- Split View
-
Views
-
CiteCitation
A.M. Bailey, D.J. Mitchell, K.L. Manjunath, G Nolasco, C.L. Niblett; Identification to the species level of the plant pathogens Phytophthora and Pythium by using unique sequences of the ITS1 region of ribosomal DNA as capture probes for PCR ELISA, FEMS Microbiology Letters, Volume 207, Issue 2, 1 February 2002, Pages 153–158, https://doi.org/10.1111/j.1574-6968.2002.tb11044.x
Download citation file:
© 2018 Oxford University Press
Close -
Share
Abstract
The ribosomal internal transcribed spacer 1 region was sequenced for 10 species of Pythium and eight species of Phytophthora. Alignment of the sequences revealed considerable sequence microheterogeneity, which was utilized to prepare a capture probe of unique sequence for each species. The capture probes were tested by PCR ELISA, combining the sensitivity and specificity of the polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay (ELISA). The probes were entirely species specific, enabling the detection and identification of the amplified DNA of species from individual cultures or from mixed samples of the DNAs of two different species. This approach to species identification, which provides a molecular technology to process large numbers of samples and still identify the fungi with a high level of confidence, may greatly reduce the resources and the time of highly trained specialists currently needed to identify these important species of plant pathogenic fungi.
1 Introduction
Historically, the identification of species of important fungal plant pathogens such as species of Pythium and Phytophthora has been based on morphometrics and growth characteristics on specific media [1,,,4]. However, the emphasis on training in classical mycology has been waning in recent years, and specialists capable of identifying fungi to the species level are less common and available. Therefore, alternative approaches must be developed to accurately identify and differentiate fungal species. Recently, many molecular approaches, including isozyme analysis, restriction fragment length polymorphisms of nuclear and mitochondrial DNA, polymerase chain reaction (PCR) of internal transcribed spacer (ITS) regions, randomly amplified polymorphic DNA PCRs, DNA probes and ribosomal DNA have been tested to detect and identify some of the oomycetes [5,,,,9].
Methods employing PCR provide the most sensitive means currently available for detecting fungi and other plant pathogens. However, detection and identification of the amplified products usually requires electrophoretic or blot hybridization analysis for interpretation. Now an immunoenzymatic method, PCR ELISA, is available for the sensitive detection of DNA or RNA [10,11]. It has been used for detecting plant viral sequences [12,,14] and for detecting mycoplasmas [15]. Using the ribosomal ITS1 as the target molecule for PCR ELISA, species of Fusarium that were potential fumonisin producers in food crops were differentiated from species that did not produce the compound [16]. Thus, PCR ELISA capitalizes on single mutations or other sequence microheterogeneities to differentiate nearly identical nucleic acid sequences.
In PCR ELISA the PCR products are non-radioactively labeled with digoxygenin-11-UTP (DIG) during amplification. This is followed by immobilization of a biotin-labeled oligonucleotide (capture probe) of complementary sequence to the target DNA strand in the wells of a streptavidin-coated microtiter plate. The DIG-labeled amplified DNA is then hybridized to the capture probe in the microtiter well, and the DIG is then detected immunologically in an ELISA-like assay [11].
Recently, Cooke et al. [5] described the phylogenetic relationships of Phytophthora, Pythium and related oomycetes on the basis of the ITS sequences of their genomic ribosomal DNA, illustrating its value in differentiating morphologically similar species and stressing the use of the ITS in the development of species-specific PCR primers in plant-health monitoring. Similar information has been presented previously by Briard et al. [17] and Paul and Masih [18]. In extending these observations to PCR ELISA for identifying species of oomycetes, we sequenced the ITS1 regions of eight species of Phytophthora and 10 species of Pythium. It was thereby possible to identify areas of sequence microheterogeneity in their ITS1 regions which were subsequently used to design capture probes for use in PCR ELISA. These probes make PCR ELISA a very sensitive and rapid method for detection and identification of species of Phytophthora and Pythium.
2 Materials and methods
2.1 Fungal isolates, identification, growth conditions and DNA isolation
The Phytophthora spp. evaluated in this study were obtained from various culture collections, and Pythium spp. were isolated from roots of bell pepper or tomato in two fields in south Florida (Table 1). All cultures of the Phytophthora spp. were selected from single hyphal tips growing on V8 juice agar and stored at 24°C on corn meal agar slants. Each culture of the Pythium spp. was initiated from a hyphal tip of the germ tube from a single encysted zoospore growing on water agar, and cultures were stored at 24°C in autoclaved glass vials containing water and several hemp seeds. Taxonomic characterization of isolates of Phytophthora spp. was in accordance with the morphological descriptions of Erwin and Ribeiro [2] and Stamps et al. [3]. Taxonomic determinations for all isolates of Pythium spp. were based on morphometric characterization in grass-leaf cultures and descriptions of Van der Plaats-Niterink [4] and Dick [1].
Isolate number, host of origin, location where isolated, source of the isolate, and year isolated for the species of Phytophthora and Pythium used in this study for sequencing of their ITS1 regions and hybridization with various capture probes
| Isolate | Species | Host | Location | Source | Year |
| P2428 | P. cinnamomi | avocado | CA, USA | M.D. Coffey [7] | 1986 |
| Pn23 | P. nicotianae | tobacco | FL, USA | DPI | 1985 |
| P1391 | P. infestans | potato | CA, USA | M.D. Coffey [7] | 1986 |
| P12 | P. palmivora | cacao | Costa Rica | ATCC 26200 | 1986 |
| P1321 | P. citricola | citrus | CA, USA | M.D. Coffey [7] | 1986 |
| Cp-32 | P. capsici | pepper | FL, USA | D. Mitchell [25] | 1998 |
| P1324 | P. citrophthora | citrus | CA, USA | M.D. Coffey [7] | 1986 |
| Hv-2 | P. hevea | cacao root | Brazil | E.D. Luz | 1989 |
| Heli-1 | P. helicoides | pepper | FL, USA | D. Mitchell [25] | 2000 |
| Caten-9 | P. catenulatum | tomato | FL, USA | D. Mitchell [25] | 2000 |
| Gram-2 | P. graminicola | pepper | FL, USA | D. Mitchell [25] | 2000 |
| Aphan-4 | P. aphanidermatum | pepper | FL, USA | D. Mitchell [25] | 2000 |
| G-1 | P. periilum | pepper | FL, USA | D. Mitchell [25] | 2000 |
| Arrhen-3 | P. arrhenomanes | tomato | FL, USA | D. Mitchell [25] | 2000 |
| Myrio-14 | P. myriotylum | pepper | FL, USA | D. Mitchell [25] | 2000 |
| Peri-13 | P. periplocum | tomato | FL, USA | D. Mitchell [25] | 2000 |
| Ulti-2 | P. ultimum | tomato | FL, USA | D. Mitchell [25] | 2000 |
| Irre-2 | P. irregulare | tomato | FL, USA | D. Mitchell | 2000 |
| Isolate | Species | Host | Location | Source | Year |
| P2428 | P. cinnamomi | avocado | CA, USA | M.D. Coffey [7] | 1986 |
| Pn23 | P. nicotianae | tobacco | FL, USA | DPI | 1985 |
| P1391 | P. infestans | potato | CA, USA | M.D. Coffey [7] | 1986 |
| P12 | P. palmivora | cacao | Costa Rica | ATCC 26200 | 1986 |
| P1321 | P. citricola | citrus | CA, USA | M.D. Coffey [7] | 1986 |
| Cp-32 | P. capsici | pepper | FL, USA | D. Mitchell [25] | 1998 |
| P1324 | P. citrophthora | citrus | CA, USA | M.D. Coffey [7] | 1986 |
| Hv-2 | P. hevea | cacao root | Brazil | E.D. Luz | 1989 |
| Heli-1 | P. helicoides | pepper | FL, USA | D. Mitchell [25] | 2000 |
| Caten-9 | P. catenulatum | tomato | FL, USA | D. Mitchell [25] | 2000 |
| Gram-2 | P. graminicola | pepper | FL, USA | D. Mitchell [25] | 2000 |
| Aphan-4 | P. aphanidermatum | pepper | FL, USA | D. Mitchell [25] | 2000 |
| G-1 | P. periilum | pepper | FL, USA | D. Mitchell [25] | 2000 |
| Arrhen-3 | P. arrhenomanes | tomato | FL, USA | D. Mitchell [25] | 2000 |
| Myrio-14 | P. myriotylum | pepper | FL, USA | D. Mitchell [25] | 2000 |
| Peri-13 | P. periplocum | tomato | FL, USA | D. Mitchell [25] | 2000 |
| Ulti-2 | P. ultimum | tomato | FL, USA | D. Mitchell [25] | 2000 |
| Irre-2 | P. irregulare | tomato | FL, USA | D. Mitchell | 2000 |
Isolate number, host of origin, location where isolated, source of the isolate, and year isolated for the species of Phytophthora and Pythium used in this study for sequencing of their ITS1 regions and hybridization with various capture probes
| Isolate | Species | Host | Location | Source | Year |
| P2428 | P. cinnamomi | avocado | CA, USA | M.D. Coffey [7] | 1986 |
| Pn23 | P. nicotianae | tobacco | FL, USA | DPI | 1985 |
| P1391 | P. infestans | potato | CA, USA | M.D. Coffey [7] | 1986 |
| P12 | P. palmivora | cacao | Costa Rica | ATCC 26200 | 1986 |
| P1321 | P. citricola | citrus | CA, USA | M.D. Coffey [7] | 1986 |
| Cp-32 | P. capsici | pepper | FL, USA | D. Mitchell [25] | 1998 |
| P1324 | P. citrophthora | citrus | CA, USA | M.D. Coffey [7] | 1986 |
| Hv-2 | P. hevea | cacao root | Brazil | E.D. Luz | 1989 |
| Heli-1 | P. helicoides | pepper | FL, USA | D. Mitchell [25] | 2000 |
| Caten-9 | P. catenulatum | tomato | FL, USA | D. Mitchell [25] | 2000 |
| Gram-2 | P. graminicola | pepper | FL, USA | D. Mitchell [25] | 2000 |
| Aphan-4 | P. aphanidermatum | pepper | FL, USA | D. Mitchell [25] | 2000 |
| G-1 | P. periilum | pepper | FL, USA | D. Mitchell [25] | 2000 |
| Arrhen-3 | P. arrhenomanes | tomato | FL, USA | D. Mitchell [25] | 2000 |
| Myrio-14 | P. myriotylum | pepper | FL, USA | D. Mitchell [25] | 2000 |
| Peri-13 | P. periplocum | tomato | FL, USA | D. Mitchell [25] | 2000 |
| Ulti-2 | P. ultimum | tomato | FL, USA | D. Mitchell [25] | 2000 |
| Irre-2 | P. irregulare | tomato | FL, USA | D. Mitchell | 2000 |
| Isolate | Species | Host | Location | Source | Year |
| P2428 | P. cinnamomi | avocado | CA, USA | M.D. Coffey [7] | 1986 |
| Pn23 | P. nicotianae | tobacco | FL, USA | DPI | 1985 |
| P1391 | P. infestans | potato | CA, USA | M.D. Coffey [7] | 1986 |
| P12 | P. palmivora | cacao | Costa Rica | ATCC 26200 | 1986 |
| P1321 | P. citricola | citrus | CA, USA | M.D. Coffey [7] | 1986 |
| Cp-32 | P. capsici | pepper | FL, USA | D. Mitchell [25] | 1998 |
| P1324 | P. citrophthora | citrus | CA, USA | M.D. Coffey [7] | 1986 |
| Hv-2 | P. hevea | cacao root | Brazil | E.D. Luz | 1989 |
| Heli-1 | P. helicoides | pepper | FL, USA | D. Mitchell [25] | 2000 |
| Caten-9 | P. catenulatum | tomato | FL, USA | D. Mitchell [25] | 2000 |
| Gram-2 | P. graminicola | pepper | FL, USA | D. Mitchell [25] | 2000 |
| Aphan-4 | P. aphanidermatum | pepper | FL, USA | D. Mitchell [25] | 2000 |
| G-1 | P. periilum | pepper | FL, USA | D. Mitchell [25] | 2000 |
| Arrhen-3 | P. arrhenomanes | tomato | FL, USA | D. Mitchell [25] | 2000 |
| Myrio-14 | P. myriotylum | pepper | FL, USA | D. Mitchell [25] | 2000 |
| Peri-13 | P. periplocum | tomato | FL, USA | D. Mitchell [25] | 2000 |
| Ulti-2 | P. ultimum | tomato | FL, USA | D. Mitchell [25] | 2000 |
| Irre-2 | P. irregulare | tomato | FL, USA | D. Mitchell | 2000 |
For DNA extraction, the fungi were grown at 24°C in 10-ml still cultures of V8 juice broth. Approximately 1.0 mg of fresh mycelium was added to a 1.5-ml microfuge tube containing 50 μl of a solution of 20 mM Tris–HCl (pH 8.5), 2 mM EDTA, and 1% Triton X-100. The suspension was vortexed for 60 s and then frozen in liquid nitrogen. The tube was then boiled for 15 min, cooled on ice for 2 min and pulsed-centrifuged to pellet the mycelial matter at the bottom of the tube. The supernatant was used as a template for the PCR reactions [19].
2.2 Ribosomal DNA amplification for PCR ELISA and sequencing
1 μl of the DNA extract from the mycelium was used as template for the PCR amplification of the ITS1 region. PCR reactions in 50-μl samples were carried out by adding the following mixture to each sample in a 500-μl tube: 5 μl of 10× PCR buffer, 4 μl of 25 mM MgCl2, 5 μl of a 0.2-mM dNTP mixture containing DIG (final concentration 0.01 mM, replacing an equal amount of TTP), 32.7 μl of sterile water, 0.3 μl of taq DNA polymerase and 1 μl each of 10 μM forward and reverse primers specifically designed ([19] and this research) to amplify the ITS1 region of both Phytophthora and Pythium (Table 2). The tubes were incubated for 2 min at 92°C, and then subjected to 40 cycles of 30 s at 92°C, 45 s at 54°C, and 1 min at 72°C. A final incubation at 72°C was carried out for 10 min.
The numbers and sequences of the oligonucleotide primers and the species specific capture probes developed and used in this study
| Species | Oligo # | Nucleotide sequence |
| Phytophthora/Pythium (forward) | 3 | 5′-GTTTCCGTAGGTGAACCTGC |
| Phytophthora/Pythium (reverse) | 26 | 5′-TAGACATCCACTGCTGAAAGTT |
| P. cinnamomi | 12 | 5′-ACGGTTGTCTGTTGCGTGGG |
| P. nicotianae | 16 | 5′-TGAGCCCCACCAAAAAAAAG |
| P. infestans | 27 | 5′-TCTTACTTGGCGGCGG |
| P. palmivora | 13 | 5′-TCTGAACTAGTAGCTTTTTTAA |
| P. citricola | 14 | 5′-CTTTTTTGCGAGCCCTAT |
| P. capsici | 17 | 5′-AAACCCATTTCACAATTCTGAT |
| P. citrophthora | 15 | 5′-TTTGCTGAGCCACGCCCTAT |
| P. hevea | 28 | 5′-AGTTTGGCTGCTGTT |
| P. helicoides | 35 | 5′-TGCGTTTTCTCTCTCTT |
| P. catenulatum | 25 | 5′-AAGGTAGAGCTGCATGTAAAA |
| P. graminicola | 34 | 5′-GCTGCATGTATGTGTA |
| P. aphanidermatum | 18 | 5′-GCTGCTTAATTGTAGTCTGCC |
| P. periilum | 33 | 5′-GGAGCCATTTGTTTG |
| P. arrhenomanes | 21 | 5′-TTGTCCGCAAGTGTAGTTAAT |
| P. myriotylum | 24 | 5′-AAGGTGGGCTGCTGTTATG |
| P. periplocum | 23 | 5′-CTTCTTGTAAGATTTGAGG |
| P. ultimum | 20 | 5′-TTTGGACACTGGAACGGGAGT |
| P. irregulare | 19 | 5′-CGTGTTGGTAGCATGCGTGT |
| Species | Oligo # | Nucleotide sequence |
| Phytophthora/Pythium (forward) | 3 | 5′-GTTTCCGTAGGTGAACCTGC |
| Phytophthora/Pythium (reverse) | 26 | 5′-TAGACATCCACTGCTGAAAGTT |
| P. cinnamomi | 12 | 5′-ACGGTTGTCTGTTGCGTGGG |
| P. nicotianae | 16 | 5′-TGAGCCCCACCAAAAAAAAG |
| P. infestans | 27 | 5′-TCTTACTTGGCGGCGG |
| P. palmivora | 13 | 5′-TCTGAACTAGTAGCTTTTTTAA |
| P. citricola | 14 | 5′-CTTTTTTGCGAGCCCTAT |
| P. capsici | 17 | 5′-AAACCCATTTCACAATTCTGAT |
| P. citrophthora | 15 | 5′-TTTGCTGAGCCACGCCCTAT |
| P. hevea | 28 | 5′-AGTTTGGCTGCTGTT |
| P. helicoides | 35 | 5′-TGCGTTTTCTCTCTCTT |
| P. catenulatum | 25 | 5′-AAGGTAGAGCTGCATGTAAAA |
| P. graminicola | 34 | 5′-GCTGCATGTATGTGTA |
| P. aphanidermatum | 18 | 5′-GCTGCTTAATTGTAGTCTGCC |
| P. periilum | 33 | 5′-GGAGCCATTTGTTTG |
| P. arrhenomanes | 21 | 5′-TTGTCCGCAAGTGTAGTTAAT |
| P. myriotylum | 24 | 5′-AAGGTGGGCTGCTGTTATG |
| P. periplocum | 23 | 5′-CTTCTTGTAAGATTTGAGG |
| P. ultimum | 20 | 5′-TTTGGACACTGGAACGGGAGT |
| P. irregulare | 19 | 5′-CGTGTTGGTAGCATGCGTGT |
Bold and underlined letters at the 5′ ends of the capture probes indicate the nucleotide biotinylated for binding to the streptavidin-coated microtiter plate.
The numbers and sequences of the oligonucleotide primers and the species specific capture probes developed and used in this study
| Species | Oligo # | Nucleotide sequence |
| Phytophthora/Pythium (forward) | 3 | 5′-GTTTCCGTAGGTGAACCTGC |
| Phytophthora/Pythium (reverse) | 26 | 5′-TAGACATCCACTGCTGAAAGTT |
| P. cinnamomi | 12 | 5′-ACGGTTGTCTGTTGCGTGGG |
| P. nicotianae | 16 | 5′-TGAGCCCCACCAAAAAAAAG |
| P. infestans | 27 | 5′-TCTTACTTGGCGGCGG |
| P. palmivora | 13 | 5′-TCTGAACTAGTAGCTTTTTTAA |
| P. citricola | 14 | 5′-CTTTTTTGCGAGCCCTAT |
| P. capsici | 17 | 5′-AAACCCATTTCACAATTCTGAT |
| P. citrophthora | 15 | 5′-TTTGCTGAGCCACGCCCTAT |
| P. hevea | 28 | 5′-AGTTTGGCTGCTGTT |
| P. helicoides | 35 | 5′-TGCGTTTTCTCTCTCTT |
| P. catenulatum | 25 | 5′-AAGGTAGAGCTGCATGTAAAA |
| P. graminicola | 34 | 5′-GCTGCATGTATGTGTA |
| P. aphanidermatum | 18 | 5′-GCTGCTTAATTGTAGTCTGCC |
| P. periilum | 33 | 5′-GGAGCCATTTGTTTG |
| P. arrhenomanes | 21 | 5′-TTGTCCGCAAGTGTAGTTAAT |
| P. myriotylum | 24 | 5′-AAGGTGGGCTGCTGTTATG |
| P. periplocum | 23 | 5′-CTTCTTGTAAGATTTGAGG |
| P. ultimum | 20 | 5′-TTTGGACACTGGAACGGGAGT |
| P. irregulare | 19 | 5′-CGTGTTGGTAGCATGCGTGT |
| Species | Oligo # | Nucleotide sequence |
| Phytophthora/Pythium (forward) | 3 | 5′-GTTTCCGTAGGTGAACCTGC |
| Phytophthora/Pythium (reverse) | 26 | 5′-TAGACATCCACTGCTGAAAGTT |
| P. cinnamomi | 12 | 5′-ACGGTTGTCTGTTGCGTGGG |
| P. nicotianae | 16 | 5′-TGAGCCCCACCAAAAAAAAG |
| P. infestans | 27 | 5′-TCTTACTTGGCGGCGG |
| P. palmivora | 13 | 5′-TCTGAACTAGTAGCTTTTTTAA |
| P. citricola | 14 | 5′-CTTTTTTGCGAGCCCTAT |
| P. capsici | 17 | 5′-AAACCCATTTCACAATTCTGAT |
| P. citrophthora | 15 | 5′-TTTGCTGAGCCACGCCCTAT |
| P. hevea | 28 | 5′-AGTTTGGCTGCTGTT |
| P. helicoides | 35 | 5′-TGCGTTTTCTCTCTCTT |
| P. catenulatum | 25 | 5′-AAGGTAGAGCTGCATGTAAAA |
| P. graminicola | 34 | 5′-GCTGCATGTATGTGTA |
| P. aphanidermatum | 18 | 5′-GCTGCTTAATTGTAGTCTGCC |
| P. periilum | 33 | 5′-GGAGCCATTTGTTTG |
| P. arrhenomanes | 21 | 5′-TTGTCCGCAAGTGTAGTTAAT |
| P. myriotylum | 24 | 5′-AAGGTGGGCTGCTGTTATG |
| P. periplocum | 23 | 5′-CTTCTTGTAAGATTTGAGG |
| P. ultimum | 20 | 5′-TTTGGACACTGGAACGGGAGT |
| P. irregulare | 19 | 5′-CGTGTTGGTAGCATGCGTGT |
Bold and underlined letters at the 5′ ends of the capture probes indicate the nucleotide biotinylated for binding to the streptavidin-coated microtiter plate.
To prepare the ITS1s for sequencing, the PCR reactions were performed as above except that 2 μl of the dNTP mixture without DIG and 5 μl of 25 mM MgCl2 were added. For both sequencing and hybridization, the PCR products were column-purified after agarose gel electrophoresis using the Quiaquick gel extraction kit (Qiagen). Direct sequencing of the PCR products was initiated using the forward primer (GTTTCCGTAGGTGAACCTGC) and the fluorescent dideoxy terminator method of cycle sequencing on a Model 377 ABI Prism automated DNA sequencer. Chromatograms of the sequences were analyzed using the program Sequencer 4.0.2 (Gene Codes Corporation). Ribosomal DNA fragments were aligned for analysis using the program Clustal X 1.8 [20]. The Rnadraw 1.1 program (Mazura Multimedia) was used to design the biotin-labeled capture probes without secondary structure. The capture probes developed and used are shown in Table 2.
The ITS1 regions of at least three different isolates were sequenced for each Phytophthora and Pythium species used in this study. Their sequences were in complete agreement with those of GenBank, except for Phytophthora hevea, whose ITS1 sequence was not reported previously. The GenBank accession numbers for the previously reported species are: Phytophthora capsici AF242821, P. cinnamomi AF242795, P. citrophthora AF242787, P. citricola AF242786, P. infestans AF242793, P. nicotianae L41383 and P. palmivora L41384; Pythium aphanidermatum AF016501, P. arrhenomanes AJ233439, P. catenulatum AF290847, P. graminicola AF271229, P. helicoides AF24289, P. irregulare AJ233448, P. myriotylum AF310334, P. periilum AF203785, P. periplocum AJ233455 and P. ultimum AF016500. The sequence we obtained for the ITS1 region for P. hevea was submitted to GenBank as accession number AF416484.
2.3 Colorimetric detection of DIG-labeled PCR products
PCR product detection was performed using slight modifications of the Roche Biochemicals PCR ELISA kit protocol [11]. This included shaking of the microtiter plates (Immunalon 2HB, Dynatec) at 37°C and 400 rpm for all incubations. The plates were coated with streptavidin (10 ng ml−1, 100 μl per well) in carbonate buffer (1.59 g Na2CO3 and 2.93 g NaHCO3 l−1, pH 9.6) overnight at 4°C or 1.5 h at 37°C. The plates were then washed three times in PBST (PBS with 0.05% Tween 20; PBS is 8.0 g NaCl, 0.20 g KH2PO4, 1.15 g Na2HPO4 and 0.20 g KCl l−1, pH 7.4). Plates were then treated with blocking buffer [PBS with 0.10% Tween 20 and 0.2% bovine serum albumin (BSA)] for 30 min at 37°C, washed three times in PBST, and incubated with capture probes specific for species of Phytophthora or Pythium (200 ng per well) for 30 min at 37°C in 100 μl of hybridization buffer [5× SSPE (43.8 g NaCl, 6.90 g NaH2PO4, 1.85 g EDTA l−1, pH 7.4), 0.1%n-lauroylsarcosine, 0.5 M NaCl, final pH 6.5], and washed three times with PBST. Then 30 μl of the purified PCR amplified DIG-labeled product was denatured by adding the product to 30 μl of denaturing buffer (0.2 M NaOH, 1.5 M NaCl) and incubated for 10 min at room temperature, followed by the addition of 340 μl of hybridization buffer. Then 100 μl of the mixture was added to each well and incubated at 37°C for at least 3 h, or overnight. The plates were washed three times with PBST and incubated for 30 min at 37°C with 100 μl per well of 0.075 U ml−1 anti-digoxygenin f(ab′)2 fragments conjugated to alkaline phosphatase in loading buffer (1× PBS containing 0.05% Tween 20, 2% polyvinylpyrrolidone, 0.2% BSA). The plates were then washed three times with PBST and incubated at 37°C with the colorimetric substrate (0.75 mg ml−1 of p-nitrophenyl phosphate in 9.5% diethanolamine, pH 9.8) for 1–2 h. Color development was then quantitated at 405 nm in a microtiter plate reader (Bio-Rad Model 550).
3 Results and discussion
The ITS1 regions of various species of Phytophthora and Pythium (Table 1) were amplified by PCR using two primers especially designed to amplify the ITS1 of both genera (Table 2). The resulting PCR product was a fragment of approximately 240 bp for all species analyzed. Fig. 1 shows the alignment of the ITS1 sequences of the different species studied. The black and gray boxed areas indicate the level of homology among the sequences. There was a high degree of sequence variability or sequence microheterogeneity in the ITS1 fragments, and this was used to design capture probes theoretically capable of distinguishing the fungi at the species level.
Nucleotide sequence alignment of the ITS1 regions of eight species of Phytophthora (cinnamomi to hevea) and 10 species of Pythium (helicoides to irregulare). The consensus sequence is shown at the bottom. Dashes indicate gaps in the sequence; black boxed areas indicate sequence identity and gray boxed areas indicate sequence variability.
Nucleotide sequence alignment of the ITS1 regions of eight species of Phytophthora (cinnamomi to hevea) and 10 species of Pythium (helicoides to irregulare). The consensus sequence is shown at the bottom. Dashes indicate gaps in the sequence; black boxed areas indicate sequence identity and gray boxed areas indicate sequence variability.
To test the specificity of the ITS1 sequence-derived capture probes in PCR ELISA, the amplified ITS1 DNAs of the species of Phytophthora and Pythium were hybridized individually and in combinations against all of the capture probes. Fig. 2 shows the visual results of a typical PCR ELISA experiment with three representative species each of Phytophthora and Pythium and all of their capture probes. Specific positive reactions occurred between each of the fungal species and its own capture probe (wells A2, B3, C4, D5, E6 and F7); no false positives were observed, as exemplified in wells F2–F6, and the background was very low, as exemplified in columns 1 and 8 (Fig. 2), and Table 3. Furthermore, PCR ELISA was capable of detecting and correctly identifying known mixtures of the DNA of each of two species of Pythium and of Phytophthora when reacted with their individual capture probes, wells G2 and G4, and also wells H5 and H7, respectively (Fig. 2). However, to routinely obtain this sensitivity and specificity it was necessary to gel and column purify the amplified DIG-labeled DNA as recommended [11].
PCR ELISA reactions of the DIG-labeled amplified DNA of the ITS1 regions of three species of Pythium (P. aphanidermatum, P. arrhenomanes and P. myriotylum) and three species of Phytophthora (P. palmivora, P. capsici and P. infestans) and mixtures of the DNAs of two Pythium species (P. aphanidermatum and P. myriotylum) and two Phytophthora species (P. palmivora and P. infestans) with their homologous and heterologous capture probes. The DNA samples were placed horizontally in rows A through H. The capture probe numbers are shown above the plate. They were placed vertically in columns 2 through 7. Column N received neither capture probe nor DIG-labeled DNA. Column 0 received the DIG-labeled DNAs, but no capture probes.
PCR ELISA reactions of the DIG-labeled amplified DNA of the ITS1 regions of three species of Pythium (P. aphanidermatum, P. arrhenomanes and P. myriotylum) and three species of Phytophthora (P. palmivora, P. capsici and P. infestans) and mixtures of the DNAs of two Pythium species (P. aphanidermatum and P. myriotylum) and two Phytophthora species (P. palmivora and P. infestans) with their homologous and heterologous capture probes. The DNA samples were placed horizontally in rows A through H. The capture probe numbers are shown above the plate. They were placed vertically in columns 2 through 7. Column N received neither capture probe nor DIG-labeled DNA. Column 0 received the DIG-labeled DNAs, but no capture probes.
Quantitative results of the PCR ELISA reactions shown in Fig. 2
| Fungal speciesa | Well numberb | A405 nm |
| P. aphanidermatum | A2 | 1.35 |
| P. arrhenomanes | B3 | 1.52 |
| P. myriotylum | C4 | 1.32 |
| P. palmivora | D5 | 1.76 |
| P. capsici | E6 | 1.91 |
| P. infestans | F7 | 1.43 |
| P. aphanidermatum+P. myriotylum | G2, G4 | 0.82/0.53 |
| P. palmivora+P. infestans | H5, H7 | 0.81/0.72 |
| +Probe controls | all wells except column 1 | 0.03 |
| −Probe controls | all wells of column 1 | 0.01 |
| Fungal speciesa | Well numberb | A405 nm |
| P. aphanidermatum | A2 | 1.35 |
| P. arrhenomanes | B3 | 1.52 |
| P. myriotylum | C4 | 1.32 |
| P. palmivora | D5 | 1.76 |
| P. capsici | E6 | 1.91 |
| P. infestans | F7 | 1.43 |
| P. aphanidermatum+P. myriotylum | G2, G4 | 0.82/0.53 |
| P. palmivora+P. infestans | H5, H7 | 0.81/0.72 |
| +Probe controls | all wells except column 1 | 0.03 |
| −Probe controls | all wells of column 1 | 0.01 |
aIndicates the ITS1 DNA sample and capture probe which were used in the PCR ELISA reaction. Where two species are listed, as exemplified by P. aphanidermatum and P. myriotylum, the DNAs were mixed equally and reacted with both capture probes.
bWell number refers to the wells in the microtiter plate in Fig. 2.
Quantitative results of the PCR ELISA reactions shown in Fig. 2
| Fungal speciesa | Well numberb | A405 nm |
| P. aphanidermatum | A2 | 1.35 |
| P. arrhenomanes | B3 | 1.52 |
| P. myriotylum | C4 | 1.32 |
| P. palmivora | D5 | 1.76 |
| P. capsici | E6 | 1.91 |
| P. infestans | F7 | 1.43 |
| P. aphanidermatum+P. myriotylum | G2, G4 | 0.82/0.53 |
| P. palmivora+P. infestans | H5, H7 | 0.81/0.72 |
| +Probe controls | all wells except column 1 | 0.03 |
| −Probe controls | all wells of column 1 | 0.01 |
| Fungal speciesa | Well numberb | A405 nm |
| P. aphanidermatum | A2 | 1.35 |
| P. arrhenomanes | B3 | 1.52 |
| P. myriotylum | C4 | 1.32 |
| P. palmivora | D5 | 1.76 |
| P. capsici | E6 | 1.91 |
| P. infestans | F7 | 1.43 |
| P. aphanidermatum+P. myriotylum | G2, G4 | 0.82/0.53 |
| P. palmivora+P. infestans | H5, H7 | 0.81/0.72 |
| +Probe controls | all wells except column 1 | 0.03 |
| −Probe controls | all wells of column 1 | 0.01 |
aIndicates the ITS1 DNA sample and capture probe which were used in the PCR ELISA reaction. Where two species are listed, as exemplified by P. aphanidermatum and P. myriotylum, the DNAs were mixed equally and reacted with both capture probes.
bWell number refers to the wells in the microtiter plate in Fig. 2.
As demonstrated here, PCR ELISA has the capability to detect, identify and clearly differentiate among species of Pythium and Phytophthora using sequence microheterogeneities in their ITS1 regions. The smallest possible sequence microheterogeneity is one nucleotide, and a single nucleotide difference has been shown to be adequate for differentiating tRNA species [21] and strains of citrus tristeza virus (CTV) [22] by standard hybridization methods. Grimm and Geisen [16] demonstrated the ability of PCR ELISA to distinguish potential fumonisin-producing Fusarium species from non-producing species with only minor nucleotide differences in their ITS1 regions, and Nolasco et al. have used PCR ELISA and fluorescent assays [12,23,24] to distinguish among several strains of CTV with only one or two nucleotide differences. Therefore, with the proper design of the capture probes, we expect that PCR ELISA can be used to routinely identify and differentiate between any two nucleic acids having such microheterogeneities.
PCR ELISA is a very ‘user friendly’ technique because it is simple and sensitive, and it uses commonly available reagents and equipment. The majority of the steps occur in the 96-well microtiter plate, and gel electrophoresis and blot hybridization steps are eliminated. This enables the simultaneous assay of large numbers of samples and their simultaneous testing with several probes, versus repeated tests with single probes in conventional hybridization. Another advantage of PCR ELISA is that all samples are assayed under identical hybridization conditions, in comparison with reverse dot blots to identify species of Pythium and Phytophthora where standardization of the melting temperatures of all the oligonucleotides was a major technical difficulty [8].
Gaining additional confidence with PCR ELISA for the routine detection and identification of species of Pythium and Phytophthora using ITS1 sequences may reduce or eliminate the need for inducing multiple spore forms and characters in culture and basing identification solely on morphometrics. Many species are delineated on minor and quantitative differences, and often it is difficult to obtain all reproductive structures, especially with heterothallic species that require pairing of compatibility types for oospore formation. Identification using PCR ELISA could greatly facilitate ecological and epidemiological studies, especially of heterothallic species, by enabling rapid and accurate species identification. As an example, only four of 10 species of Pythium isolated from bell pepper roots in Florida fields caused significant root rot [25], and, because up to nine species may be isolated in one sampling, the rapid and efficient differentiation of root-rotting species from non-pathogens would facilitate both epidemiological studies and disease-management decisions. An advantage of using ITS1 regions or other ribosomal DNA sequences is that they are highly repeated, providing greater sensitivity than tests based on single copy sequences. If the ITS1 region does not contain sufficient microheterogeneity for capture probe selection, as with Fusarium spp. [16], then other regions of the ribosomal DNA, or even a single gene, could be selected. Because of our earlier experience with the cutinase gene of Phytophthora[26], we investigated the use of its sequence to distinguish among species of Pythium and Phytophthora by PCR ELISA. We sequenced the cutinase genes of 11 Pythium and nine Phytophthora species. However, there was insufficient interspecific or intergeneric sequence microheterogeneity among those sequences for them to be used for development of capture probes.
PCR ELISA, by combining the specificity and sensitivity of both PCR and ELISA, has the potential to provide reliable identification of both routine and ambiguous pathogens, as well as mixtures of pathogens. This accurate information is critical for disease diagnosis and epidemiological studies for both research and for essential applications in international trade and quarantine or regulatory programs.


