Abstract

The satA gene encoding streptogramin A resistance was detected in virginiamycin-resistant Enterococcus faecium isolates from pigs and broilers. The satA gene was present in 22 of 89 (25%) virginiamycin-resistant E. faecium isolates. It was shown that the satA gene and other gene(s) encoding streptogramin resistance could be transferred between isogenic E. faecium strains at frequencies ranging from 2.3×10−4 to 2.2×10−3 transconjugants per donor.

Introduction

Streptogramins are a group of cyclic peptides produced by Streptomyces spp. as a mixture of components classified into two groups: streptogramin A and streptogramin B [1]. Compounds of group A (SgA), including streptogramin A, pristinamycin IIA and virginiamycin M, are polyunsaturated cyclic peptolides. Compounds of group B (SgB), which includes streptogramin B, pristinamycin IB and virginiamycin S, are cyclic hexapeptides. In clinical practice, the A and B streptogramins are administered in combination because they act synergistically [1]. Natural mixtures of streptogramins have been available on the European market since the mid-fifties, and products like pristinamycin and staphylomycin have been used as oral antistaphylococcal agents for human infections [1]. A semisynthetic injectable streptogramin quinupristin/dalfopristin RP59500 (Synercid) has been under development, and Synercid and pristinamycin have recently been used for treatment of vancomycin-resistant Enterococcus faecium[2–4] and methicillin-resistant Staphylococcus aureus in humans [5].

In 1975 the first staphylococci resistant to a mixture of A and B components were observed in France [6]. Since then, four different genes encoding resistance to the A compounds, vga[7], vgaB[8], vat[9], and vatB[10], and one gene which inactivates the B compounds, vgb[11], have been detected on plasmids isolated from staphylococci.

Resistance to the streptogramin A group was observed in a human E. faecium strain in 1984. In this strain a new gene, satA, located on a plasmid was detected [12]. Recently the vgb gene has also been detected in a human E. faecium strain [13].

In contrast to humans, where streptogramins have only been used rarely, another streptogramin product, virginiamycin, has been widely used as a growth promoter for broilers, pigs and cattle in Europe. In Denmark, streptogramins have never been approved for human therapy, but virginiamycin has been used for animals for decades (58.696 kg active compound from 1989 to 1997), and occurrence of resistance to virginiamycin has frequently been observed among E. faecium isolates from Danish food-producing animals [14]. In this study, the presence of the satA gene among virginiamycin-resistant E. faecium isolates from pigs and broilers is described. Furthermore, the transferability of the satA gene and of unknown gene(s) is described.

Materials and methods

Bacterial isolates

The virginiamycin-resistant E. faecium isolates were collected from October 1995 to December 1996 [14]. A total of 89 isolates from broilers (48) and pigs (41) were investigated. The isolates were recovered from the intestinal contents collected at the slaughterhouse. Only one isolate per animal was included. All isolates had MICs ≥4 μg ml−1 to virginiamycin and were identified as E. faecium according to Devriese et al. [15].

E. faecium BM4145 [12], E. faecalis ATCC 29212 and S. aureus ATCC 29213 were used as quality control strains in the antimicrobial susceptibility testing. E. faecium BM4145 [12], S. aureus BM3093 and S. aureus BM12235 were used as positive controls for the PCR. E. faecium BM4105-RF and E. faecium BM4105-Str [16] were used as recipients for the conjugative transfer.

Antimicrobial susceptibility

The MICs of pristinamycin IIA RP74502 (Rhône-Poulenc Rorer, Vitry sur Seine Cedex, France) and virginiamycin (Pfizer, Rixensat, Belgium) were determined on freshly made Mueller-Hinton II agar (Mueller-Hinton II; Becton Dickinson Microbiology System, Cockeyville, MD) following NCCLS guidelines [17]. The concentrations of virginiamycin were from 0.06 to 32 μg ml−1 and of pristinamycin IIA from 0.25 to 256 μg ml−1.

Polymerase chain reaction and DNA sequencing

DNA extractions, PCR amplification and DNA sequencing were performed according to Sandvang et al. [18]. The primers are shown in Table 1. SUPER-TAQ (HT Biotechnology, Cambridge, UK) was used as DNA polymerase. E. faecium BM4145, S. aureus BM3093 and S. aureus BM12235 were used as positive controls. All isolates were investigated for the presence of satA with PCR. Two amplicons were sequenced. Six isolates were PCR-negative for the presence of satA were investigated for the presence of vat, vatB, vga, vgaB and vgb.

1

Primers used for identification of all know genes encoding streptogramin resistance

Primer Sequence (5′–3′) Position Accession number 
satA-1 GCTCAATAGGACCAGGTGTA 200–219 L12033 
satA-2-B TCCAGCTAACATGTATGGCG 471–452 L12033 
vga-1 AGTGGTGGTGAAGTAACACG 241–260 M90056 
vga-2 CTTGTCTCCTCCGCGAATAC 900–881 M90056 
vgaB-1 TGACAATATGAGTGGTGGTG 990–1009 U82085 
vgaB-2 GCGACCATGAAATTGCTCTC 1566–1547 U82085 
vgb-1 TACAGAGTACCCACTACCGA 141–160 M36022 
vgb-2 TCAATTCCTGCTCCAGCAGT 710–691 M36022 
vat-1 TGGAGTGTGACAAGATAGGC 200–219 L07778 
vat-2 GTGACAACAGCTTCTGCAGC 712–693 L07778 
vatB-1 GGCCCTGATCCAAATAGCAT 10–29 U19459 L38809 
vatB-2 GTGCTGACCAATCCCACCAT 568–549 U19459 L38809 
Primer Sequence (5′–3′) Position Accession number 
satA-1 GCTCAATAGGACCAGGTGTA 200–219 L12033 
satA-2-B TCCAGCTAACATGTATGGCG 471–452 L12033 
vga-1 AGTGGTGGTGAAGTAACACG 241–260 M90056 
vga-2 CTTGTCTCCTCCGCGAATAC 900–881 M90056 
vgaB-1 TGACAATATGAGTGGTGGTG 990–1009 U82085 
vgaB-2 GCGACCATGAAATTGCTCTC 1566–1547 U82085 
vgb-1 TACAGAGTACCCACTACCGA 141–160 M36022 
vgb-2 TCAATTCCTGCTCCAGCAGT 710–691 M36022 
vat-1 TGGAGTGTGACAAGATAGGC 200–219 L07778 
vat-2 GTGACAACAGCTTCTGCAGC 712–693 L07778 
vatB-1 GGCCCTGATCCAAATAGCAT 10–29 U19459 L38809 
vatB-2 GTGCTGACCAATCCCACCAT 568–549 U19459 L38809 

Filter mating

Eight isolates of E. faecium containing the satA gene and six isolates containing unknown streptogramin resistance gene(s) were chosen as donors for conjugation experiments.

Conjugation was performed using the filter mating procedure as described by Clewell et al. [19]. One vol. of a log-phase donor culture was mixed with 9 vols. of a similarly prepared recipient culture. The mixed culture (200 μl) was dispensed onto a 47-mm sterile filter (0.2 μm, MFS, California, USA) that had been placed on a bovine blood agar plate. After allowing the mixed culture to ‘dry’ into the filter, the plate was incubated at 37°C. Transferability was determined after 24 h incubation placing the filter in 10 ml 0.9% saline, suspending the culture by vortex mixing, and plating on selective media (1000 μg ml−1 streptomycin and 2 μg ml−1 virginiamycin) or (25 μg ml−1 fusidin, 25 μg ml−1 rifampin and 2 μg ml−1 virginiamycin) according to the recipient.

The resistance genes were first transferred to E. faecium BM4105-RF. Later, the transfer efficiencies were measured in a conjugation experiment from E. faecium BM4105-RF to E. faecium BM4105-Str for two of the satA-positive strains and three of the strains with an unknown gene(s).

Plasmid profiling and pulsed field gel electrophoresis

The plasmid profiles of transconjugants and donors were prepared according to the method described by Anderson and McKay [20]. A digoxigenin-labeled DNA probe for satA (271 bp) was prepared by PCR amplification using the primers described in Table 1 and was subsequently labeled with the Boehringer Mannheim DNA labeling and detection kit. The obtained PCR product was purified by using Qiagen (Hilden, Germany) spin columns.

The satA-positive strains were hybridized with the satA probe. Pulsed field gel electrophoresis (PFGE) of the donors and transconjugants was performed according to Jensen et al. [21].

Results and discussion

The MICs of virginiamycin for the 89 isolates are shown in Table 2. All the virginiamycin (mixture SgA and SgB)-resistant isolates were also resistant to pristinamycin IIA (SgA) (data not shown). In staphylococci, the same observation, that resistance to a synergetic mixture of SgA and SgB is always associated with resistance to SgA, has been made [22].

2

MICs of virginiamycin for 89 E. faecium isolates from pigs and broilers in Denmark according to the presence of the satA gene

Detection of satA  Distribution of isolates according to the MIC of virginiamycin (μg/ml) (no. of isolates) 
    0.5a 2b 16 32 >32c 
pigs      
 broilers   12  
− pigs    24 
 broilers   
Detection of satA  Distribution of isolates according to the MIC of virginiamycin (μg/ml) (no. of isolates) 
    0.5a 2b 16 32 >32c 
pigs      
 broilers   12  
− pigs    24 
 broilers   

aMIC for S. aureus ATCC 29213.

bMIC for E. faecalis ATCC 29212.

cMIC for E. faecium BM4145.

A sequence identical to satA was detected in 22 of the 89 (25%) virginiamycin-resistant E. faecium isolates originating from pigs and broilers. Two amplicons were sequenced, and the obtained sequences were identical to the published sequence of satA from E. faecium BM4145 (Fig. 1). There was no relationship between the presence or the absence of satA and the levels of resistance to virginiamycin (Table 2) or pristinamycin IIA (data not shown).

1

Comparison of the satA gene and two sequences obtained by PCR. The sequences were identical with the satA gene between the two primers. The primers are reported in bold type.

1

Comparison of the satA gene and two sequences obtained by PCR. The sequences were identical with the satA gene between the two primers. The primers are reported in bold type.

It was possible to transfer plasmids from six of the eight satA-positive strains and five of the six isolates with unknown gene(s) to BM4105-RF (Table 3). All recipients had received plasmids and the satA probe hybridized to all the satA-positive strains (data not shown). The transconjugants and the recipient strains had nearly identical PFGE patterns (two bands difference), indicating that a large plasmid was transferred to the recipient strains (Fig. 2).

3

Conjugation of virginiamycin resistance from 14 resistant E. faecium isolates to a sensitive recipient (BM4105-RF)

Donor satA Recipient Transfer possiblea 
S9508038-2 (pAH2) − E. faecium BM4105-RF 
S9508039-1 (pAH3) − E. faecium BM4105-RF − 
S9630193-3 (pAH4) − E. faecium BM4105-RF 
S9630342-3 (pAH5) − E. faecium BM4105-RF 
F9630395-1 (pAH7) − E. faecium BM4105-RF 
F9631080-1 (pAH9) − E. faecium BM4105-RF 
BM4145 (pIP815) E. faecium BM4105-RF 
S9631101-1 (pAH12) E. faecium BM4105-RF − 
F9630230-1 (pAH13) E. faecium BM4105-RF 
F9508106-1 (pAH14) E. faecium BM4105-RF − 
F9631160-1 (pAH15) E. faecium BM4105-RF 
F9631247-1 (pAH16) E. faecium BM4105-RF 
S9631095-1 (pAH17) E. faecium BM4105-RF 
S9630370-1 (pAH18) E. faecium BM4105-RF 
Donor satA Recipient Transfer possiblea 
S9508038-2 (pAH2) − E. faecium BM4105-RF 
S9508039-1 (pAH3) − E. faecium BM4105-RF − 
S9630193-3 (pAH4) − E. faecium BM4105-RF 
S9630342-3 (pAH5) − E. faecium BM4105-RF 
F9630395-1 (pAH7) − E. faecium BM4105-RF 
F9631080-1 (pAH9) − E. faecium BM4105-RF 
BM4145 (pIP815) E. faecium BM4105-RF 
S9631101-1 (pAH12) E. faecium BM4105-RF − 
F9630230-1 (pAH13) E. faecium BM4105-RF 
F9508106-1 (pAH14) E. faecium BM4105-RF − 
F9631160-1 (pAH15) E. faecium BM4105-RF 
F9631247-1 (pAH16) E. faecium BM4105-RF 
S9631095-1 (pAH17) E. faecium BM4105-RF 
S9630370-1 (pAH18) E. faecium BM4105-RF 

aConjugation was done by filter mating as described in the text. Antibiotic selection (μg/ml): rifampin, 25; fusidin, 25; virginiamycin, 2.

2

CHEF electrophoresis of SmaI digested DNA from recipients, transconjugants and donors; lane 2–3 recipients, BM4105-Str, BM4105-RF; lane 4–8 transconjugants, BM4105-RF (pAH4), BM4105-RF (pAH7), BM4105-RF (pAH9), BM4105-RF (pAH15), BM4105-RF (pAH16); Lane 9–13 donors, S9630193-3 (pAH4), F9630395-1 (pAH7), F9631080-1 (pAH9), F9631160-1 (pAH15), F9631247-1 (pAH16). Lanes 1 and 14, Lambda ladder used as molecular size markers. Size of markers is 339, 291, 242, 194, 145, 97, 48.5 bp.

2

CHEF electrophoresis of SmaI digested DNA from recipients, transconjugants and donors; lane 2–3 recipients, BM4105-Str, BM4105-RF; lane 4–8 transconjugants, BM4105-RF (pAH4), BM4105-RF (pAH7), BM4105-RF (pAH9), BM4105-RF (pAH15), BM4105-RF (pAH16); Lane 9–13 donors, S9630193-3 (pAH4), F9630395-1 (pAH7), F9631080-1 (pAH9), F9631160-1 (pAH15), F9631247-1 (pAH16). Lanes 1 and 14, Lambda ladder used as molecular size markers. Size of markers is 339, 291, 242, 194, 145, 97, 48.5 bp.

The transfer frequency ranged from 2.3×10−4 to 2.2×10−3 transconjugants per donor (Table 4). The transfer frequencies are relatively high and further studies may show if it is a sex pheromones mating response as has been observed in many E. faecalis and a few E. faecium strains [23]. In vitro transfer of streptogramin resistance has previously been observed [24]. This suggests that both known and unknown genes encoding streptogramin resistance can spread horizontally to sensitive E. faecium isolates.

4

Transfer frequencies of plasmids carrying virginiamycin resistance between E. faecium BM4105 isolates

Donor Recipient Transfer frequencya 
E. faecium BM4105-RF (pAH5) E. faecium BM4105-Str 3.2×10−4 
E. faecium BM4105-RF (pAH7) E. faecium BM4105-Str 6.9×10−4 
E. faecium BM4105-RF (pAH9) E. faecium BM4105-Str 3.3×10−4 
E. faecium BM4105-RF (pAH13) E. faecium BM4105-Str 2.2×10−3 
E. faecium BM4105-RF (pAH15) E. faecium BM4105-Str 2.3×10−4 
Donor Recipient Transfer frequencya 
E. faecium BM4105-RF (pAH5) E. faecium BM4105-Str 3.2×10−4 
E. faecium BM4105-RF (pAH7) E. faecium BM4105-Str 6.9×10−4 
E. faecium BM4105-RF (pAH9) E. faecium BM4105-Str 3.3×10−4 
E. faecium BM4105-RF (pAH13) E. faecium BM4105-Str 2.2×10−3 
E. faecium BM4105-RF (pAH15) E. faecium BM4105-Str 2.3×10−4 

aTransfer frequencies, expressed as the number of transconjugants per donor CFU after mating, are means of three independent experiments and were reproducible within one order of magnitude. Antibiotic selection (μg/ml): streptomycin, 1000; virginiamycin, 2.

In the majority of the virginiamycin/pristinamycin IIA-resistant isolates, satA was not detected, but it was possible to transfer resistance to a sensitive E. faecium strain. These isolates were all PCR negative to vat, vatB, vga, vgaB, vgb. This indicates that another streptogramin A resistance gene(s) is present in E. faecium.

The present study showed that virginiamycin-resistant E. faecium isolates from pigs and broilers contained the satA gene and another not yet identified gene(s), conferring resistance to virginiamycin and pristinamycin IIA. Both types of resistance were shown to be transferable.

Acknowledgements

This study is a part of the Danish Integrated Antimicrobial Resistance Monitoring and Research Program (DANMAP) conducted in collaboration between Statens Serum Institut, the Danish Veterinary and Food Administration and the Danish Veterinary Laboratory, and funded jointly by the Danish Ministry of Health and the Danish Ministry of Food, Agriculture and Fisheries. We would like to acknowledge the following persons for their technical assistance: René Hendriksen, Lissie Kjær Jensen, Karina Absalonsen, Mette Juul, Anne Lykkegaard Lauritsen and Christina Aaby Svendsen. We are grateful to Professor P. Courvalin and Professor R. Leclercq for sending BM4145, to Dr. Claire Poyart and Dr. Patrick Trieu-Cout for sending E. faecium BM4105-RF and E. faecium BM4105-Str and to Dr. Nevine El Sohl for sending S. aureus BM3093 and S. aureus BM12235.

References

1
Cocito
C.
(
1979
)
Antibiotics of the virginiamycin family, inhibitors which contain synergistic components
.
Microbiol. Rev.
 
43
,
145
198
.
2
Dever
L.L.
Smith
S.M.
Dejesus
D.
Masurekar
M.
Patel
D.
Kaminski
Z.C.
Johanson
J.W.G.
(
1996
)
Treatment of vancomycin-resistant Enterococcus faecium infections with an inverstigational streptogramin antibiotic (quinupristin/dalfopristin): a report of fifteen cases
.
Microb. Drug Resist.
 
2
,
407
413
.
3
Sahgal
V.S.
Urban
C.
Mariano
N.
Weinbaum
F.
Turner
J.
Rahal
J.J.
(
1995
)
Quinupristin/dalfopristin (RP 59500) therapy for vancomycin-resistant Enterococcus faecium aortic graft infection: case report
.
Microb. Drug Resist.
 
1
,
245
247
.
4
Wade
J.
Baillie
L.
Rolando
N.
Casewell
M.
(
1992
)
Pristinamycin for Enterococcus faecium resistant to vancomycin and gentamicin (letter)
.
Lancet
 
339
,
312
313
.
5
Torralba
M.D.
Frey
S.E.
Lagging
L.M.
(
1995
)
Treatment of methicillin-resistant Staphylococcus aureus infection with quinupristin/dalfopristin (letter)
.
Clin. Infect. Dis.
 
21
,
460
461
.
6
El Solh
N.
Fouace
J.M.
Shalita
Z.
Bouanchaud
D.H.
Novick
R.P.
Chabbert
Y.A.
(
1980
)
Epidemiological and structural studies of Staphylococcus aureus R plasmids mediating resistance to tobramycin and streptogramin
.
Plasmid
 
4
,
117
120
.
7
Allignet
J.
Loncle
V.
El Solh
N.
(
1992
)
Sequence of a staphylococcal plasmid gene, vga, encoding a putative ATP-binding protein involved in resistance to virginiamycin A-like antibiotics
.
Gene
 
117
,
45
51
.
8
Allignet
J.
El Sohl
N.
(
1997
)
Characterization of a new gene, vgaB, encoding a putative ABC transporter conferring resistance to streptogramin A and related compounds
.
Gene
 
202
,
133
138
.
9
Allignet
J.
Loncle
V.
Simenel
C.
Delepierre
M.
El Solh
N.
(
1993
)
Sequence of a staphylococcal gene, vat, encoding an acetyltransferase inactivating the A-type compounds of virginiamycin-like antibiotics
.
Gene
 
130
,
91
98
.
10
Allignet
J.
El Solh
N.
(
1995
)
Diversity among the gram-positive acetyltransferases inactivating streptogramin A and structurally related compounds and characterization of a new staphylococcal determinant, vatB
.
Antimicrob. Agents Chemother.
 
39
,
2027
2036
.
11
Allignet
J.
Loncle
V.
Mazodier
P.
El Solh
N.
(
1988
)
Nucleotide sequence of a staphylococcal plasmid gene, vgb, encoding a hydrolase inactivating the B components of virginiamycin-like antibiotics
.
Plasmid
 
20
,
271
275
.
12
Rende-Fournier
R.
Leclercq
R.
Galimand
M.
Duval
J.
Courvalin
P.
(
1993
)
Identification of the satA gene encoding a streptogramin A acetyltransferase in Enterococcus faecium BM4145
.
Antimicrob. Agents Chemother.
 
37
,
2119
2125
.
13
Bozdogan
B.
Leclercq
R.
(
1997
)
Intrinsic and acquired resistance to dalfopristin (streptogramin A) in Enterococcus spp
. In:
Program and Abstracts of the 37th Interscience Conference on Antimicrobial Agents and Chemotherapy, abstr. C-79
 , pp.
59
60
.
American Society for Microbiology
,
Toronto, Canada
.
14
Aarestrup
F.M.
Bager
F.
Jensen
N.E.
Madsen
M.
Meyling
A.
Wegener
H.C.
(
1998
)
Surveillance to antimicrobial resistance in bacteria isolated from food animals to antimicrobial growth promoters and related therapeutic agents in Denmark
.
APMIS
 
106
,
606
622
.
15
Devriese
L.A.
Pot
B.
Collins
M.D.
(
1993
)
Phenotypic identification of the genus Enterococcus and differentiation of phylogenetically distinct enterococcal species and species groups
.
J. Appl. Bacteriol.
 
75
,
399
408
.
16
Poyart
C.
Trieu-Cuot
P.
(
1994
)
Heterogeneric conjugal transfer of the pheromone-responsive plasmid pIP964 (IncHlyI) of Enterococcus faecalis in the apparent absence of pheromone induction
.
FEMS Microbiol. Lett.
 
122
,
173
180
.
17
National Committee for Clinical Laboratory Standards
(
1997
)
Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically-fourth edition; approved standard M7-A4
 .
National Committee for Laboratory Standards
,
Villanova, PA
.
18
Sandvang
D.
Aarestrup
F.M.
Jensen
L.B.
(
1997
)
Characterization of integrons and antibiotic resistance genes in Danish multiresistant Salmonella enterica Typhimurium DT104
.
FEMS Microbiol. Lett.
 
157
,
177
181
.
19
Clewell
D.B.
An
F.Y.
White
B.A.
Gawron-Burke
C.
(
1985
)
Streptococcus faecalis sex pheromone (cAM373) also produced by Staphylococcus aureus and identification of a conjugative transposon (Tn918)
.
J. Bacteriol.
 
162
,
1212
1220
.
20
Anderson
D.G.
McKay
L.L.
(
1983
)
Simple and rapid method for isolating large plasmid DNA from lactic streptococci
.
Appl. Env. Microbiol.
 
46
,
549
552
.
21
Jensen
L.B.
Ahrens
P.
Dons
L.
Jones
R.N.
Hammerum
A.M.
Aarestrup
F.M.
(
1998
)
Molecular analysis of Tn1546 in Enterococcus faecium isolated from animals and humans
.
J. Clin. Microbiol.
 
36
,
437
442
.
22
Allignet
J.
Aubert
S.
Morvan
A.
El Sohl
N.
(
1996
)
Distribution of genes encoding resistance to streptogramin A and related compounds among the staphylococci resistant to these antibiotics
.
Antimicrob. Agents Chemother.
 
40
,
2523
2528
.
23
Clewell
D.B.
(
1993
)
Sex pheromones and the plasmid-encoded mating response in Enterococcus faecalis
. In:
Bacterial Conjugation
  (
Clewell
D.B.
, Ed.), pp.
349
368
.
Plenum Press
,
New York
.
24
Woodford
N.
Palepou
M.-F.
Johnson
A.P.
Chadwich
P.R.
Bates
J.
(
1997
)
Methicillin-resistant Staphylococcus aureus and vancomycin-resistant enterococci
.
Lancet
 
350
,
737
738
.