Effectiveness of the lactococcal abortive infection systems AbiA, AbiE, AbiF and AbiG against P335 type phages

Abstract

Four lactococcal abortive infection mechanisms were introduced into strains which were sensitive hosts for P335 type phages and plaque assay experiments performed to assess their effect on five lactococcal bacteriophages from this family. Results indicate that AbiA inhibits all five P335 phages tested, while AbiG affects φP335 itself and φQ30 but not the other P335 species phages. AbiA was shown to retard phage Q30 DNA replication as previously reported for other phages. It was also demonstrated that AbiG, previously shown to act at a point after DNA replication in the cases of c2 type and 936 type phages, acts at the level of, or prior to phage Q30 DNA replication. AbiE and AbiF had no effect on the P335 type phages examined.

P335, AbiA, AbiE, AbiF, AbiG, Abortive infection mechanism

1 Introduction

The susceptibility of lactococcal starter cultures to the action of a wide variety of bacteriophages is of considerable economic importance within the dairy fermentation industry. Bacteriophage infection is considered to be the most significant cause of decreased starter activity in commercial practice, with lytic lactococcal phages cited as the primary cause of fermentation failures [1,2]. The means by which the industry has addressed the phage problem has included the use of both physical barriers and biological precautions. The latter have largely focused on the selection and use of naturally resistant strains of lactococci and the nature of these resistance systems has been studied extensively [3,,5]. Four principal naturally occurring phage resistance mechanisms have been described for Lactococcus species to date: adsorption inhibition, phage DNA penetration blocking, restriction–modification and abortive infection (for reviews see [1,5,6]). Of these mechanisms, it has been suggested that abortive infection (Abi) is the most powerful[7].

Lactococcal phages have been classified into 12 groups on the basis of morphology and DNA homology[8]. Two of these species are most commonly found in dairy fermentations, i.e. the small isometric-headed 936 species (particularly in New Zealand, the USA and Ireland) [9,,11] and the more virulent but less prevalent prolate-headed c2 species, while members of a third species (P335) have been isolated with increasing frequency [10,11]. This latter species includes both virulent and temperate types.

Whereas all lactococcal Abi mechanisms published to date have been demonstrated to be effective against 936 type phages, only AbiA, AbiC, AbiK and AbiU are known to have an effect on members of the P335 family [12,,,15]. AbiA provides resistance to all three of the phage types mentioned and is described as an ‘early acting’ mechanism since it interferes with phage DNA replication within the host in the case of the P335 type φ31 [12,16]. AbiK has been shown to be highly effective against P335 species, preventing both phage ul36 and phage P335 DNA replication [14,17]. However, the DNA replication of phages p2 and p008 of the 936 group, which are also sensitive to AbiK, was shown to be unaffected in its presence, providing the first report of different phage responses towards an Abi system[14].

A P335 phage/host interaction system was not available at the time of the initial discovery of the AbiE, AbiF and AbiG mechanisms in this laboratory; hence, these have previously been tested only against phages of the 936 and c2 species. Due to the increasing prevalence of P335 type phages in milk fermentations in Ireland (A. Forde, personal communication) and elsewhere [10,11] and because of the more recent availability of phage/host systems with which the interaction between these mechanisms and P335 type phages can be examined, a study was undertaken to assess their effectiveness against several members of this phage family, and to partially characterise any observed effects.

2 Materials and methods

2.1 Bacterial strains, bacteriophages and plasmids

The bacterial strains, bacteriophages and plasmids used in this study are listed in Table 1. Lactococcal strains were grown at 30°C in M17 medium[23] containing 0.5% glucose. Stocks of all cultures were maintained at −20°C in their growth medium containing 15% glycerol. Bacteriophages were propagated on their homologous hosts at 30°C in GM17 broth. Plasmids were transformed into competent cells with the Bio-Rad Gene Pulser apparatus (Bio-Rad Corp., Richmond, CA, USA) using the conditions outlined in the Bio-Rad manual. Positive selection of recombinant plasmids was effected using chloramphenicol (Cm, 10 μg ml⁻¹).

1

Bacterial strains, bacteriophages and plasmids

Strain/phage		Source or Ref.
L. lactis ssp. lactis var. diacetylactis F7/2		[18]
L. lactis ssp. cremoris SMQ-86 (UL8/pSA3)		[17]
P335 phages
P335 and P013	small isometric-headed lytic phages for host F7/2	[18]
ul36, Q30 and Q33	small isometric-headed lytic phages for host SMQ-86	[11,19]
Plasmids
pMG36CT	E. coli/lactococcal shuttle vector, Cmr	[20]
pMGA	2.2-kb abiA PCR fragment cloned into the Bam HI/Hin dIII sites of pMG36CT	This study
pPG01	pAM401/abiE	[21]
pCG1	pAM401/abiF	[21]
pCI735	pAM401/abiG	[22]

2.2 Bacteriophage plaque assays

Bacteriophage plaque assays were performed by adding 0.1 ml of an overnight culture, 0.1 ml of 0.185 M CaCl₂ and 0.1 ml of the appropriate phage dilution to 3 ml of sloppy GM17 agar (0.7%) and overlaying onto prepoured GM17 agar (1.5%) plates. Plates were incubated at 30°C.

2.3 Restriction endonucleases, polymerase chain reaction and molecular techniques

Restriction endonucleases were purchased from Roche Diagnostics Ltd. (East Sussex, UK) and utilised according to the manufacturer's instructions. Lactococcal plasmid DNA for use as template in polymerase chain reactions was isolated as described by Anderson and McKay[24]. Oligonucleotide primers (Table 2) were synthesised using an Applied Biosystems PCR-MATE DNA synthesiser (Applied Biosystems Inc., Foster City, CA, USA). PCR reagents were purchased from Promega (Madison, WI, USA) and reactions were executed using an Omnigene thermal cycler (Hybaid Ltd., Middlesex, UK). The annealing temperatures for PCR programmes varied according to the melting temperatures of the specific primers used. PCR products were separated on agarose gels in TAE buffer (40 mM Tris–acetate, 1 mM EDTA), stained with ethidium bromide, and visualised under UV light and photographed using a UVP Imagestore 5000 gel documentation system (UV Products Ltd., Cambridge, UK). DNA was transferred from agarose gels to nylon membranes (Hybond N⁺, Amersham International, Bucks., UK) by the method of Southern[25] as modified by Wahl et al.[26]. DNA was labelled using the enhanced chemiluminescence (ECL) gene detection system (Amersham International, Bucks., UK). Probe labelling, hybridisation conditions and washing steps were performed according to the instructions issued by the manufacturer (Amersham International, Bucks., UK). DNA molecular weight markers M.W. IX was purchased from Roche Diagnostics.

2

Oligonucleotide primers used in this study

Primer	Sequence	Size (bp)
AbiA (Fwd)	GTGGATCCAACTATAGAGACATT
AbiA (Rev)	CGCAAGCTTACATACGATATAAGAACGACT	2191
AbiE (Fwd)	AACTGCAGTGTATACGCCATGATTCAGGA
AbiE (Rev)	ATGATCAGGAATTGAAGGATACAAGT	1856
AbiF (Fwd)	TAGGATCCATTATACATTGAAAAAGTCCT
AbiF (Rev)	TACAAGCTTTCTAAGACTTAAGGCTGA	1375
AbiG (Fwd)	CTCTGCAGCTTAGTGCTAATG
AbiG (Rev)	ATGATCATAGTTCTTGATAACTAATCTA	2050
P335A	GAAGCTAGGCGAATCAGTAA
P335B	GATTGCCATTTGCGCTCTGA	682
AbiAf	CATCTAGTAGATACAGAC
AbiAr	ATCAGCATTAACAGACAT	518
AbiEif	CTCTCAACCTATTTAGTAGAC
AbiEir	GAGACCTAAAAAGCTATTTAC	500
AbiEiif	GATACAGCTCTGATAGACTTT
AbiEiir	TTCATCAATAAATTGAGTTGG	500
AbiFf	GATAATGAAGGAATTACA
AbiFr	TACATTTACAGCCTTTAA	515
AbiGif	TGTCATATCATGCAGAGG
AbiGir	ATCTGATATCTGATACAC	479
AbiGiif	AGGAGAAGTTGGCAAGCA
AbiGiir	TACAACTCTATCATTAAT	501

Primers designated Abi (Fwd/Rev) were used in the amplification of abi genes from L. lactis transformants. The P335 primers were employed to confirm that phages in the study were of the P335 species. The Abi f/r primers were used for RT-PCR amplification of abi transcripts in L. lactis hosts. Expected product sizes are also indicated.

2.4 Intracellular phage DNA replication

Replication of phage DNA within the sensitive and resistant hosts was compared using the method described by Hill et al.[12]. Phages were used to infect cells at a multiplicity of infection greater than one (m.o.i. >1) and samples were taken at specific time intervals after infection until the sensitive host had lysed. Extracted DNA samples were digested with Eco RI. Digested DNA was electrophoresed on 0.7% agarose gels and subsequently transferred to nylon membranes, before probing with φQ30 DNA using the ECL detection system.

2.5 RNA isolation and cDNA synthesis

Total cellular RNA was isolated from 0.5 ml overnight cultures using the Purescript RNA isolation kit (Gentra Systems, Minneapolis, MN, USA). RNA suspensions were treated with DNase (Roche Diagnostics) at 37°C for 30 min before denaturing at 70°C for 10 min. 3 μl samples were used as template in reverse transcription reactions with AMV reverse transcriptase purchased from Roche Diagnostics. 2 μl of the resulting cDNA were used as template in PCR reactions.

3 Results

Previously constructed recombinant plasmids carrying the abiE, abiF and abiG abortive infection genes are listed in Table 1. A 2191-bp PCR fragment corresponding to abiA was amplified from pCI829[27], and cloned into the Bam HI/Hin dIII sites of the Escherichia coli/lactococcal shuttle vector pMG36CT[20], followed by sequencing of the insert to ensure that no alteration in the DNA sequence had occurred during the course of PCR amplification. The different Abi plasmids were then introduced via electroporation into Lactococcus lactis ssp. lactis var. diacetylactis F7/2 (homologous host for phages P335 and P013) and L. lactis ssp. cremoris SMQ-86 (homologous host for phages ul36, Q30 and Q33). While no transformants could be obtained following electroporation of pPG01 (AbiE) into L. lactis ssp. lactis var. diacetylactis F7/2, frequencies ranging from 7.0×10² to 4.1×10⁵ transformants per μg DNA were observed in the cases of the remaining electroporations (data not shown). PCR reactions using primers specific for abiA, abiE, abiF or abiG indicated that abortive infection genes of these types were absent in original strains, but present in transformants, i.e. SMQ-86/AbiA, SMQ-86/AbiE, SMQ-86/AbiF, SMQ-86/AbiG, or F7/2/AbiA, F7/2/AbiF and F7/2/AbiG (data not shown).

Plaque assay experiments assessing the effectiveness of the Abi-harbouring SMQ-86 and F7/2 hosts against P335 type phages indicated that AbiA inhibits all P335 phages tested to varying degrees, with accompanying reductions in plaque sizes. Infection of the AbiA-containing strain F7/2 with φP335 itself and φP013 resulted in EOP values of 7.6×10⁻³ and 3.3×10⁻⁷, respectively; φQ30 and φul36 formed plaques on the SMQ-86/AbiA host with efficiencies of 1.63×10⁻⁶ and 9.4×10⁻³ while no plaques were observed when this derivative was challenged with φQ33 at a titre of 10⁵ pfu ml⁻¹. AbiG was found to be partially effective against two of the five phages tested, offering protection to F7/2 against φP335 itself and to SMQ-86 against φQ30 with resultant EOPs of 5.6×10⁻³ and 10⁻⁴, respectively; there is also an accompanying reduction in plaque sizes in both cases. Neither AbiE nor AbiF conferred any resistance on the SMQ-86 strain, nor did AbiF on the F7/2 strain to the P335 species phages tested.

PCR reactions using primers specific for this species[2] confirmed that all plaques observed on sensitive or Abi-harbouring strains post infection were in fact due to P335 type phages (data not shown). Furthermore, restriction patterns confirmed that the five phages used in this study represent different P335 phages (data not shown).

In order to rule out the possibility that the failure of some of the Abi mechanisms to inhibit P335 phages could be due to loss of transcriptional ability in novel hosts, Abi gene transcription was assessed using RTPCR methods. cDNA was synthesised in a reverse transcription reaction using total RNA isolated from putative Abi transformant cultures and the appropriate forward PCR primer listed in Table 2. Fragments corresponding to approximately 500-bp sequences internal to the abiE and abiF (as well as the abiA and abiG) open reading frames (ORFs) were successfully amplified from resultant cDNA by PCR (Fig. 1). This result indicates that mRNA could be detected for each of the abi genes, which confirms their expression.

1

Results of RT-PCR reactions to detect products specific for Abi transcripts using total cellular RNA from L. lactis ssp. lactis var. diacetylactis F7/2 or L. lactis ssp. cremoris SMQ-86+/−Abi.

The replication of phage DNA in SMQ-86 hosts in the presence or absence of AbiA was assessed at time intervals following phage Q30 infection (Fig. 2A). Normal phage DNA replication could be seen in the sensitive SMQ-86 cells, where phage DNA was detected after 15 min, increasing to a peak concentration at 45 min, before rapidly decreasing to an almost undetectable quantity at 80 min. This reduction most likely indicates packaging and release of progeny phage. Culture lysis was also observed by this time. In SMQ-86 cells containing AbiA, phage DNA was also detected at 15 min but there was essentially no change in concentration detected from 30 to 80 min, indicating the significant reduction or absence of replication activity and a failure to package and release progeny. In addition, no lysis of this culture was observed.

2

φQ30 DNA replication in (A) L. lactis ssp. cremoris SMQ-86 and L. lactis ssp. cremoris SMQ-86/AbiA, or (B) L. lactis ssp. cremoris SMQ86 and L. lactis ssp. cremoris SMQ86/AbiG at time intervals post infection with φQ30. DNA was digested with Eco RI prior to electrophoresis and Southern blotting.

Similar analysis was performed for SMQ-86/AbiG, which was also found to retard φQ30 replication (Fig. 2B). The analytical blot also indicates normal phage DNA replication in the sensitive SMQ-86 cells. In cells containing AbiG, phage DNA was also detected at 15 min and there was no significant alteration in concentration from 30 to 100 min. No lysis of this culture was observed.

4 Discussion

A survey of the literature concerning lactococcal Abi mechanisms indicates that the characterisation of their effect on phage sensitivity is generally conducted using one phage species. In order to gain a greater understanding of the functioning of these mechanisms and their potential utility in strain construction strategies, it is necessary to investigate a broader range of phages. The objective of this work was to examine the efficacy of lactococcal Abi mechanisms against previously untested P335 group phages, and to partially characterise any observed interactions. Due to the diversity of phages within this group, host strains for numerous P335 phages were chosen in order to gain a broader insight into Abi interactions with this family.

AbiA has previously been demonstrated to be effective against 936, c2 and P335 species with φ31 DNA replication shown to be affected. [12,16,28]. In the case of AbiE, only a single phage (φ712) has been shown to be sensitive to this mechanism, when a total of nine phages representing 936 and c2 species were examined, and no effect on DNA replication was observed[21]. AbiF is known to affect a broader range of phages (φc2 itself and φ712), affecting the rate of phage DNA replication[21]. Insensitivity conferred by AbiG includes resistance to 936 type phages and partial resistance to phage c2, with DNA replication reported as being unaffected[22].

To date, out of a total of 19 known lactococcal Abi systems, AbiA, AbiK, AbiL, AbiP, AbiQ and AbiU are the only mechanisms whose interactions with P335 type phage have been published [12,14,15,29,30]. Comparison of the degrees of sensitivity between the different phage families appears to reflect phage virulence in the cases of AbiA, AbiG and AbiK, with the generally less virulent 936 phages showing the highest degrees of sensitivity compared to the c2 phage which exhibits only a reduction in plaque size or a single log-fold reduction in EOP.

The results obtained in this study indicate that none of the five P335 group phages examined displays sensitivity to AbiE or AbiF, despite the fact that each of the genes is being transcribed; thus their failure to affect P335 type phages is not due to a loss of transcriptional ability in novel hosts. AbiA was shown to be effective against all phages tested, with, in the case of phage Q30, replication being shown to be the most likely point at which the mechanism acts, as previously reported for both 936 and c2 species [12,16]. pTRK18 (pSA3/abiA) was previously shown to reduce the EOP of φul36 to 2.5×10⁻²[13]. The EOP of 10⁻⁵ observed here presumably reflects the higher copy number of the pMG36CT plasmid relative to pSA3 (between 50 and 100 copies, and six copies, respectively). A similar consequence of altering the copy number of AbiA has previously been reported[16].

Normal phage DNA replication in the presence of AbiK was reported by Boucher et al. to occur for phage p2 (936 species)[14], which was in apparent contradiction to an earlier report where no phage DNA was detected in infected AbiK⁺ cells in the case of the P335 type phage ul36[17]. These AbiK data mirror the effects observed with AbiG, which was previously shown not to affect phage DNA replication in the cases of c2 and 936 phages[22], but shown in this study to significantly retard φQ30 DNA replication. Hence it can be concluded that the molecular impacts of AbiG on different phage species are distinct. The possibility of a multifunctional AbiG product is in many respects consistent with the presence of two ORFs in the abiG coding region (abiGi, abiGii), the latter being particularly large (750 bp and 1194 bp, respectively). It has been reported for E. coli that a high proportion of proteins of more than 300 amino acids in size are estimated to be multifunctional with more than one active site[31], and thus possibly more than one mechanism of action.

Where normal phage DNA replication is observed in Abi-containing hosts, inhibition of some later process in the lytic cycle is implied as the mode of action, e.g. late transcription, translation, DNA packaging or virion assembly. Garvey et al.[4] utilised the observed ability/inability of Abi systems to inhibit phage DNA replication to categorise Abi mechanisms as being early or late acting. Since both AbiK and AbiG have different modes of action which are dependent on the target phage species, it may be necessary to abandon or alter this terminology to include the phage-specific nature of these systems.

These data indicate the distinct nature of Abi mechanisms while providing further evidence of significantly different phage responses towards a given system, highlighting the necessity to examine several and various phage types when attempting to elucidate the mode of action of a particular mechanism.