Abstract

Two PCR primer pairs specific for Helminthosporium solani, which causes silver scurf on potato tubers, were designed from nucleotide sequences of the nuclear ribosomal internal transcribed spacer regions of H. solani. Both primer pairs amplified a single product with DNA from 48 North American and European isolates of H. solani, but not with DNA from 42 other fungi. Primers also amplified a single product with DNA extracted from silver scurf lesions on potato tubers and other plant tissue inoculated with spores of H. solani. Detection of the fungus in infested soil was only possible with nested PCR and after processing soil with a bead beater. Specific amplification of H. solani DNA can be used to study the saprophytic and pathogenic activity of this fungus in soil and plant tissue.

1 Introduction

Helminthosporium solani Dur. and Mont. causes silver scurf, a disease of the potato tuber periderm. Infected tubers develop tan to gray lesions that are often clustered at the stolon end of the tuber. Tuber infection can occur during the growing season or during storage [3, 4, 13]. At present, no effective disease control strategies are available for silver scurf and economic losses are significant [10].

Knowledge of the biology and ecology of disease-causing microbes is a prerequisite for the development of effective, long-lasting disease management strategies. Unfortunately, little is known about the biology and ecology of H. solani, a very slow-growing pathogen that has been isolated only from sporulating potato periderm lesions. The teleomorph of H. solani has not been discovered and its phylogenetic position is uncertain. Plant pathogens formerly grouped in the genus Helminthosporium are mainly pathogens of grasses (e.g. Cochliobolus, Setosphaeria). In contrast, H. solani has been described only as a pathogen of the potato tuber periderm; it does not colonize other tissues of the potato plant and is not reported to have other hosts [3].

Molecular markers can be very helpful in providing information on the ecology and phylogeny of microorganisms. Internal transcribed spacer (ITS1 and ITS2) regions within ribosomal gene clusters are particularly useful for the design of species-specific PCR primers [6, 18]. However, PCR amplification of microbial DNA directly from soil is not trivial, due to the presence of PCR inhibitors in the soil. It is especially difficult if the goal is amplification from fungal dissemination propagules, which are often protected by thick-walled cells. Of the great number of protocols available for DNA extractions from soil, most are time consuming [5, 12, 14] and few are optimized for recalcitrant fungal propagules (e.g. [17]). It was the objective of this study to develop PCR primers specific for H. solani from unique ITS sequences of this fungus and to use them for detection of this fungus in soil and plant tissue.

2 Materials and methods

2.1 Culture preparation and PCR methods

Six isolates of H. solani (3-SS5, 12-SS2, 17-SS8, HSND23, HSWS04, YG21A) were grown in minimal medium (2.5 g MgSO4·7H2O, 2.7 g KH2PO4, 10 g sucrose, 1 g peptone, 1 g yeast extract in 1 l H2O) for 2 weeks on a rotary shaker. DNA was extracted according to a procedure by Milgroom et al. [9], precipitated with 20% PEG 8000 containing 2.5 M NaCl at 4°C overnight and quantified fluorometrically. PCR amplifications were performed in 50-μl reactions in a TouchDown thermal cycler (Hybaid). DNA (40 ng) was amplified with 100 nM each of the universal primers ITS5 and ITS4 [18], 0.5 units AmpliTaq? DNA polymerase, 200 nM dNTP, 1.5 mM MgCl2 in 1×PCR buffer II (Perkin Elmer) with the following program: 120 s at 94°C initial denaturation; 60 s at 94°C, 60 s at 62°C, 120 s at 72°C (30 cycles); 10 min at 72°C final extension. The amplified product was separated by electrophoresis on a 2% agarose gel in 1×TAE buffer (40 mM Tris-acetate, 1 mM EDTA, pH 8.0), stained with ethidium bromide and visualized under UV light [15]. PCR products were purified using the Qiaquick PCR purification kit (Qiagen) and directly sequenced with primers ITS5 and ITS4 using an ABI fluorescent automated sequencer. The PCR-amplified fragments containing ITS regions 1 and 2 and the 5.8S rDNA were sequenced three times for all six isolates of H. solani. Sequences were aligned using the DNASTAR software package (DNASTAR Inc.) and subjected to a database search (GenBank, release 98.0), using both the BLAST and FASTA programs. The GenBank Accession numbers for nucleotide sequences of ITS regions and 5.8S rDNA of the six H. solani strains are: AF073907 (3-SS5), AF073908 (12-SS2), AF073911 (17-SS8), AF073904 (HSND23), AF073909 (HSWS04), AF073910 (HSYG21A).

2.2 Design of H. solani-specific primers

Oligonucleotide primers (HSF120: TCCCTTAAACCCTTGTATCTGAAG, HSR465: TGGTCCACCAGGGCTTCAAGAAG, HSF19: AAGGACATTACGTTTCAGCG, HSR447: AGAAGCGCAATGTGCTGCACGAG, listed in 5′ to 3′ direction, HSF120 and HSF19 are forward primers) specific for the ITS regions of H. solani were designed using Primer Select (DNASTAR). Primer pairs HSF120-HSR465 and HSF19-HSR447 (synthesized by IDT) were tested for specificity with total genomic DNA from 48 isolates of H. solani and 43 other fungi in PCR amplifications (Table 1Table 2). To ensure the quality of template DNA, all fungi were also PCR-amplified with universal primers ITS5 and ITS4 and PCR products were visualized on agarose gels as described in Section 2.1. Fungal cultures were grown, DNA isolated, and PCR amplifications performed as described above. PCR products obtained with H. solani DNA strains 19-SS1 and 3-SS5, using both H. solani-specific primer pairs, were sequenced to confirm amplification of the expected product. In addition, amplified ITS regions from two isolates of Helminthosporium velutinum Link ex Fr., the type species of the genus Helminthosporium, were sequenced and compared to ITS regions of H. solani.

1

Isolates of Helminthosporium solani tested in PCR with species-specific primer pairs HSF120-HSR465 and HSF19-HSR447

Isolate of H. solani Origina Isolate of H. solani Origina 
1-SS1 New York 18-SS2N2 New York 
1-SS2 New York 18-SS3N2 New York 
1-SS3 New York 19-SS1 New York 
2-SS1 New York 19-SS3 New York 
2-SS2 New York HSCA01 Californiab 
2-SS3 New York HSCA06 Californiab 
2-SS10 New York HSME26 North Dakota 
2-SS11 New York HSME27 Maine 
2-SS12 New York HSME28 Maine 
3-SS2 New York HSNB16 New Brunswick, Canada 
3-SS5 New York HSND23 North Dakota 
5-SS1 New York HSNK4A British Columbia, Canada 
5-SS-2 New York HSOR10 Oregon 
5-SS3 New York HPR1 Northern Ireland, UKc 
6-SS5 New York HSR1 Northern Ireland, UKc 
7-SS2 New York HSR2 Northern Ireland, UKc 
11-SS4 New York HSR3 Northern Ireland, UKc 
12-SS2 New York HSS1 Northern Ireland, UKc 
13-SS6 New York HSS2 Northern Ireland, UKc 
14-SS1T1 North Dakota HSS4 Northern Ireland, UKc 
15-SS4T2 New York HSS5 Northern Ireland, UKc 
15-SS5T1 New York HSWS04 Wisconsin 
17-SS5T1 Pennsylvania HSWS05 Wisconsin 
17-SS8 Pennsylvania HSYG21A British Columbia, Canada 
Isolate of H. solani Origina Isolate of H. solani Origina 
1-SS1 New York 18-SS2N2 New York 
1-SS2 New York 18-SS3N2 New York 
1-SS3 New York 19-SS1 New York 
2-SS1 New York 19-SS3 New York 
2-SS2 New York HSCA01 Californiab 
2-SS3 New York HSCA06 Californiab 
2-SS10 New York HSME26 North Dakota 
2-SS11 New York HSME27 Maine 
2-SS12 New York HSME28 Maine 
3-SS2 New York HSNB16 New Brunswick, Canada 
3-SS5 New York HSND23 North Dakota 
5-SS1 New York HSNK4A British Columbia, Canada 
5-SS-2 New York HSOR10 Oregon 
5-SS3 New York HPR1 Northern Ireland, UKc 
6-SS5 New York HSR1 Northern Ireland, UKc 
7-SS2 New York HSR2 Northern Ireland, UKc 
11-SS4 New York HSR3 Northern Ireland, UKc 
12-SS2 New York HSS1 Northern Ireland, UKc 
13-SS6 New York HSS2 Northern Ireland, UKc 
14-SS1T1 North Dakota HSS4 Northern Ireland, UKc 
15-SS4T2 New York HSS5 Northern Ireland, UKc 
15-SS5T1 New York HSWS04 Wisconsin 
17-SS5T1 Pennsylvania HSWS05 Wisconsin 
17-SS8 Pennsylvania HSYG21A British Columbia, Canada 

PCR amplification resulted in a single product from each of the isolates.

aOrigin in the US (culture collection of authors), if not listed otherwise.

bIsolates were obtained from M. DeCunha, California, USA.

cDNA samples were obtained from G. McKay, Northern Ireland, UK.

1

Isolates of Helminthosporium solani tested in PCR with species-specific primer pairs HSF120-HSR465 and HSF19-HSR447

Isolate of H. solani Origina Isolate of H. solani Origina 
1-SS1 New York 18-SS2N2 New York 
1-SS2 New York 18-SS3N2 New York 
1-SS3 New York 19-SS1 New York 
2-SS1 New York 19-SS3 New York 
2-SS2 New York HSCA01 Californiab 
2-SS3 New York HSCA06 Californiab 
2-SS10 New York HSME26 North Dakota 
2-SS11 New York HSME27 Maine 
2-SS12 New York HSME28 Maine 
3-SS2 New York HSNB16 New Brunswick, Canada 
3-SS5 New York HSND23 North Dakota 
5-SS1 New York HSNK4A British Columbia, Canada 
5-SS-2 New York HSOR10 Oregon 
5-SS3 New York HPR1 Northern Ireland, UKc 
6-SS5 New York HSR1 Northern Ireland, UKc 
7-SS2 New York HSR2 Northern Ireland, UKc 
11-SS4 New York HSR3 Northern Ireland, UKc 
12-SS2 New York HSS1 Northern Ireland, UKc 
13-SS6 New York HSS2 Northern Ireland, UKc 
14-SS1T1 North Dakota HSS4 Northern Ireland, UKc 
15-SS4T2 New York HSS5 Northern Ireland, UKc 
15-SS5T1 New York HSWS04 Wisconsin 
17-SS5T1 Pennsylvania HSWS05 Wisconsin 
17-SS8 Pennsylvania HSYG21A British Columbia, Canada 
Isolate of H. solani Origina Isolate of H. solani Origina 
1-SS1 New York 18-SS2N2 New York 
1-SS2 New York 18-SS3N2 New York 
1-SS3 New York 19-SS1 New York 
2-SS1 New York 19-SS3 New York 
2-SS2 New York HSCA01 Californiab 
2-SS3 New York HSCA06 Californiab 
2-SS10 New York HSME26 North Dakota 
2-SS11 New York HSME27 Maine 
2-SS12 New York HSME28 Maine 
3-SS2 New York HSNB16 New Brunswick, Canada 
3-SS5 New York HSND23 North Dakota 
5-SS1 New York HSNK4A British Columbia, Canada 
5-SS-2 New York HSOR10 Oregon 
5-SS3 New York HPR1 Northern Ireland, UKc 
6-SS5 New York HSR1 Northern Ireland, UKc 
7-SS2 New York HSR2 Northern Ireland, UKc 
11-SS4 New York HSR3 Northern Ireland, UKc 
12-SS2 New York HSS1 Northern Ireland, UKc 
13-SS6 New York HSS2 Northern Ireland, UKc 
14-SS1T1 North Dakota HSS4 Northern Ireland, UKc 
15-SS4T2 New York HSS5 Northern Ireland, UKc 
15-SS5T1 New York HSWS04 Wisconsin 
17-SS5T1 Pennsylvania HSWS05 Wisconsin 
17-SS8 Pennsylvania HSYG21A British Columbia, Canada 

PCR amplification resulted in a single product from each of the isolates.

aOrigin in the US (culture collection of authors), if not listed otherwise.

bIsolates were obtained from M. DeCunha, California, USA.

cDNA samples were obtained from G. McKay, Northern Ireland, UK.

2

Fungal species tested with PCR to confirm specificity of Helminthosporium solani-specific PCR primers HSF120-HSR465 and HSF19-HSR447a

Alternaria alternata (2) 
Alternaria brassicae 
Alternaria brassicicola (2) 
Alternaria solani (3) 
Bipolaris sorokinia 
Botrytis cinerea 
Cochliobolus heterostrophus (2) 
Colletotrichum coccodes (3) 
Colletotrichum graminicola 
Drechslera tritici-repentis 
Exserohilum turcicum 
Fusarium oxysporum (2) 
Fusarium oxysporum f.sp. lycopersici 
Fusarium roseum 
Fusarium sambucinum (2) 
Fusarium solani (2) 
Helminthosporium anomalum 
Helminthosporium asterinum (2) 
Helminthosporium decacuminatum 
Helminthosporium palmigenum 
Helminthosporium parvum 
Helminthosporium velutinum (2) 
Leptosphaeria maculans 
Magnaporthe grisea 
Mycosphaerella pinodes 
Nectria haematococca 
Ophiostoma ulmi 
Penicillim funiculosum 
Phoma lingam (3) 
Phoma medicaginis 
Phytophthora infestans (2) 
Phytophthora megasperma 
Pythium graminicola 
Pythium heterothallicum 
Pythium sylvaticum 
Pythium ultimum 
Rhizoctonia solani (2) 
Rhizopus stolonifer 
Stagonospora nodorum (2) 
Thielaviopsis basicola 
Verticillium albo-atrum (2) 
Verticillium dahliae (2) 
Verticillium fungicola 
Alternaria alternata (2) 
Alternaria brassicae 
Alternaria brassicicola (2) 
Alternaria solani (3) 
Bipolaris sorokinia 
Botrytis cinerea 
Cochliobolus heterostrophus (2) 
Colletotrichum coccodes (3) 
Colletotrichum graminicola 
Drechslera tritici-repentis 
Exserohilum turcicum 
Fusarium oxysporum (2) 
Fusarium oxysporum f.sp. lycopersici 
Fusarium roseum 
Fusarium sambucinum (2) 
Fusarium solani (2) 
Helminthosporium anomalum 
Helminthosporium asterinum (2) 
Helminthosporium decacuminatum 
Helminthosporium palmigenum 
Helminthosporium parvum 
Helminthosporium velutinum (2) 
Leptosphaeria maculans 
Magnaporthe grisea 
Mycosphaerella pinodes 
Nectria haematococca 
Ophiostoma ulmi 
Penicillim funiculosum 
Phoma lingam (3) 
Phoma medicaginis 
Phytophthora infestans (2) 
Phytophthora megasperma 
Pythium graminicola 
Pythium heterothallicum 
Pythium sylvaticum 
Pythium ultimum 
Rhizoctonia solani (2) 
Rhizopus stolonifer 
Stagonospora nodorum (2) 
Thielaviopsis basicola 
Verticillium albo-atrum (2) 
Verticillium dahliae (2) 
Verticillium fungicola 

aNumbers in parentheses indicate the number of isolates, if more than one isolate was tested. Cultures originated from the author's culture collection, the teaching collection of the Plant Pathology Department at Cornell University, from the American Type Culture Collection in the USA (ATCC), or from the Centraalbureau voor Schimmelcultures, The Netherlands (CBS).

2

Fungal species tested with PCR to confirm specificity of Helminthosporium solani-specific PCR primers HSF120-HSR465 and HSF19-HSR447a

Alternaria alternata (2) 
Alternaria brassicae 
Alternaria brassicicola (2) 
Alternaria solani (3) 
Bipolaris sorokinia 
Botrytis cinerea 
Cochliobolus heterostrophus (2) 
Colletotrichum coccodes (3) 
Colletotrichum graminicola 
Drechslera tritici-repentis 
Exserohilum turcicum 
Fusarium oxysporum (2) 
Fusarium oxysporum f.sp. lycopersici 
Fusarium roseum 
Fusarium sambucinum (2) 
Fusarium solani (2) 
Helminthosporium anomalum 
Helminthosporium asterinum (2) 
Helminthosporium decacuminatum 
Helminthosporium palmigenum 
Helminthosporium parvum 
Helminthosporium velutinum (2) 
Leptosphaeria maculans 
Magnaporthe grisea 
Mycosphaerella pinodes 
Nectria haematococca 
Ophiostoma ulmi 
Penicillim funiculosum 
Phoma lingam (3) 
Phoma medicaginis 
Phytophthora infestans (2) 
Phytophthora megasperma 
Pythium graminicola 
Pythium heterothallicum 
Pythium sylvaticum 
Pythium ultimum 
Rhizoctonia solani (2) 
Rhizopus stolonifer 
Stagonospora nodorum (2) 
Thielaviopsis basicola 
Verticillium albo-atrum (2) 
Verticillium dahliae (2) 
Verticillium fungicola 
Alternaria alternata (2) 
Alternaria brassicae 
Alternaria brassicicola (2) 
Alternaria solani (3) 
Bipolaris sorokinia 
Botrytis cinerea 
Cochliobolus heterostrophus (2) 
Colletotrichum coccodes (3) 
Colletotrichum graminicola 
Drechslera tritici-repentis 
Exserohilum turcicum 
Fusarium oxysporum (2) 
Fusarium oxysporum f.sp. lycopersici 
Fusarium roseum 
Fusarium sambucinum (2) 
Fusarium solani (2) 
Helminthosporium anomalum 
Helminthosporium asterinum (2) 
Helminthosporium decacuminatum 
Helminthosporium palmigenum 
Helminthosporium parvum 
Helminthosporium velutinum (2) 
Leptosphaeria maculans 
Magnaporthe grisea 
Mycosphaerella pinodes 
Nectria haematococca 
Ophiostoma ulmi 
Penicillim funiculosum 
Phoma lingam (3) 
Phoma medicaginis 
Phytophthora infestans (2) 
Phytophthora megasperma 
Pythium graminicola 
Pythium heterothallicum 
Pythium sylvaticum 
Pythium ultimum 
Rhizoctonia solani (2) 
Rhizopus stolonifer 
Stagonospora nodorum (2) 
Thielaviopsis basicola 
Verticillium albo-atrum (2) 
Verticillium dahliae (2) 
Verticillium fungicola 

aNumbers in parentheses indicate the number of isolates, if more than one isolate was tested. Cultures originated from the author's culture collection, the teaching collection of the Plant Pathology Department at Cornell University, from the American Type Culture Collection in the USA (ATCC), or from the Centraalbureau voor Schimmelcultures, The Netherlands (CBS).

2.3 Detection of H. solani in plant tissue

DNA was extracted from the periderm of disease-free potato tubers, tubers infected with H. solani under laboratory conditions, and commercially grown tubers with silver scurf and black dot symptoms (caused by Colletotrichum coccodes (Wallr.) Hughes). Tissue from greenhouse-grown crop plants (alfalfa, barley, buckwheat, corn, Indian mustard, oat, rapeseed, red clover, rye, sorghum, wheat, white mustard) was harvested, surface-sterilized with 70% ethanol for 10 min, and air-dried. From each plant species, 5 g of tissue was inoculated with a washed H. solani spore suspensions (104 spores ml−1) via vacuum-infiltration. DNA was extracted from air-dried, inoculated plant tissue after vacuum-infiltration. In addition, leaves (5 g) from corn, oats and rye were buried in a peat moss-based potting medium (20 g) that was amended with H. solani spore suspensions (104 spores g−1 soil) and incubated at 21°C for 8 weeks. Plant tissue was recovered from soil and air dried. Fifty samples were processed in total, including non-inoculated plant tissue.

DNA was extracted from plant tissue by grinding samples with sea sand in liquid nitrogen followed by extraction with the FastDNA™ SPIN Kit (BIO 101) with a modified protocol. Additional ceramic beads (4 mm diameter) were added to all processing tubes. Plant tissue was prepared in an oscillating bead beater (FastPrep™ instrument, BIO 101) for three cycles at 5.5 m s−1 for 30 s. DNA was subjected to PCR amplification with primer pairs HSF120-HSR465 and HSF19-HSR447; PCR products were visualized as described in Section 2.1(Fig. 2). Amplification of expected PCR products was confirmed by sequencing fragments amplified from 3-SS5 isolated from soil and from H. solani-infected potato tissue.

2

PCR amplification with DNA extracted from plant tissue (upper row) with H. solani-specific primer pairs and from soil (lower row) amplified in nested PCR with primers ITS5-ITS4, followed by amplification with HSF120-HSR465 (lanes 1–13) or HSF19-HSR447 (lanes 14–26). Upper row: lanes 1–13 amplified with HSF120-HSR465 (lanes 1–7 from potato tuber cvs. Katahdin and Superior): lane 1: inoculated with H. solani spore suspensions; lanes 2, 3: naturally infected with H. solani; lanes 4, 5: infected with both H. solani and C. coccodes; lane 6: disease-free; lane 7: infected with C. coccodes only. Lanes 8–10: plants infiltrated with H. solani spore suspensions in the order: rye leaves, sorghum stem, alfalfa leaves; lane 11: corn leaves incubated for 8 weeks at 23°C in soil amended with H. solani spores (104 spores g−1 soil); lanes 12, 13: plant tissue from rye and corn, respectively. Lanes 14–26: samples in the same order as lanes 1–13, but amplified with HSF19-HSR447. Lower row: lanes 1, 14: spore suspension from H. solani 2-SS1; lanes 2, 15: mycelium of H. solani 3-SS5 (1 μg) added to autoclaved soil; lanes 3, 16: mycelium of H. solani 3-SS5 (100 ng) added to autoclaved soil; lanes 4, 17: autoclaved soil with 8000 spores of H. solani 2-SS1; lanes 5, 19: soil only; lanes 6, 20: sandy loam only; lanes 7, 18: sandy loam soil with 8000 spores of H. solani; lanes 8, 21: sandy loam amended with 100 ng mycelium of H. solani 3-SS5; lanes 9–11 and 22–24: three different soil samples from a potato field with a history of silver scurf; lanes 12, 13, 25, 26: soil samples from two different fields not planted with potatoes for at least 6 years.

2

PCR amplification with DNA extracted from plant tissue (upper row) with H. solani-specific primer pairs and from soil (lower row) amplified in nested PCR with primers ITS5-ITS4, followed by amplification with HSF120-HSR465 (lanes 1–13) or HSF19-HSR447 (lanes 14–26). Upper row: lanes 1–13 amplified with HSF120-HSR465 (lanes 1–7 from potato tuber cvs. Katahdin and Superior): lane 1: inoculated with H. solani spore suspensions; lanes 2, 3: naturally infected with H. solani; lanes 4, 5: infected with both H. solani and C. coccodes; lane 6: disease-free; lane 7: infected with C. coccodes only. Lanes 8–10: plants infiltrated with H. solani spore suspensions in the order: rye leaves, sorghum stem, alfalfa leaves; lane 11: corn leaves incubated for 8 weeks at 23°C in soil amended with H. solani spores (104 spores g−1 soil); lanes 12, 13: plant tissue from rye and corn, respectively. Lanes 14–26: samples in the same order as lanes 1–13, but amplified with HSF19-HSR447. Lower row: lanes 1, 14: spore suspension from H. solani 2-SS1; lanes 2, 15: mycelium of H. solani 3-SS5 (1 μg) added to autoclaved soil; lanes 3, 16: mycelium of H. solani 3-SS5 (100 ng) added to autoclaved soil; lanes 4, 17: autoclaved soil with 8000 spores of H. solani 2-SS1; lanes 5, 19: soil only; lanes 6, 20: sandy loam only; lanes 7, 18: sandy loam soil with 8000 spores of H. solani; lanes 8, 21: sandy loam amended with 100 ng mycelium of H. solani 3-SS5; lanes 9–11 and 22–24: three different soil samples from a potato field with a history of silver scurf; lanes 12, 13, 25, 26: soil samples from two different fields not planted with potatoes for at least 6 years.

2.4 Detection of H. solani in soil

Soil samples (500 mg) were amended with 100 ng, 200 ng, 1 μg, or 1 mg lyophilized mycelium or with 500, 8000, or 20000 spores of H. solani (isolates 3-SS5, 14-SS1). Soil samples were collected 2 months after harvest from a potato field with a history of silver scurf, and from two fields that had not been planted with potatoes for at least 6 years. DNA was extracted using the FastDNA™ SPIN Kit for soil (Bio 101) with the following modifications: 900 μl CLS-Y or CLS-TC solution (Bio 101) was added to samples as lysis buffer, incubated for 5 min, centrifuged for 20 min, and 250 μl PPS solution was added to the supernatant before centrifugation for 5 min. For DNA extractions from spores added to soil, additional ceramic beads (6 mm diameter) were added to the tubes for the FastPrep™ processing. Tubes were processed three times in the FastPrep™ instrument (5.5 m s−1 for 30 s). After DNA elution (in 100 μl H2O), samples were diluted 1:20 before further processing. Controls consisted of unamended soil samples and 50 μl of a spore suspension (105 spores ml−1).

Nested PCR was performed with all samples extracted from soil. Three μl of DNA were subjected to PCR amplification with universal primers ITS5 and ITS4 as described in Section 2.1. The resulting PCR product (3 μl) was amplified in a second PCR with primer pairs HSF120-HSR465 or HSF19-HSR447 under the same conditions, but for 35 amplification cycles. PCR products were visualized on agarose gels as described in Section 2.1.

2.5 Southern hybridizations

Southern hybridizations were performed to confirm primer specificity. PCR products (10 μl of each reaction) from amplifications of all isolates of H. solani (Table 1), all other fungi (Table 2) and DNA extractions from plant tissue and soil were separated on 2% agarose gels. Separated products were transferred onto Hybond N+ nylon membranes (Amersham, Little Chalfont, UK) according to the manufacturer's alkaline transfer method, and hybridized to probes consisting of the purified PCR products (H. solani isolate 3-SS5) of either 345 bp amplified with HSF120-HSR465 or 447 bp amplified with HSF19-HSR447. Probes were labeled by random priming (Prime-It II Kit, Stratagene) using [α-32P]dCTP.

3 Results

Single products (including both ITS regions and the 5.8S rDNA) of identical length (530 bp) and sequence were amplified with primers ITS5 and ITS4 from all six isolates of H. solani. Based on this sequence and on ITS sequences available for other fungi, primer pair HSF120-HSR465 was designed that amplified a single product (345 bp) with DNA from all 48 isolates of H. solani (Table 1, Fig. 1). However, this primer pair also amplified a product with DNA from two isolates of H. velutinum, as visualized on ethidium bromide-stained agarose gels; amplification products were not obtained with DNA from other fungi. Southern hybridization confirmed these results. In addition, a weak hybridization signal was detected with one other fungus (Penicillium funiculosum), indicating a low level of amplification. To increase specificity, primer pair HSF19-HSR447 was designed, which amplified a single product (447 bp) from DNA of all H. solani isolates. Primer sequences were chosen based on the ITS sequence of the two isolates of H. velutinum (data not presented). Primer pair HSF19-HSR447 did not amplify from fungi other than H. solani.

1

PCR amplification from genomic DNA with H. solani-specific primer pairs HSF120-HSR465 (lanes 1–13) and HSF19-HSR447 (lanes 14–26). Lanes 1–13 in the upper row show amplification with HSF120-HSR465 from H. solani isolates: 1-SS1, 2: 2-SS12, 3-SS5, 5-SS1, 6-SS5, 11-SS4, 14-SS1T1, 18-SS3-N2, HSME27, HSNK4A, HSOR10, HSWS04, HSYG21A. Lanes 1–13 in the lower row show amplification from H. solani HSWS05, H. velutinum ATCC 38969, H. velutinum CBS 360.75, Alternaria solani, Colletotrichum coccodes, Exserohilum turcicum, Fusarium sambucinum, Fusarium solani, Leptosphaeria maculans, Phoma lingam, Phytophthora infestans, Pythium ultimum, Verticillium dahliae. Lanes 14–26 in both rows show amplification results with the same fungi as lanes 1–13, but tested with primer pair HSF19-HSR447.

1

PCR amplification from genomic DNA with H. solani-specific primer pairs HSF120-HSR465 (lanes 1–13) and HSF19-HSR447 (lanes 14–26). Lanes 1–13 in the upper row show amplification with HSF120-HSR465 from H. solani isolates: 1-SS1, 2: 2-SS12, 3-SS5, 5-SS1, 6-SS5, 11-SS4, 14-SS1T1, 18-SS3-N2, HSME27, HSNK4A, HSOR10, HSWS04, HSYG21A. Lanes 1–13 in the lower row show amplification from H. solani HSWS05, H. velutinum ATCC 38969, H. velutinum CBS 360.75, Alternaria solani, Colletotrichum coccodes, Exserohilum turcicum, Fusarium sambucinum, Fusarium solani, Leptosphaeria maculans, Phoma lingam, Phytophthora infestans, Pythium ultimum, Verticillium dahliae. Lanes 14–26 in both rows show amplification results with the same fungi as lanes 1–13, but tested with primer pair HSF19-HSR447.

DNA extracted from potato periderm collected from tubers with silver scurf symptoms, including tubers with mixed infections of H. solani and C. coccodes, amplified a single product with both specific primer pairs. Extractions from disease-free tubers and tubers with black dot symptoms did not result in a PCR product. DNA extracts from all plant tissue samples that had been vacuum-infiltrated with H. solani spore suspensions resulted in the expected PCR product with both primer pairs, whereas no product was obtained from non-inoculated plant tissue (Fig. 2). Amplification of the correct product was confirmed by sequencing of PCR products from two H. solani-infected plant tissue samples with each primer pair.

Unamended samples from a peat moss-based potting medium and soil samples from a pasture and from crop production fields not planted with potatoes for at least 6 years did not amplify a PCR product in nested PCR with ITS5 and ITS4 followed by amplification with primer pairs HSF120-HSR465 or HSF19-HSR447. Amplification from spore suspensions alone and from soil samples infested with fresh or lyophilized mycelium and spores of H. solani at all densities tested resulted in a single product of the expected size. DNA extracts from soil samples collected from a field with a history of silver scurf also produced the expected fragment with both primer pairs (Fig. 2).

4 Discussion

We evaluated various methods for extraction of H. solani DNA from soil [1, 5, 11, 17], none of which resulted in amplification from conidia of H. solani, which are extremely thick-walled and likely contain phenolic substances that increase their resistance to chemicals. Here we describe a method which allows the rapid extraction of DNA from spores and mycelium of H. solani from soil. This method is suitable for studies requiring extensive soil sampling and could be used for DNA extractions from recalcitrant propagules of other soilborne microorganisms. Successful DNA extraction from H. solani conidia was not possible without the use of the FastPrep™ instrument. The shearing of genomic DNA caused by bead beating with the FastPrep™ instrument is reduced compared to other bead beaters [1] and should not prevent amplification if target DNA fragments are small, such as ribosomal DNA fragments. Dilution of samples (at least 20-fold) prior to PCR was necessary to reduce soil inhibitors, and nested PCR was essential for successful amplification of H. solani from soil. The use of nested PCR improves the sensitivity of the assay by allowing the detection of minute amounts of target DNA [17], even from soil with a high organic matter content.

Detection of H. solani with species-specific primers from nuclear ribosomal ITS regions has several advantages. The presence of multiple copies of ITS regions in the genome allows easier amplification from preparations containing very low concentrations of the target DNA, but large amounts of host DNA, e.g. plant tissue. Recently, design of PCR primers specific for the β-tubulin gene of H. solani was reported; this study identified thiabendazole-resistant isolates of H. solani[8]. Since the β-tubulin gene is likely only present in very few copies in the genome of H. solani, as was shown for other fungi (e.g. [7, 16]), primers based on the sequence of this gene would be less sensitive in detection of the fungus than those based on the multi-copy ribosomal gene cluster. In our study, ITS regions and 5.8S rDNA from H. solani isolates originating from many locations across North America and from Europe had identical nucleotide sequences, indicating that these strains are a homogeneous phylogenetic group and that primers designed from ITS regions should be useful for detection of the fungus regardless of the source of the strain.

Primer pair HSF120-HSR465 amplified a single product (345 bp) from DNA of all isolates of H. solani, but also amplified a product of similar size from both isolates of H. velutinum. We found that the ITS regions and 5.8S rDNA of H. velutinum, the type species of the genus Helminthosporium, are very similar (95% sequence identity) to those of H. solani (data not presented). H. velutinum is a wood saprophyte and has never been reported to occur on potato. However, this fungus is commonly found on woody plants [2]; it is quite plausible that H. velutinum may also be a soil inhabitant and could be problematic in surveys for H. solani. Primer pair HSF19-HSR447, which was designed based on sequence disparities between H. solani and H. velutinum, was specific to H. solani and is therefore appropriate for ecological studies.

Silver scurf and black dot cause lesions of similar appearance on potato [3, 4], and correct identification of the pathogen is time-consuming and dependent on pathogen sporulation. In our study, H. solani was selectively amplified from potato tubers that exhibited silver scurf lesions at the time of harvest or during storage, regardless of the presence of Colletotrichum coccodes. Therefore, these PCR primers can be used to diagnose silver scurf on potatoes at any stage of disease development. Successful amplifications from H. solani spores infiltrated into senescent plant tissue of various species and from sterile plant tissue incubated in H. solani-infested soil demonstrate the usefulness of the primers for studies on saprophytic abilities of H. solani.

Acknowledgements

We thank Dr. Gareth J. McKay for supplying us with H. solani isolates. This study was supported in part by the USDA/ARS Potato Research Grants Program, Agreement No. 58-5442-6-126.

References

1
Borneman
J.
Skroch
P.W.
O'Sullivan
K.M.
Palus
J.A.
Rumjanek
N.G.
Jansen
J.L.
Nienhuis
J.
Triplett
E.W.
(
1996
)
Molecular microbial diversity of an agricultural soil in Wisconsin
.
Appl. Environ. Microbiol.
 
62
,
1935
1943
.
2
Ellis
M.B.
(
1971
)
Helminthosporium velutinum
. In:
Dematiacious Hyphomycetes
 , p.
390
.
Commonwealth Mycological Institute
,
Kew, Surrey
.
3
Jellis
G.J.
Taylor
G.S.
(
1974
)
The relative importance of silver scurf and black dot: two disfiguring diseases of potato tubers
.
ADAS Q. Rev.
 
14
,
97
112
.
4
Jellis
G.J.
Taylor
G.S.
(
1977
)
The development of silver scurf (Helminthosporium solani) disease of potato
.
Ann. Appl. Biol.
 
86
,
19
28
.
5
Johnston
C.G.
Aust
S.D.
(
1994
)
Detection of Phanerochaete chryosporium in soil by PCR and restriction enzyme analysis
.
Appl. Environ. Microbiol.
 
60
,
2350
2354
.
6
Jorgensen
R.A.
Cluster
P.D.
(
1989
)
Modes and tempos in the evolution of nuclear ribosomal DNA: new characters for evolutionary studies and new markers for genetic and population studies
.
Ann. Mo. Bot. Gard.
 
75
,
1238
1247
.
7
Luck
J.E.
Gillins
M.R.
Steel
C.C.
(
1994
)
Amplification and cloning of a beta-tubulin gene fragment from strains of Botrytis cinerea resistant and sensitive to benzimidazole fungicides
.
N.Z. J. Crop Hortic. Sci.
 
22
,
173
179
.
8
McKay
G.J.
Cooke
L.R.
(
1997
)
A PCR-based method to characterise and identify benzimidazole resistance in Helminthosporium solani
.
FEMS Microbiol. Lett.
 
152
,
371
378
.
9
Milgroom
M.G.
Lipari
S.E.
Powell
W.A.
(
1992
)
DNA fingerprinting and analysis of population structure in the chestnut blight fungus, Cryphonectria parasitica
.
Genetics
 
131
,
297
306
.
10
Nolte
P.
Shetty
K.
Patterson
P.
(
1994
)
Understanding and controlling silver scurf of potato
.
The Badger Common'tater
 
1
,
5
12
.
11
Porteous
L.A.
Armstrong
J.L.
Seidler
R.J.
Watrud
L.S.
(
1994
)
An effective method to extract DNA from environmental samples for polymerase chain reaction amplification and DNA fingerprint analysis
.
Curr. Microbiol.
 
29
,
301
307
.
12
Porteous
L.A.
Seidler
R.J.
Watrud
L.S.
(
1997
)
An improved method for purifying DNA from soil for polymerase chain reaction amplification and molecular applications
.
Mol. Ecol.
 
6
,
787
791
.
13
Rodriguez
D.A.
Secor
G.A.
Gudmestad
N.C.
Francl
L.J.
(
1996
)
Sporulation of Helminthosporium solani and infection of potato tubers in seed and commercial storages
.
Plant Dis.
 
80
,
1063
1070
.
14
Saano
A.
Lindström
K.
(
1995
)
Small scale extraction of DNA from soil with spin columns, 1.3.4
. In:
Molecular Microbial Ecology Manual
  (
Akkermans
A.D.L.
Van Elsas
J.D.
De Bruijn
F.J.
, Eds.), pp.
1
6
.
Kluwer Academic
,
Dordrecht
.
15
Sambrook
J.
Fritsch
E.F.
Maniatis
T.
(
1989
)
Molecular Cloning: A Laboratory Manual
 .
Cold Spring Harbor Laboratory Press
,
Cold Spring Harbor, NY
.
16
Smith
H.A.
Allaudeen
H.S.
Whitman
M.H.
Koltin
Y.
Gorman
J.A.
(
1988
)
Isolation and characterization of a beta tubulin gene from Candida albicans
.
Gene
 
63
,
53
63
.
17
Volossiouk
T.
Robb
E.J.
Nazar
R.N.
(
1995
)
Direct DNA extraction for PCR- mediated assays of soil organisms
.
Appl. Environ. Microbiol.
 
61
,
6972
3976
.
18
White
T.J.
Bruns
T.
Lee
S.
Taylor
J.
(
1990
)
Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics
. In:
PCR Protocols: A Guide to Methods and Applications
  (
Innis
M.A.
Gelfand
D.H.
Sninsky
J.J.
White
T.J.
, Eds.), pp.
315
322
.
Academic Press
,
San Diego, CA
.