Abstract

A classification of the different erm gene classes based on published sequences was performed, and specific primers to detect some of these classes designed. The presence of ermA (Tn554), ermB (class IV) and ermC (class VI) was determined by PCR in a total of 113 enterococcal, 77 streptococcal and 68 staphylococcal erythromycin resistant isolates of animal and human origin. At least one of these genes was detected in 88% of the isolates. Four isolates contained more than one erm gene. ermB dominated among the enterococci (88%) and streptococci (90%) and ermC among staphylococci (75%) with ermA (Tn554) present in some isolates (16%). Variations in the presence of the different genes when comparing staphylococcal isolates of human and animal origin were observed.

Introduction

The macrolide tylosin is the most commonly used antimicrobial agent in pig production in Denmark. Recent national surveys have found widespread resistance to macrolides in staphylococci, streptococci and enterococci isolated from pigs in Denmark [1, 2]. Macrolides are used for treatment of humans with erythromycin as first choice also as a substitute for penicillin in cases where patients are allergic to penicillin [3].

Resistance to macrolides is based on different mechanisms: target modification by point mutation or methylation of 23S rRNA inhibiting binding of macrolides so protein synthesis is not interfered with [4], hydrolysis of the lactone ring in the macrolide [5] and efflux pumps removing the antibiotic internally from the bacteria [6–8]. Resistance to macrolides can spread from animals to human, either by spread of the resistant bacteria or by horizontal gene transfer of mobile DNA elements. To determine whether a horizontal spread of resistance has occurred, a characterization of the mechanisms for resistance is needed.

According to the published literature [9–12] the most frequently found macrolide resistance genes in bacterial isolates from animals and humans are the erm genes. These genes encode a methyltranferase that has specific target residues in the 23S rRNA [4]. Methylation will inhibit binding of erythromycin. Several erm genes have been sequenced and named. However, the names associated with the genes have not been chosen according to homology with previously published genes, thus creating confusing names.

In this study a classification of the published genes based on sequence identity in the coding regions of the erm genes is presented. This classification was used to study the prevalence of selected erm gene classes by PCR in erythromycin resistant bacteria of animal and human origin in Denmark.

Materials and methods

Classification of erm gene classes

Several erm genes have been deposited in GenBank (Table 1). Among the published sequences names are not consistent. Using the DNASIS software the published sequences were aligned according to percent identity in the coding region and using the maximum likelihood method a phylogenetic tree was created. The minimal percentage of identity for a gene to be placed in a class was set at 95% in the sequenced area of the coding open reading frame.

1

erm genes published in GenBank

Origin Position Size Gene GenBank 
Class 0 (ermE group) 
S. erythraea Chromosomal DNA 1257 bp ermE X51891 
S. erythraea Chromosomal DNA 1113 bp ermE2 M11200 M11304 
Class I (ermDK group) 
B. anthracis Chromosomal DNA 864 bp ermJ L08389 
B. licheniformis Chromosomal DNA 864 bp ermD M29832 
B. licheniformis Chromosomal DNA 864 bp ermK M77505 
Class II (ermF group) 
B. fragilis Conjugal element 801 bp ermFU M62487 
B. fragilis Tn4351 801 bp ermF M17124 
B. fragilis Tn4551 801 bp ermFS M17808 
Class III (ermA2 group) 
C. xerosis Tn5432 762 bp ermCX U21300 
C. diphtheriae pNG2 855 bp ermCd M36726 
C. diphtheriae pSV5(pNG2) 762 bp ermA X57320 
C. diphthteriae pNG2 762 bp ermA X51472 
Class IV (ermB group) 
L. fermentum pLEM3 753 bp erm U48430 
S. pyogenes pMD101 750 bp erm X66468 
Enterococcus plasmid 738 bp erm2 X82819 
S. pyogenes pBT233 738 bp erm2 X64695 
E. faecalis not determined 738 bp ermB U86375 
S. lentus pSES20 738 bp ermB U35228 
S. agalactiae pIP501 738 bp erm X72021 
C. perfringens Chromosomal DNA 738 bp ermBP U18931 
E. coli pIP1527 738 bp ermBC M19270 
E. hirae not determined 738 bp ermAM X81655 
S. sanguis pAM77 738 bp ermAM K00551 
E. faecalis Tn917 (pAD2) 738 bp ermB M11180 M36722 
S. pneumoniae Tn1545 738 bp ermB X52632 
E. faecalis pAMβ1 283 bp ermAM M20334 
E. faecalis pAMβ1 161 bp ermAM M20335 
Class V (ermG group) 
E. faecalis Tn7853 735 bp metht. L42817 
B. sphaericus Chromosomal DNA 735 bp ermG M15332 
Class VI (ermC group) 
B. subtilis pIM13 735 bp ermC M13761 
S. aureus J3356::POX7;1 735 bp ermC U36911 
S. aureus J3356::POX7;3 759 bp ermC U36912 
S. chromogenes pPV141 735 bp ermM U82607 
S. simulans pV142 735 bp ermM AF019140 
S. epidermidis pNE131 735 bp ermM M12730 
S. aureus pE194 735 bp ermC J0175-8 
S. aureus pE5 735 bp ermC M17990 
S. aureus pT48 735 bp ermC M19652 
S. equorum pSES6 735 bp ermC X82668 
S. hominis pSES5 735 bp ermC Y09001 
S. haemolyticus pSES4a 735 bp ermC Y09002 
S. hyicus pSES21 735 bp ermC Y09003 
S. aureus pRJ5 283 bp ermC L04687 
S. aureus pA22 226 bp ermC X54338 
Unique sequences 
H. influenzae Chromosomal DNA 1173 bp ermA L45536/42023 
B. fragilis pBF4 1035 bp ermF M14730 
Arthrobacter sp. Chromosomal DNA 1023 bp ermA M11276 
S. fradiae pSK101 960 bp ermSF M19269 
C. perfringens Chromosomal DNA 774 bp ermQ L22689 
Lactobacillus pGT633 735 bp ermGT M64090 
S. pyogenes Chromosomal DNA 732 bp ermTR AF002716 
S. aureus Tn554 732 bp ermA K02987 
Origin Position Size Gene GenBank 
Class 0 (ermE group) 
S. erythraea Chromosomal DNA 1257 bp ermE X51891 
S. erythraea Chromosomal DNA 1113 bp ermE2 M11200 M11304 
Class I (ermDK group) 
B. anthracis Chromosomal DNA 864 bp ermJ L08389 
B. licheniformis Chromosomal DNA 864 bp ermD M29832 
B. licheniformis Chromosomal DNA 864 bp ermK M77505 
Class II (ermF group) 
B. fragilis Conjugal element 801 bp ermFU M62487 
B. fragilis Tn4351 801 bp ermF M17124 
B. fragilis Tn4551 801 bp ermFS M17808 
Class III (ermA2 group) 
C. xerosis Tn5432 762 bp ermCX U21300 
C. diphtheriae pNG2 855 bp ermCd M36726 
C. diphtheriae pSV5(pNG2) 762 bp ermA X57320 
C. diphthteriae pNG2 762 bp ermA X51472 
Class IV (ermB group) 
L. fermentum pLEM3 753 bp erm U48430 
S. pyogenes pMD101 750 bp erm X66468 
Enterococcus plasmid 738 bp erm2 X82819 
S. pyogenes pBT233 738 bp erm2 X64695 
E. faecalis not determined 738 bp ermB U86375 
S. lentus pSES20 738 bp ermB U35228 
S. agalactiae pIP501 738 bp erm X72021 
C. perfringens Chromosomal DNA 738 bp ermBP U18931 
E. coli pIP1527 738 bp ermBC M19270 
E. hirae not determined 738 bp ermAM X81655 
S. sanguis pAM77 738 bp ermAM K00551 
E. faecalis Tn917 (pAD2) 738 bp ermB M11180 M36722 
S. pneumoniae Tn1545 738 bp ermB X52632 
E. faecalis pAMβ1 283 bp ermAM M20334 
E. faecalis pAMβ1 161 bp ermAM M20335 
Class V (ermG group) 
E. faecalis Tn7853 735 bp metht. L42817 
B. sphaericus Chromosomal DNA 735 bp ermG M15332 
Class VI (ermC group) 
B. subtilis pIM13 735 bp ermC M13761 
S. aureus J3356::POX7;1 735 bp ermC U36911 
S. aureus J3356::POX7;3 759 bp ermC U36912 
S. chromogenes pPV141 735 bp ermM U82607 
S. simulans pV142 735 bp ermM AF019140 
S. epidermidis pNE131 735 bp ermM M12730 
S. aureus pE194 735 bp ermC J0175-8 
S. aureus pE5 735 bp ermC M17990 
S. aureus pT48 735 bp ermC M19652 
S. equorum pSES6 735 bp ermC X82668 
S. hominis pSES5 735 bp ermC Y09001 
S. haemolyticus pSES4a 735 bp ermC Y09002 
S. hyicus pSES21 735 bp ermC Y09003 
S. aureus pRJ5 283 bp ermC L04687 
S. aureus pA22 226 bp ermC X54338 
Unique sequences 
H. influenzae Chromosomal DNA 1173 bp ermA L45536/42023 
B. fragilis pBF4 1035 bp ermF M14730 
Arthrobacter sp. Chromosomal DNA 1023 bp ermA M11276 
S. fradiae pSK101 960 bp ermSF M19269 
C. perfringens Chromosomal DNA 774 bp ermQ L22689 
Lactobacillus pGT633 735 bp ermGT M64090 
S. pyogenes Chromosomal DNA 732 bp ermTR AF002716 
S. aureus Tn554 732 bp ermA K02987 

Not totally sequenced.

Accession number in GenBan.

Bacterial isolates

A total of 258 erythromycin resistant isolates were tested. Among these 61 were of human origin and 197 from animals. All 44 human isolates of Staphylococcus aureus were collected in 1996 in Denmark from non-hospitalized patients. Isolates of several phage types were included indicating that these isolates were representatives of common S. aureus phage types of human origin found in Denmark. All S. aureus strains were susceptible to methicillin. All 16 human Enterococcus faecium isolates were isolated from faecal samples.

The animal isolates originated from the DANMAP surveillance program [1] and therefore reflect the number of isolates obtain from this project. They include 16 E. faecium isolates from broilers, 35 E. faecium, 36 E. faecalis and 16 S. hyicus isolates from pigs and eight staphylococcal (two S. aureus and six coagulase negative staphylococci) and nine enterococcal isolates (five E. faecium and four E. faecalis) from cattle. Furthermore, 77 Streptococcus suis isolates from a strain collection of diagnostic samples from pigs obtained from 1991 to 1996 were included.

PCR amplification of the erm genes

DNA extractions and PCR amplification were performed according to Jensen et al. [13]. From all isolates two single colonies were picked for isolation of total DNA and PCR performed. Strains were only considered positive if both amplifications were positive. If a positive and negative amplification was obtained two new single colonies were picked and a second round of amplification was performed. All PCR amplifications were run with a MgCl2 concentration of 1 mM.

Primers were designed according to the published sequences and the classes for the erm genes defined in this work (see Section 3 and Table 1). All designed primers were tested for their specificity on several published strains (Table 2). For the ermA (Tn554) [14] gene the sequence for Tn554 was chosen for design of primer. For ermB (class IV) the sequence from Tn917[15] was chosen and for ermC (class VI) the sequence from pE194 was chosen. The sequences of all primers and position on selected genes from the two classes and ermA (Tn554) are listed in Table 2. The primers were verified using strains listed in Table 3. The Tm values for the individual primers were calculated using the Tm DETERMINATION [16] available on INTERNET (http://alces.med.umn.edu/rawtm.html).

2

Sequence, position, class and reference for PCR primers used in this study

Name Sequence (5′–3′) Position Class Reference 
Tn554-2 TCAAAGCCTGTCGGAATTGG 4634–4653  K02987 
Tn544-1 AAGCGGTAAACCCCTCTGAG 5074–5055  K02987 
ermB-1 CATTTAACGACGAAACTGGC 836–855 IV M11180 
ermB-2 GGAACATCTGTGGTATGGCG 1260–1241 IV M11180 
ermC-1 ATCTTTGAAATCGGCTCAGG 2639–2620 VI J01755 
ermC-2 CAAACCCGTATTCCACGATT 2345–2364 VI J01755 
Name Sequence (5′–3′) Position Class Reference 
Tn554-2 TCAAAGCCTGTCGGAATTGG 4634–4653  K02987 
Tn544-1 AAGCGGTAAACCCCTCTGAG 5074–5055  K02987 
ermB-1 CATTTAACGACGAAACTGGC 836–855 IV M11180 
ermB-2 GGAACATCTGTGGTATGGCG 1260–1241 IV M11180 
ermC-1 ATCTTTGAAATCGGCTCAGG 2639–2620 VI J01755 
ermC-2 CAAACCCGTATTCCACGATT 2345–2364 VI J01755 

All primers used for PCR amplification were designed inside the coding regions. All numbers indicated refer to the sequences published in GenBank. The access numbers are: K02987 for the Tn554 containing ermA, M11180 for the Tn917 containing ermB and J01755 for pE194 for ermC.

3

Reference strains for erm genes

Origin Bacterium Gene Class Reference 
Tn554     
1206 S. aureus ermA Tn554 [24] 
RN1389 S. aureus::Tn554 ermA Tn554 Dr. Courvalin, personal communication 
ermE, class 0     
 S. lividans/pIJ702+ermE ermE [25] 
 E. coli/pIJ4026 ermE Dr. Vester, personal communication 
ermB, class IV     
JIR2220 E. coli DH5α/pJIR599 ermBP IV [26] 
 B. subtilis/pAM77 ermAM IV [27] 
JH2-2 E. faecalis::Tn1545 ermB IV [28] 
 S. lentus ermB IV [11] 
JM107 E. coli/pSES20 ermB IV [29] 
CH116 E. faecalis::Tn5384 ermB IV [30] 
BR-151 B. subtilus/pAM77 ermB IV [27] 
ermC, class VI     
 B. subtilis/pE194 ermC VI [31] 
B.3HU104 B. subtilis/pE194 ermC VI Dr. Courvalin, personal communication 
RN4220 S. aureus::pSES5 ermC VI [11] 
HB101 E. coli/pKH80 ermC VI [32] 
 L. reuteri/pGT633 ermGT VI [33] 
ermQ     
JIR2879 E. coli DH5α/pJIR1120 ermQ  [26] 
Origin Bacterium Gene Class Reference 
Tn554     
1206 S. aureus ermA Tn554 [24] 
RN1389 S. aureus::Tn554 ermA Tn554 Dr. Courvalin, personal communication 
ermE, class 0     
 S. lividans/pIJ702+ermE ermE [25] 
 E. coli/pIJ4026 ermE Dr. Vester, personal communication 
ermB, class IV     
JIR2220 E. coli DH5α/pJIR599 ermBP IV [26] 
 B. subtilis/pAM77 ermAM IV [27] 
JH2-2 E. faecalis::Tn1545 ermB IV [28] 
 S. lentus ermB IV [11] 
JM107 E. coli/pSES20 ermB IV [29] 
CH116 E. faecalis::Tn5384 ermB IV [30] 
BR-151 B. subtilus/pAM77 ermB IV [27] 
ermC, class VI     
 B. subtilis/pE194 ermC VI [31] 
B.3HU104 B. subtilis/pE194 ermC VI Dr. Courvalin, personal communication 
RN4220 S. aureus::pSES5 ermC VI [11] 
HB101 E. coli/pKH80 ermC VI [32] 
 L. reuteri/pGT633 ermGT VI [33] 
ermQ     
JIR2879 E. coli DH5α/pJIR1120 ermQ  [26] 

Sequencing

The nucleotide sequence of the amplification products was determined by cycle sequencing [17] using AmplitaqFS dye terminator kit and a 373A automatic sequencer (Applied Biosystems/Perkin Elmer, Foster City, CA, USA). The DNASIS software (Hitachi Software Engineering Co., Ltd) was used for sequence analysis.

Results

Classification of erm gene classes

On the basis of aligning the published sequences the erm genes were grouped into seven classes and some unique genes (Table 1). Class 0 contained genes from erythromycin producing strains while the remaining classes contained acquired genes for macrolide resistance in bacteria. Using the maximum likelihood method a phylogenetic tree was created verifying the defined classes (Fig. 1). The class number was assigned according to the length of the coding region and not due to the number of sequenced genes.

1

Phylogenetic tree of erm genes. The phylogenetic tree was created by the maximum likelihood method. Only fully sequenced genes are included in the tree and GenBank numbers and gene classes in parentheses are listed. For genes and organisms see Table 1.

1

Phylogenetic tree of erm genes. The phylogenetic tree was created by the maximum likelihood method. Only fully sequenced genes are included in the tree and GenBank numbers and gene classes in parentheses are listed. For genes and organisms see Table 1.

Prevalence of selected erm genes among bacterial isolates of human and animal origin

All designed primers were tested on several reference strains (Table 2). Positive amplicons were only obtained from the reference strains containing the corresponding genes. No cross reaction towards other genes were seen. This is to our knowledge the first time so many reference strains have been used to check the specificity of designed primers.

The results of PCR amplification for selected gene classes in the tested isolates are given in Table 4. Using PCR the presence of at least one of the three genes were found in 88% of the isolates. For all strains amplicons of correct size was obtained and a selected number of amplicons was sequenced to verify that the correct target had been amplified (data not shown). Four isolates, three S. aureus of human origin and one E. faecium from a pig, contained more than one gene for macrolide resistance. The ermB (class IV) was the most common class found among enterococci (88%) and streptococci (90%). No amplicons of any size was obtained for ermA (Tn554) in enterococci and streptococci and only one E. faecium of animal origin contained the ermC (class VI).

4

Prevalence of selected erm genes in enterococci, streptococci and staphylococci of animal and human origin in Denmark

 Humans Animals Total 
  Broilers Cattle Pigs  
Bacteria S. aureus E. faecium E. faecium staphylococci enterococci S. suis E. faecalis E. faecium S. hyicus  
n44 17 16 77 36 35 16 258 
ermA 10 11 
ermB, IV 17 15 69 31 28 168 
ermC, VI 36 12 52 
N.D. 31 
 Humans Animals Total 
  Broilers Cattle Pigs  
Bacteria S. aureus E. faecium E. faecium staphylococci enterococci S. suis E. faecalis E. faecium S. hyicus  
n44 17 16 77 36 35 16 258 
ermA 10 11 
ermB, IV 17 15 69 31 28 168 
ermC, VI 36 12 52 
N.D. 31 

All numbers indicate a positive amplicon of correct size. n=number of isolates tested, N.D.=number of isolates where the genetic background was not determined.

Since four isolates contained more than one erythromycin resistance gene the total number of positive reactions will be greater than the number of isolates.

Two S. aureus and six coagulase negative staphylococci.

Five E. faecium and four E. faecalis.

Among human S. aureus both ermA (Tn554) (23%) and ermC (VI) (82%) were found. In staphylococci isolated from animals ermA (Tn554) (5%) and ermC (VI) (63%) were found. No significant difference in prevalence of these genes in staphylococci of animal (24 isolates) and human (44 isolates) origin could be detected. The ermB (class IV) was not found in staphylococci.

Discussion

In this study a re-classification of the erm genes was suggested and the prevalence of selected erm gene classes in bacteria of animal and human origin was detected by use of PCR. On the basis of the re-classification the first published sequence for ermA (Tn554) does not belong to class III in which two other genes named ermA are placed. Especially for the ermA genes the published names are not consistent with the classes proposed in this study. In the phylogenetic tree the ermA (Tn554) was grouped together with the ermTR from Streptococcus pyogenes. These two sequences were 82% homologous in the coding region and were for that reason not defined as a class. Several genes belonging to class IV are named ermAM and in many cases almost identical genes are called ermB. We propose that the published names are kept but that additional to these the class to which the gene belongs should be defined and noted after the name. As an example Tn917 contain the ermB (class IV) gene.

The presence of two classes of genes as well as the ermA (Tn554) was tested among selected erythromycin resistant isolates. By limiting the detection to two classes of genes and the Tn554 at least one of these genes was found in 88% of the tested isolates. In the remaining 11 percent the genotype was not determined but genes of other erm classes or other mechanism for erythromycin resistance could be present.

ermA (Tn554) was found in staphylococci predominantly isolated from humans in accordance with previously published studies [18]. ermB (class IV) dominated among enterococci and streptococci as found in previously studies [10, 19, 20, 11, 21, 4, 18]. ermC (VI) dominated among staphylococci of human and animal origin [10, 18].

In the study differences in the prevalence of erm gene classes in enterococci/streptococci and staphylococci were observed. For different staphylococci and for enterococci and streptococci identical erm gene classes were observed. S. pyogenes and S. pneumoniae of human origin have previously been found to harbor ermB (class IV) [22, 20, 23, 8] and transfer of genes between enterococci and S. suis of animal origin to these bacteria could take place. However, in Denmark the frequency of macrolide resistance among these bacteria is low, making it difficult to obtain resistant isolates.

Identical genes in different bacteria can be a result of horizontal transfer but could also indicate a common reservoir for resistance or evolution from the same ancestor. Proof of horizontal transfer would be the presence of identical mobile DNA elements in different bacterial species of human and animal origin. Further studies of the position and the mobility of the different erm genes are needed to determine whether horizontal transfer takes place. Such studies are ongoing at present.

Acknowledgements

We would like to acknowledge the following persons for their technical assistance: René Hendriksen, Mette Juul, Lissie Kjær Jensen, Karina Kristensen, Inge Hansen, Dorthe Nielsen, Anne Lykkegaard Lauritsen and Christina Aaby Svendsen. Special thanks to Flemming Bager, DVL for creating lists of resistant bacteria from the DANMAP database, Thomas D. Leser for creating the phylogenetic tree and Birte Vester, Copenhagen University, Knud Bϕrge Pedersen, Anders Meyling and Henrik C. Wegener, DVL, for helpful comments in the preparation of the manuscript.

References

[1]
Aarestrup
F.M.
Bager
F.
Jensen
N.E.
Madsen
M.
Meyling
A.
Wegener
H.C.
(
1998
)
Surveillance of antimicrobial resistance in bacteria isolated from food animals to antimicrobial growth promoters and related therapeutic agents in Denmark
.
APMIS
 
106
,
606
622
.
[2]
Aarestrup
F.M.
Jorsal
S.E.
Jensen
N.E.
(
1998
)
Serological characterization and antimicrobial susceptibility of Streptococcus suis isolates from diagnostic samples in Denmark during 1995 and 1996
.
Vet. Microbiol.
 
60
,
59
66
.
[3]
Clermont
D.
Horaud
T.
(
1990
)
Identification of chromosomal antibiotic resistance genes in Streptococcus anginosus (‘S. milleri’)
.
Antimicrob. Agents Chemother.
 
34
,
1685
1690
.
[4]
Weisblum
B.
(
1995
)
Erythromycin resistance by ribosome modification
.
Antimicrob. Agents Chemother.
 
39
,
577
585
.
[5]
Barthelemy
P.
Autissier
D.
Gerbaud
G.
Courvallin
P.
(
1984
)
Enzymic hydrolysis of erythromycin by a strain of Escherichia coli
.
J. Antibiot.
 
37
,
1692
1696
.
[6]
Clancy
J.
Petitpas
J.
Dib-Hajj
F.
Yuan
W.
Cronan
M.
Kamath
A.V.
Bergeron
J.
Retsema
J.A.
(
1996
)
Molecular cloning and functional analysis of a novel macrolide-resistance determinant, mefA, from Streptococcus pyogenes
.
Mol. Microbiol.
 
22
(
5
),
867
879
.
[7]
Sutcliffe
J.
Grebe
T.
Tait-Kamradt
A.
Wondrack
L.
(
1996
)
Detection of erythromycin-resistant determinants by PCR
.
Antimicrob. Agents Chemother.
 
40
,
2562
2566
.
[8]
Sutcliffe
J.
Tait-Kamradt
A.
Wondrack
L.
(
1996
)
Streptococcus pneumoniae and Streptococcus pyogenes resistant to macrolides but sensitive to clindamycin: a common resistance pattern mediated by an efflux system
.
Antimicrob. Agents Chemother.
 
40
,
1817
1824
.
[9]
Dutta
G.N.
Devriese
L.A.
(
1982
)
Resistance to macrolide-lincosamide-streptogramin antibiotics in enterococci from the intestine of animals
.
Res. Vet. Sci.
 
33
,
70
72
.
[10]
Eady
A.E.
Ross
J.I.
Tipper
J.L.
Walters
C.E.
Cove
J.H.
Noble
W.C.
(
1993
)
Distribution of genes encoding erythromycin ribosomal methylases and an erythromycin efflux pump in epidemiologically distinct groups of staphylococci
.
J. Antimicrob. Chemother.
 
31
,
211
217
.
[11]
Lodder
G.
Werckenthin
C.
Schwarz
S.
Dyke
K.
(
1997
)
Molecular analysis of naturally occurring ermC-encoding plasmids in staphylococci isolated from animals with and without previous contact with macrolide/lincosamide antibiotics
.
FEMS Immunol. Med. Microbiol.
 
18
,
7
15
.
[12]
Rollins
L.D.
Lee
L.N.
LeBlanc
D.J.
(
1985
)
Evidence for disseminated erythromycin resistance determinant mediated by Tn917-like sequences among group D streptococci isolates from pigs, chickens and humans
.
Antimicrob. Agents Chemother.
 
27
,
439
444
.
[13]
Jensen
L.B.
Ahrens
P.
Dons
L.
Jones
R.N.
Hammerum
A.M.
Aarestrup
F.M.
(
1998
)
Molecular analysis of the Tn1546 in Enterococcus faecium isolated from animals and humans
.
J. Clin. Microbiol.
 
36
,
437
442
.
[14]
Murphy
E.
Huwyler
L.
do Carmo de Freire Bastos
M.
(
1985
)
Transposon Tn554: complete sequence and isolation of transposition-defective and antibiotic-sensitive mutants
.
EMBO J.
 
4
,
3357
3365
.
[15]
Shaw
J.H.
Clewell
D.B.
(
1985
)
Complete sequence of the macrolide-lincosamide-streptogramin B-resistance transposon Tn917 in Streptococcus faecalis
.
Antimicrob. Agents Chemother.
 
164
,
782
796
.
[16]
Breslauer
K.J.
Frank
R.
Blöcket
H.
Marky
L.A.
(
1986
)
Predicting DNA duplex stability from the base sequence
.
Proc. Natl. Acad. Sci. USA
 
83
,
3746
3750
.
[17]
Sears
L.E.
Moran
L.S.
Kissinger
C.
Slatko
B.E.
(
1992
)
Thermal cycle sequencing and alternative sequencing protocols using the highly thermostable Vent® (exo) DNA polymerase
.
Biotechniques
 
13
,
626
683
.
[18]
Westh
H.
Hougaard
D.M.
Vuust
J.
Rosdahl
V.T.
(
1995
)
Prevalence of erm gene classes in erythromycin-resistant Staphylococcus aureus strains isolated between 1959 and 1988
.
Antimicrob. Agents Chemother.
 
39
,
369
373
.
[19]
Jenssen
W.D.
Thakker-Varia
S.
Dubin
D.T.
Weinstein
M.P.
(
1987
)
Prevalence of macrolide-lincosamide-streptogramin B resistance and erm gene classes among clinical strains of staphylococci and streptococci
.
Antimicrob. Agents Chemother.
 
31
,
883
888
.
[20]
Leclercq
R.
Courvalin
P.
(
1991
)
Bacterial resistance to macrolide, lincosamide, and streptogramin antibiotics by target modification
.
Antimicrob. Agents Chemother.
 
35
,
1267
1272
.
[21]
Thakker-Varia
S.
Jenssen
W.D.
Moon-McDermott
L.
Weinstein
M.P.
Dubin
D.T.
(
1987
)
Molecular epidemiology of macrolide-lincosamide-streptogramin B resistance in Staphylococcus aureus and coagulase-negative staphylococci
.
Antimicrob. Agents Chemother.
 
31
,
735
743
.
[22]
Cornaglia
G.
Ligozzi
M.
Mazzariol
A.
Valentini
M.
Orefici
G.
Italian Surveillance group for antimicrobial resistance
Fontana
R.
(
1996
)
Rapid increase of resistance to erythromycin and clindamycin in Streptococcus pyogenes in Italy 1993–1995
.
Emerging Infect. Dis.
 
2
,
339
342
.
[23]
Schalen
C.
Gebreselassie
D.
Ståhl
S.
(
1995
)
Characterization of an erythromycin resistance (erm) plasmid in Streptococcus pyogenes
.
APMIS
 
103
,
59
68
.
[24]
Weisblum
B.
Demohn
V.
(
1969
)
Erythromycin-inducible resistance in Staphylococcus aureus: survey of antibiotic classes involved
.
J. Bacteriol.
 
98
,
447
452
.
[25]
Pernodet
J.-L.
Fish
S.
Blondelet-Rouault
M.-H.
Cundliffe
E.
(
1996
)
The macrolide-lincosamide-streptogramin B resistance phenotypes characterized by using specifically deleted, antibiotic-sensitive strains of Streptomyces lividans
.
Antimicrob. Agents Chemother.
 
40
,
581
585
.
[26]
Berrymann
D.I.
Lysristis
M.
Rood
J.I.
(
1994
)
Cloning and sequence analysis of ermQ, the predominant macrolide-lincosamide-streptogramin B resistance gene in Clostridium perfringens
.
Antimicrobial. Agents Chemother.
 
38
,
1041
1046
.
[27]
Horinouchi
S.
Byeon
W.-H.
Weisblum
B.
(
1983
)
A complex attenuator regulates inducible resistance to macrolides, lincosamides, and streptogramin type B antibiotics in Streptococcus sanguis
.
J. Bacteriol.
 
154
,
1252
1262
.
[28]
Courvalin
P.
Carlier
C.
(
1986
)
Transposable multiple antibiotic resistance in Streptococcus pneumoniae
.
Mol. Gen. Genet.
 
205
,
291
297
.
[29]
Werckenthin
C.
Schwarz
S.
Dyke
K.
(
1996
)
Macrolide-lincosamide-streptogramin B resistance in Staphylococcus lentus results from the integration of part of a transposon into a small plasmid
.
Antimicrob. Agents Chemother.
 
40
,
2224
2225
.
[30]
Rice
L.B.
Carias
L.L.
Marshall
S.H.
Bonafede
M.E.
(
1996
)
Sequences found on staphylococcal beta-lactamase plasmids integrated into the chromosome of Enterococcus faecalis CH116
.
Plasmid
 
35
,
81
90
.
[31]
Gryczan
T.J.
Grandi
G.
Hahn
J.
Grandi
R.
Dubnau
D.
(
1980
)
Conformational alteration of mRNA structure and the posttranscriptional regulation of erythromycin induced drug resistance
.
Nucleic Acids Res.
 
8
,
6081
6097
.
[32]
Hardy
K.
Haefali
C.
(
1982
)
Expression of Escherichia coli of a staphylococcal gene for resistance to macrolide, lincosamide and streptogramin type B antibiotics
.
J. Bacteriol.
 
152
,
524
526
.
[33]
Tannock
G.W.
Luchansky
J.B.
Miller
L.
Connell
H.
Thode-Andersen
S.
Mercer
A.A.
Klaenhammer
T.R.
(
1994
)
Molecular characterization of a plasmid-borne (pGT633) erythromycin resistance determinant (ermGT) from Lactobacillus reuteri 100–63
.
Plasmid
 
31
,
60
71
.