2004) 
F6 Firmicutes Clostridia Cluster IV (C. leptum group) GCACAAGCAGTGGAGT
CTTCCTCCGTTTTGTCAA 
239 Matsuki et al. (2004) 
F7 Firmicutes Clostridia Cluster XIVa (C. coccoidesE. rectale group) AAATGACGGTACCTGACTAA
CTTTGAGTTTCATTCTTGCGAA 
438–441 Matsuki et al. (2002) 
F8 Firmicutes Eubacterium hallii GCGTAGGTGGCAGTGCAA
GCACCGRAGCCTATACGG 
278 Ramirez-Farias et al. (2009) 
F9 Firmicutes Roseburia spp. TACTGCATTGGAAACTGTCG
CGGCACCGAAGAGCAAT 
230 Larsen et al. (2010) 
F10 Firmicutes Enterococcus spp. CCCTTATTGTTAGTTGCCATCATT
ACTCGTTGTACTTCCCATTGT 
144 Rinttila et al. (2004) 
B1 Bacteroidetes All All GGARCATGTGGTTTAATTCGATGAT
AGCTGACGACAACCATGCAG 
126 Guo et al. (2008) 
B2 Bacteroidetes Bacteroides/Prevotella spp. GAGAGGAAGGTCCCCCAC
CGCTACTTGGCTGGTTCAG 
106 Layton et al. (2006) 
B3 Bacteroidetes Bacteroides spp. CGATGGATAGGGGTTCTGAGAGGA
GCTGGCACGGAGTTAGCCGA 
238 This study 
B4 Bacteroidetes Bacteroides fragilis group CTGAACCAGCCAAGTAGCG
CCGCAAACTTTCACAACTGACTTA 
230 Liu et al. (2003) 
B5 Bacteroidetes Bacteroides vulgatus GCATCATGAGTCCGCATGTTC
TCCATACCCGACTTTATTCCTT 
287 Wang et al. (1996) 
B6 Bacteroidetes Bacteroides thetaiotaomicron GGCAGCATTTCAGTTTGCTTG
GGTACATACAAAATTCCACACGT 
423 Wang et al. (1996) 
B7 Bacteroidetes Bacteroides eggerthii GTCATATTAACGGTGGCG
GGGTTBCCCCATTCGG 
250 Liu et al. (2003) 
B8 Bacteroidetes Parabacteroides distasonis TGATCCCTTGTGCTGCT
ATCCCCCTCATTCGGA 
220 Liu et al. (2003) 
B9 Bacteroidetes Prevotella spp. CACCAAGGCGACGATCA
GGATAACGCCYGGACCT 
283 Larsen et al. (2010) 
B10 Bacteroidetes Alistipes spp. TTAGAGATGGGCATGCGTTGT
TGAATCCTCCGTATT 
320 Vigsnæs et al. (2012) 
A1 Actinobacteria Bifidobacterium spp. GCGTGCTTAACACATGCAAGTC
CACCCGTTTCCAGGAGCTATT 
126 Penders et al. (2005) 
A1b Actinobacteria Bifidobacterium spp. CGCGTCYGGTGTGAAAG
CCCCACATCCAGCATCCA 
244 Delroisse et al. (2008) 
A2 Actinobacteria Bifidobacterium bifidum CCACATGATCGCATGTGATTG
CCGAAGGCTTGCTCCCAAA 
278 Matsuki et al. (1998) 
A3 Actinobacteria Bifidobacterium adolescentis CTCCAGTTGGATGCATGTC
CGAAGGCTTGCTCCCAGT 
279 Matsuki et al. (1998) 
A4 Actinobacteria Bifidobacterium catenulatum/psudocatenulatum CGGATGCTCCGACTCCT
CGAAGGCTTGCTCCCGAT 
289 Matsuki et al. (1998) 
A5 Actinobacteria Bifidobacterium longum GGATGTTCCAGTTGATCGCATGGTC
AGCCGGTGCTTATTCAACGGGTAA 
312 This study 
A6 Actinobacteria Bifidobacterium breve AATGCCGGATGCTCCATCACAC
GCCTTGCTCCCTAACAAAAGAGG 
286 Rinne et al. (2005) 
P1 Proteobacteria Enterobacteriaceae group CATTGACGTTACCCGCAGAAGAAGC
CTCTACGAGACTCAAGCTTGC 
195 Bartosch et al. (2004) 
P2 Proteobacteria Escherichia coli CATGCCGCGTGTATGAAGAA
CGGGTAACGTCAATGAGCAAA 
96 Huijsdens et al. (2002) 
P3 Proteobacteria Desulfovibrio spp. CCGTAGATATCTGGAGGAACATCAG
ACATCTAGCATCCATCGTTTACAGC 
136 Fite et al. (2004) 
V1 Verrucomicrobia Akkermansia muciniphila CAGCACGTGAAGGTGGGGAC
CCTTGCGGTTGGCTTCAGAT 
329 Collado et al. (2007) 
E1 Euryarchaeota Methanobrevibacter Smithii CCGGGTATCTAATCCGGTTC
CTCCCAGGGTAGAGGTGAAA 
123 Dridi et al. (2009) 

For each primer set, the first row shows the forward primer and second row the reverse primer. Y = C or T; R = A or G; M = A or C; S = C or T; B = G, C or T.

Abbreviations for primer ID are as follows: U, Universal; F, Firmicutes; B, Bacteroidetes; A, Actinobacteria; P, Proteobacteria; V, Verrucomicrobia; E, Euryarchaeota.

Primer sets F1b and A1b were associated with misamplification of Bifidobacteria spp. and slight misamplification within the Firmicutes phylum, respectively. Alternatives F1 and A1 are presented in the table and validated (Fig. 1).

Primer set B7 targets the 16S–23S rRNA gene intergenic spacer region/23S rRNA gene and primer set B8 targets the 16S–23S rRNA gene intergenic spacer region.

Acknowledgements

The authors would like to thank The Danish Agency for Science, Technology and Innovation for financial support. We thank laboratory technicians Bodil Madsen and Vivian Julia Anker for excellent technical assistance, Thomas Skov for advice on PCA analysis and Sara Dyhrberg and Louise Nissen-Schmidt for valuable assistance in the development of the GULDA qPCR setup.

References

Altschul
S.F.
Gish
W.
Miller
W.
Myers
E.W.
Lipman
D.J.
(
1990
)
Basic local alignment search tool
.
J Mol Biol
 
215
:
403
410
.
Bacchetti De Gregoris
T.
Aldred
N.
Clare
A.S.
Burgess
J.G.
(
2011
)
Improvement of phylum- and class-specific primers for real-time PCR quantification of bacterial taxa
.
J Microbiol Methods
 
86
:
351
356
.
Bartosch
S.
Fite
A.
Macfarlane
G.T.
McMurdo
M.E.
(
2004
)
Characterization of bacterial communities in feces from healthy elderly volunteers and hospitalized elderly patients by using real-time PCR and effects of antibiotic treatment on the fecal microbiota
.
Appl Environ Microbiol
 
70
:
3575
3581
.
Chakravorty
S.
Helb
D.
Burday
M.
Connell
N.
Alland
D.
(
2007
)
A detailed analysis of 16S ribosomal RNA gene segments for the diagnosis of pathogenic bacteria
.
J Microbiol Methods
 
69
:
330
339
.
Colborn
J.M.
Byrd
B.D.
Koita
O.A.
Krogstad
D.J.
(
2008
)
Estimation of copy number using SYBR Green: confounding by AT-rich DNA and by variation in amplicon length
.
Am J Trop Med Hyg
 
79
:
887
892
.
Cole
J.R.
Wang
Q.
Cardenas
E.
et al
. (
2009
)
The Ribosomal Database Project: improved alignments and new tools for rRNA analysis
.
Nucleic Acids Res
 
37
:
D141
D145
.
Collado
M.C.
Derrien
M.
Isolauri
E.
de Vos
W.M.
Salminen
S.
(
2007
)
Intestinal integrity and Akkermansia muciniphila, a mucin-degrading member of the intestinal microbiota present in infants, adults, and the elderly
.
Appl Environ Microbiol
 
73
:
7767
7770
.
Combes
S.
Michelland
R.J.
Monteils
V.
Cauquil
L.
Soulie
V.
Tran
N.U.
Gidenne
T.
Fortun-Lamothe
L.
(
2011
)
Postnatal development of the rabbit caecal microbiota composition and activity
.
FEMS Microbiol Ecol
 
77
:
680
689
.
Delroisse
J.M.
Boulvin
A.L.
Parmentier
I.
Dauphin
R.D.
Vandenbol
M.
Portetelle
D.
(
2008
)
Quantification of Bifidobacterium spp. and Lactobacillus spp. in rat fecal samples by real-time PCR
.
Microbiol Res
 
163
:
663
670
.
Dridi
B.
Henry
M.
Khéchine
A.E.
Raoult
D.
Drancourt
M.
(
2009
)
High prevalence of Methanobrevibacter smithii and Methanosphaera stadtmanae detected in the human gut using an improved DNA detection protocol
.
PLoS ONE
 
4
:
e7063
.
Eckburg
P.B.
Bik
E.M.
Bernstein
C.N.
Purdom
E.
Dethlefsen
L.
Sargent
M.
Gill
S.R.
Nelson
K.E.
Relman
D.A.
(
2005
)
Diversity of the human intestinal microbial flora
.
Science
 
308
:
1635
1638
.
Firmesse
O.
Mogenet
A.
Bresson
J.L.
Corthier
G.
Furet
J.P.
(
2008
)
Lactobacillus rhamnosus R11 consumed in a food supplement survived human digestive transit without modifying microbiota equilibrium as assessed by real-time polymerase chain reaction
.
J Mol Microbiol Biotechnol
 
14
:
90
99
.
Fite
A.
Macfarlane
G.T.
Cummings
J.H.
Hopkins
M.J.
Kong
S.C.
Furrie
E.
Macfarlane
S.
(
2004
)
Identification and quantitation of mucosal and faecal desulfovibrios using real time polymerase chain reaction
.
Gut
 
53
:
523
529
.
Gueimonde
M.
Tolkko
S.
Korpimaki
T.
Salminen
S.
(
2004
)
New real-time quantitative PCR procedure for quantification of bifidobacteria in human fecal samples
.
Appl Environ Microbiol
 
70
:
4165
4169
.
Guo
X.
Xia
X.
Tang
R.
Zhou
J.
Zhao
H.
Wang
K.
(
2008
)
Development of a real-time PCR method for Firmicutes and Bacteroidetes in faeces and its application to quantify intestinal population of obese and lean pigs
.
Lett Appl Microbiol
 
47
:
367
373
.
Haarman
M.
Knol
J.
(
2006
)
Quantitative real-time PCR analysis of fecal Lactobacillus species in infants receiving a prebiotic infant formula
.
Appl Environ Microbiol
 
72
:
2359
2365
.
Heilig
H.G.
Zoetendal
E.G.
Vaughan
E.E.
Marteau
P.
Akkermans
A.D.
de Vos
W.M.
(
2002
)
Molecular diversity of Lactobacillus spp. and other lactic acid bacteria in the human intestine as determined by specific amplification of 16S ribosomal DNA
.
Appl Environ Microbiol
 
68
:
114
123
.
Hopkins
M.J.
Macfarlane
G.T.
Furrie
E.
Fite
A.
Macfarlane
S.
(
2005
)
Characterisation of intestinal bacteria in infant stools using real-time PCR and northern hybridisation analyses
.
FEMS Microbiol Ecol
 
54
:
77
85
.
Huijsdens
X.W.
Linskens
R.K.
Mak
M.
Meuwissen
S.G.
Vandenbroucke-Grauls
C.M.
Savelkoul
P.H.
(
2002
)
Quantification of bacteria adherent to gastrointestinal mucosa by real-time PCR
.
J Clin Microbiol
 
40
:
4423
4427
.
Larsen
N.
Vogensen
F.K.
van den Berg
F.W.
Nielsen
D.S.
Andreasen
A.S.
Pedersen
B.K.
Al-Soud
W.A.
Sørensen
S.J.
Hansen
L.H.
Jakobsen
M.
(
2010
)
Gut microbiota in human adults with type 2 diabetes differs from non-diabetic adults
.
PLoS ONE
 
5
:
e9085
.
Larsen
N.
Vogensen
F.K.
Gobel
R.
Michaelsen
K.F.
Al-Soud
W.A.
Sørensen
S.J.
Hansen
L.H.
Jakobsen
M.
(
2011
)
Predominant genera of fecal microbiota in children with atopic dermatitis are not altered by intake of probiotic bacteria Lactobacillus acidophilus NCFM and Bifidobacterium animalis subsp. lactis Bi-07
.
FEMS Microbiol Ecol
 
75
:
482
496
.
Layton
A.
McKay
L.
Williams
D.
Garrett
V.
Gentry
R.
Sayler
G.
(
2006
)
Development of Bacteroides 16S rRNA gene TaqMan-based real-time PCR assays for estimation of total, human, and bovine fecal pollution in water
.
Appl Environ Microbiol
 
72
:
4214
4224
.
Leser
T.D.
Lindecrona
R.H.
Jensen
T.K.
Jensen
B.B.
Møller
K.
(
2000
)
Changes in bacterial community structure in the colon of pigs fed different experimental diets and after infection with Brachyspira hyodysenteriae
.
Appl Environ Microbiol
 
66
:
3290
3296
.
Ley
R.E.
Backhed
F.
Turnbaugh
P.
Lozupone
C.A.
Knight
R.D.
Gordon
J.I.
(
2005
)
Obesity alters gut microbial ecology
.
P Natl Acad Sci USA
 
102
:
11070
11075
.
Licht
T.R.
Hansen
M.
Poulsen
M.
Dragsted
L.O.
(
2006
)
Dietary carbohydrate source influences molecular fingerprints of the rat faecal microbiota
.
BMC Microbiol
 
6
:
98
.
Liu
C.
Song
Y.
McTeague
M.
Vu
A.W.
Wexler
H.
Finegold
S.M.
(
2003
)
Rapid identification of the species of the Bacteroides fragilis group by multiplex PCR assays using group- and species-specific primers
.
FEMS Microbiol Lett
 
222
:
9
16
.
Lock
E.F.
Ziemiecke
R.
Marron
J.
Dittmer
D.P.
(
2010
)
Efficiency clustering for low-density microarrays and its application to QPCR
.
BMC Bioinformatics
 
11
:
386
.
Madsen
A.L.
Schack-Nielsen
L.
Larnkjaer
A.
Mølgaard
C.
Michaelsen
K.F.
(
2010
)
Determinants of blood glucose and insulin in healthy 9-month-old term Danish infants; the SKOT cohort
.
Diabet Med
 
27
:
1350
1357
.
Matsuda
K.
Tsuji
H.
Asahara
T.
Matsumoto
K.
Takada
T.
Nomoto
K.
(
2009
)
Establishment of an analytical system for the human fecal microbiota, based on reverse transcription-quantitative PCR targeting of multicopy rRNA molecules
.
Appl Environ Microbiol
 
75
:
1961
1969
.
Matsuki
T.
Watanabe
K.
Tanaka
R.
Oyaizu
H.
(
1998
)
Rapid identification of human intestinal bifidobacteria by 16S rRNA-targeted species- and group-specific primers
.
FEMS Microbiol Lett
 
167
:
113
121
.
Matsuki
T.
Watanabe
K.
Fujimoto
J.
Miyamoto
Y.
Takada
T.
Matsumoto
K.
Oyaizu
H.
Tanaka
R.
(
2002
)
Development of 16S rRNA-gene-targeted group-specific primers for the detection and identification of predominant bacteria in human feces
.
Appl Environ Microbiol
 
68
:
5445
5451
.
Matsuki
T.
Watanabe
K.
Fujimoto
J.
Takada
T.
Tanaka
R.
(
2004
)
Use of 16S rRNA gene-targeted group-specific primers for real-time PCR analysis of predominant bacteria in human feces
.
Appl Environ Microbiol
 
70
:
7220
7228
.
McCartney
A.L.
(
2002
)
Application of molecular biological methods for studying probiotics and the gut flora
.
Br J Nutr
 
88
:
S29
S37
.
Penders
J.
Vink
C.
Driessen
C.
London
N.
Thijs
C.
Stobberingh
E.E.
(
2005
)
Quantification of Bifidobacterium spp., Escherichia coli and Clostridium difficile in faecal samples of breast-fed and formula-fed infants by real-time PCR
.
FEMS Microbiol Lett
 
243
:
141
147
.
Petersen
A.
Bergström
A.
Andersen
J.B.
Hansen
M.
Lahtinen
S.J.
Wilcks
A.
Licht
T.R.
(
2010
)
Analysis of the intestinal microbiota of oligosaccharide fed mice exhibiting reduced resistance to Salmonella infection
.
Benef Microbes
 
1
:
271
281
.
Petrosino
J.F.
Highlander
S.
Luna
R.A.
Gibbs
R.A.
Versalovic
J.
(
2009
)
Metagenomic pyrosequencing and microbial identification
.
Clin Chem
 
55
:
856
866
.
Ramakers
C.
Ruijter
J.M.
Deprez
R.H.
Moorman
A.F.
(
2003
)
Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data
.
Neurosci Lett
 
339
:
62
66
.
Ramirez-Farias
C.
Slezak
K.
Fuller
Z.
Duncan
A.
Holtrop
G.
Louis
P.
(
2009
)
Effect of inulin on the human gut microbiota: stimulation of Bifidobacterium adolescentis and Faecalibacterium prausnitzii
.
Br J Nutr
 
101
:
541
550
.
Rinne
M.M.
Gueimonde
M.
Kalliomaki
M.
Hoppu
U.
Salminen
S.J.
Isolauri
E.
(
2005
)
Similar bifidogenic effects of prebiotic-supplemented partially hydrolyzed infant formula and breastfeeding on infant gut microbiota
.
FEMS Immunol Med Microbiol
 
43
:
59
65
.
Rinttila
T.
Kassinen
A.
Malinen
E.
Krogius
L.
Palva
A.
(
2004
)
Development of an extensive set of 16S rDNA-targeted primers for quantification of pathogenic and indigenous bacteria in faecal samples by real-time PCR
.
J Appl Microbiol
 
97
:
1166
1177
.
Roger
L.C.
Costabile
A.
Holland
D.T.
Hoyles
L.
McCartney
A.L.
(
2010
)
Examination of faecal Bifidobacterium populations in breast- and formula-fed infants during the first 18 months of life
.
Microbiology
 
156
:
3329
3341
.
Ruijter
J.M.
Ramakers
C.
Hoogaars
W.M.
Karlen
Y.
Bakker
O.
van den Hoff
M.J.
Moorman
A.F.
(
2009
)
Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data
.
Nucleic Acids Res
 
37
:
e45
.
Turnbaugh
P.J.
Hamady
M.
Yatsunenko
T.
et al
. (
2009
)
A core gut microbiome in obese and lean twins
.
Nature
 
457
:
480
484
.
Vigsnæs
L.K.
Brynskov
J.
Steenholdt
C.
Wilcks
A.
Licht
T.R.
(
2012
)
Gram-negative bacteria account for main differences between faecal microbiota from patients with ulcerative colitis and healthy controls
.
Benef Microbes
 
11
:
11
21
.
Vigsnæs
L.K.
Holck
J.
Meyer
A.S.
Licht
T.R.
(
2011
)
In vitro fermentation of sugar beet arabino-oligosaccharides by fecal microbiota obtained from patients with ulcerative colitis to selectively stimulate the growth of Bifidobacterium spp. and Lactobacillus spp
.
Appl Environ Microbiol
 
77
:
8336
8344
.
Wagner
M.
Smidt
H.
Loy
A.
Zhou
J.
(
2007
)
Unravelling microbial communities with DNA-microarrays: challenges and future directions
.
Microb Ecol
 
53
:
498
506
.
Walter
J.
Tannock
G.W.
Tilsala-Timisjarvi
A.
Rodtong
S.
Loach
D.M.
Munro
K.
Alatossava
T.
(
2000
)
Detection and identification of gastrointestinal Lactobacillus species by using denaturing gradient gel electrophoresis and species-specific PCR primers
.
Appl Environ Microbiol
 
66
:
297
303
.
Walter
J.
Hertel
C.
Tannock
G.W.
Lis
C.M.
Munro
K.
Hammes
W.P.
(
2001
)
Detection of Lactobacillus, Pediococcus, Leuconostoc, and Weissella species in human feces by using group-specific PCR primers and denaturing gradient gel electrophoresis
.
Appl Environ Microbiol
 
67
:
2578
2585
.
Wang
R.F.
Cao
W.W.
Cerniglia
C.E.
(
1996
)
PCR detection and quantitation of predominant anaerobic bacteria in human and animal fecal samples
.
Appl Environ Microbiol
 
62
:
1242
1247
.
Zoetendal
E.G.
Akkermans
A.D.
de Vos
W.M.
(
1998
)
Temperature gradient gel electrophoresis analysis of 16S rRNA from human fecal samples reveals stable and host-specific communities of active bacteria
.
Appl Environ Microbiol
 
64
:
3854
3859
.
Zoetendal
E.G.
Vaughan
E.E.
de Vos
W.M.
(
2006
)
A microbial world within us
.
Mol Microbiol
 
59
:
1639
1650
.