- Split View
-
Views
-
CiteCitation
Octavio García González, Rosa M. García, Mireya de la, Sergio Vaca P., Gloria Luz Paniagua, Ricardo Mejía, Víctor R. Tenorio, Erasmo Negrete-Abascal; Actinobacillus pleuropneumoniae metalloprotease: cloning and in vivo expression, FEMS Microbiology Letters, Volume 234, Issue 1, 1 May 2004, Pages 81–86, https://doi.org/10.1111/j.1574-6968.2004.tb09516.x
Download citation file:
© 2018 Oxford University Press
Close -
Share
Abstract
The complete amino acid and nucleotide sequence of a secreted metalloprotease produced by Actinobacillus pleuropneumoniae serotype 1 is reported. A clone showing proteolytic activity in cell-free culture media was selected from a genomic library of A. pleuropneumoniae serotype 1 in pUC 19. The sequence obtained contained an open reading frame encoding a protein with 869 amino acids. This protein was identified as a zinc neutral-metalloprotease belonging to the aminopeptidase family, with a predicted molecular weight of approximately 101 kDa. This sequence showed high homology with other predicted or sequenced aminopeptidases reported for different Gram-negative bacteria. Expression of the protease was observed in lung tissue from pigs that died of porcine pleuropneumonia suggesting a role in pathogenesis.
1 Introduction
Swine pleuropneumonia caused by the Gram-negative bacterium Actinobacillus pleuropneumoniae is a severe, contagious, and often fatal respiratory disease that occurs in peracute, acute, subacute, and chronic stages [1]. The clinical and pathological effects of both natural and experimental infections are well documented [1, 2]. It seems likely that certain virulence factors are involved, such as capsular polysaccharides, lipopolysaccharide (LPS), cytotoxins, outer membrane proteins, fimbriae and enzymes [3–6].
Proteolytic enzymes play important physiological roles, being essential factors for homeostatic control in both eukaryotic and prokaryotic cells. Microbial proteases produced by pathogenic microorganisms occasionally act as toxic factors to the host [7], producing different pathological actions, such as necrotic or hemorrhagic tissue damage. They form edematous lesions through production of inflammatory mediators, act as synergistic virulence factors through disordered proteolysis of plasma proteins or allow the bacteria to evade the immune response by degrading immunoglobulins and different complement components [7,8].
A. pleuropneumoniae, just like other mucosal bacterial pathogens, is able to secrete proteases into the culture media [9]. The protein responsible of proteolytic activity was purified and characterized as a metalloprotease able to degrade porcine IgA and IgG, being a multimeric protein constituted by subunits of approximately 47 kDa. Proteolytic activity was expressed by all serotypes of biotype 1 and two serotypes of biotype 2 and it was recognized by sera from infected but not from vaccinated pigs [10].
In this work we describe the complete nucleotide and amino acid sequence of an A. pleuropneumoniae serotype 1 metalloprotease, its comparison with other microbial metalloproteases reported to Genbank, and evidence of its expression in vivo.
2 Materials and methods
2.1 Bacterial strains and growth conditions
Actinobacillus pleuropneumoniae strain 35 is a field isolate characterized and classified as serotype 1 [9]. In order to obtain genomic DNA, this strain was grown in brain heart infusion (BHI) medium supplemented with 10 μg/ml β-nicotinamide adenine dinucleotide, incubated in a rotary shaker at 200 rpm, and harvested by centrifugation (10,000g, 4 °C, 20 min). Escherichia coli DH5α (Gibco BRL, Maryland, USA) was grown in Luria-Bertani (LB) broth. Recombinant plasmid that conferred protease activity to E. coli DH5α obtained in this work was named pIZ 12. DH5α (pIZ 12) was grown in Tryptic soy broth containing 100 μg/ml ampicillin (Sigma Chemical Co. St. Louis, MO, USA) and 1 mM isopropyl β-d-thiogalactopyranoside (Roche Diagnostic Co. Indianapolis IN, USA) (TSAI).
2.2 DNA extraction and genomic library construction
Genomic DNA was prepared using the phenol–chloroform method extraction as described by Sambrook et al. [11]. Plasmid DNA (pUC 19) was obtained by alkaline lysis [12]. For gene library construction, DNA of A. pleuropneumoniae was digested with Sau 3AI to generate fragments ranged from approximately 0.5–10 kb in size [11]. Plasmid pUC 19 was linearized with Bam HI, and ligated to A. pleuropneumoniae DNA fragments. Competent E. coli DH5α cells were transformed and spread on TSAI agar plates [11].
2.3 Gene library screening
Recombinant clones were screened for protease activity on TSAI agar plates containing 1% (w/v) casein or porcine gelatin [13], which were stained with Coomassie Blue R250 to facilitate clone selection. Positive clones with a degradation halo around the colonies were reinoculated 10 times on TSAI agar plates with 1% skim milk or porcine gelatin, to check the genetic construction stability. They were then tested by colony immunodot assay [11] using a polyclonal serum (diluted 1:100) raised against the purified protease of A. pleuropneumoniae[10]. Secondary antibody was peroxidase-linked goat IgG-antirabbit, diluted 1:2000 (Sigma). The immune reaction was revealed with 3,3′-diaminobenzidine.
2.4 Cloned enzyme
To check secreted proteolytic activity expressed by DH5α (pIZ 12), bacteria were grown overnight under aerobic conditions into TSAI. Bacteria were removed by centrifugation (10,000g, 4 °C, 20 min) and cell free culture supernatants were concentrated by precipitation overnight with 70% ammonium sulphate. After this, proteins were harvested by centrifugation (10,000g, 4 °C, 30 min). Culture supernatants from A. pleuropneumoniae, and E. coli DH5α with or without pUC 19 were processed in the same manner as DH5α (pIZ 12). Samples were kept frozen until use.
2.5 Zymograme
The ability to degrade porcine gelatin and other substrates was analyzed for clone DH5α (pIZ 12) by electrophoresis in a SDS–10% polyacrylamide gel copolymerized with 0.1% porcine gelatin, 1% bovine casein or 0.05% porcine hemoglobin. Gels were incubated in 2.5% Triton X-100, and processed as described previously [9]. Gels were incubated overnight at 37 °C with 50 mM Tris-HCl pH 7.5 added with 10 mM CaCl2. Culture supernatant proteins from A. pleuropneumoniae serotype 1, and E. coli DH5α with or without plasmid pUC 19 were processed in the same form and loaded as positive and negative controls, respectively. Copolymerized gels were stained with Coomassie-blue R250 in order to observe the proteolytic activity. Twenty mM EDTA was used to inhibit proteolytic activity.
2.6 DNA sequencing and computer analysis
The cloned DNA fragment that conferred proteolytic activity was subcloned into pCR2.1 vector, and its nucleotide sequence was obtained with Taq dye deoxy-terminator and Dye primer sequencing protocols on a Perkin–Elmer genetic analyzer (ABI Prism 3100 sequencer). T4 and M13 universal primers were used as sequencing initiators. In order to complete the cloned fragment DNA sequence, AppI1 (5′AAAACCGGAAACTGCCACCGATACC3′) and AppI2 (5′GGTGCGTTTAGATTATGCCTATA3′) internal sequencing primers were synthesized. Nucleotide and deduced amino acid sequences of the cloned fragment were deposited into the GenBank database (GenBank Acc. No. AY545035).
2.7 Immunofluorescence
Since the analysis of the amino acid sequence revealed possible transmembrane domains and a signal sequence, we decided to examine the exposure of the protease on the bacterial surface. About 107A. pleuropneumoniae cells were fixed during 1 h in 4% paraformaldehyde dissolved in PBS. After this, cellular suspension was washed twice with PBS, blocked with 1% BSA at room temperature and incubated at 37 °C during 1 h first with the polyclonal serum against the A. pleuropneumoniae high molecular mass protease (diluted 1:100) and then with a rhodamine-labeled goat IgG-antirabbit antibody (Bio-Rad, diluted 1:60). Samples were poured on poly-l-lysine-coated glass slides and observed by epifluorescence microscopy.
2.8 In vivo protease expression
In order to know if the protease is expressed in vivo, lung tissue from healthy and naturally infected porcine pleuropneumoniae deceased pigs (from which A. pleuropneumoniae was isolated), were processed for immune cytochemical protease detection. Tissues were immersed overnight into PBS-10% sucrose at 4 °C and frozen by using Cryoform medium (IEC Minot Custom Microtome, USA). Tissues were cut, and 6–8 μm wide slices were obtained. Samples were placed on microscope slides and washed during 10 min with PBS containing 0.2% Triton X100 (PBS-T), followed by incubation (1 h at 37 °C) with a rabbit polyclonal antiserum against the high molecular-mass protease secreted by A. pleuropneumoniae (diluted 1:100), and washed twice for 10 min. Next, samples were incubated at 37 °C for 45 min with a rhodamine labeled goat IgG-antirabbit antibody (diluted 1:60), and washed twice with PBS-T (10 min). Healthy pig-lung tissues were processed in the same manner. Samples were set up with mounting media and observed with an epifluorescence microscope (Nikon, PFX).
3 Results
3.1 DH5α (pIZ 12) clone selection and enzyme characterization
A. pleuropneumoniae Sau 3A1 DNA fragments were ligated to Bam H1-linearized pUC19 and recombinant plasmids were used to transform E. coli DH5α, selecting for ampicillin resistance and screened for protease production and cross-reactivity with antibodies against A. pleuropneumoniae serotype 1 protease. DH5α (pIZ 12) expressed proteolytic activity inside the cells as well as in high molecular-mass secreted forms, the later showing larger proteolytic activity. Also, the clone reacted in a colony dot assay with the polyclonal serum against the purified secreted protease from A. pleuropneumoniae serotype 1. Proteolytic activity from DH5α (pIZ 12) degraded porcine gelatin, bovine casein, and porcine hemoglobin, (Fig. 1. Lanes A–C, respectively), and it was inhibited using 20 mM EDTA (Fig. 1, lane D). This proteolytic activity was not observed in E. coli DH5α with or without pUC 19 (Fig. 1, lanes E and F, respectively). DH5α (pIZ 12) proteolytic activity was similar to that showed by A. pleuropneumoniae serotype 1 (Fig. 1, lane G).
Culture supernatants from DH5α (pIZ 12) were precipitated with 70% (NH4)2SO4 and 15–20 μg of protein were loaded by well in 10% SDS–polyacrylamide gels copolymerized with different substrates. Gels were incubated in 50 mM Tris-HCl buffer pH 7.5. Lane A: DH5α (pIZ 12) in porcine gelatin; lane B: DH5α (pIZ 12) in bovine casein; lane C: DH5α (pIZ 12) in porcine hemoglobin; lane D: DH5α (pIZ 12) in the presence of 20 mM EDTA; lane E: E. coli DH5α (pUC 19) without insert in porcine gelatin; lane F: E. coli DH5α in porcine gelatin; lane G: A. pleuropneumoniae serotype 1 in porcine gelatin.
Culture supernatants from DH5α (pIZ 12) were precipitated with 70% (NH4)2SO4 and 15–20 μg of protein were loaded by well in 10% SDS–polyacrylamide gels copolymerized with different substrates. Gels were incubated in 50 mM Tris-HCl buffer pH 7.5. Lane A: DH5α (pIZ 12) in porcine gelatin; lane B: DH5α (pIZ 12) in bovine casein; lane C: DH5α (pIZ 12) in porcine hemoglobin; lane D: DH5α (pIZ 12) in the presence of 20 mM EDTA; lane E: E. coli DH5α (pUC 19) without insert in porcine gelatin; lane F: E. coli DH5α in porcine gelatin; lane G: A. pleuropneumoniae serotype 1 in porcine gelatin.
3.2 Nucleotide sequence and computer analysis
The fragment cloned into pIZ 12 was sequenced and the obtained nucleotide sequence (corresponding to 3024 bp) was analyzed using Blastn software (http://www.ncbi.nlm.nih.gov/blast/). The cloned sequence showed high homology with reported or predicted sequences of N-aminopeptidases from Haemophilus ducrei (80%), Pasteurella multocida (83%), H. influenzae (80%) and E. coli (89%). The sequence was also compared with A. pleuropneumoniae serotype 1 genomic sequence (GenBank Acc. No. NC_003998) and found from nucleotide position 33925–36534. The complete sequence (3024 bp) was analyzed with ORF finder software (http://www.ncbi.nlm.nih.gov/gorf/gorf.html), and the combined results of this software and the above reported homology sequence, determined that the cloned protease codifying reading frame was a 2610 bp gene.
3.3 Predicted amino acid sequence analysis
Using the ScanProsite software (http://www.expasy.org/tools/scanprosite), a zinc binding signature was found in the position 297–303 (Fig. 2A). As such, the protein was classified as a zinc neutral-metallopeptidase belonging to the aminopeptidase family. Analysis of the amino acid sequence using Blasp software (http://www.ncbi.nlm.nih.gov/BLAST) showed high levels of homology with different sequenced or predicted N-aminopeptidases from different Gram-negative bacteria (Table 1).
(A) Predicted amino acid sequence of A. pleuropneumoniae serotype 1 protease obtained from nucleotide sequence (GenBank AY545035). Putative cleavage sites (a.a. 64, 279, and 685) are in bold and underlined. Putative transmembranal segments (a.a. 186–192, and 249–257) are shaded, and zinc binding signature (a.a. 297–303) is underlined. (B) Schematic representation of putative proteolytic cleavage sites [1 (a.a. 164), 2 (a.a. 279), 3 (a.a. 685)] on the A. pleuropneumoniae protease and the different molecular mass proteolytic activities observed in substrate gels. Zn indicates the zinc binding signature (a.a. 297–303).
(A) Predicted amino acid sequence of A. pleuropneumoniae serotype 1 protease obtained from nucleotide sequence (GenBank AY545035). Putative cleavage sites (a.a. 64, 279, and 685) are in bold and underlined. Putative transmembranal segments (a.a. 186–192, and 249–257) are shaded, and zinc binding signature (a.a. 297–303) is underlined. (B) Schematic representation of putative proteolytic cleavage sites [1 (a.a. 164), 2 (a.a. 279), 3 (a.a. 685)] on the A. pleuropneumoniae protease and the different molecular mass proteolytic activities observed in substrate gels. Zn indicates the zinc binding signature (a.a. 297–303).
Homology of cloned gene amino acid sequence compared with other reported N-aminopeptidases
| Microorganism | State | Homology (%) |
| Actinobacillus pleuropneumoniae 1 | Predicted | 99 |
| Haemophilus somnus | Predicted | 82 |
| Haemophilus influenzae Rd | Sequenced | 81 |
| Haemophilus ducrei | Predicted | 79 |
| Salmonella typhimurium | Sequenced | 79 |
| Yersinia pestis | Sequenced | 75 |
| Vibrio cholerae | Predicted | 72 |
| Pasteurella multocida | Predicted | 71 |
| Pseudomonas aeruginosa | Sequenced | 62 |
| Microorganism | State | Homology (%) |
| Actinobacillus pleuropneumoniae 1 | Predicted | 99 |
| Haemophilus somnus | Predicted | 82 |
| Haemophilus influenzae Rd | Sequenced | 81 |
| Haemophilus ducrei | Predicted | 79 |
| Salmonella typhimurium | Sequenced | 79 |
| Yersinia pestis | Sequenced | 75 |
| Vibrio cholerae | Predicted | 72 |
| Pasteurella multocida | Predicted | 71 |
| Pseudomonas aeruginosa | Sequenced | 62 |
Homology of cloned gene amino acid sequence compared with other reported N-aminopeptidases
| Microorganism | State | Homology (%) |
| Actinobacillus pleuropneumoniae 1 | Predicted | 99 |
| Haemophilus somnus | Predicted | 82 |
| Haemophilus influenzae Rd | Sequenced | 81 |
| Haemophilus ducrei | Predicted | 79 |
| Salmonella typhimurium | Sequenced | 79 |
| Yersinia pestis | Sequenced | 75 |
| Vibrio cholerae | Predicted | 72 |
| Pasteurella multocida | Predicted | 71 |
| Pseudomonas aeruginosa | Sequenced | 62 |
| Microorganism | State | Homology (%) |
| Actinobacillus pleuropneumoniae 1 | Predicted | 99 |
| Haemophilus somnus | Predicted | 82 |
| Haemophilus influenzae Rd | Sequenced | 81 |
| Haemophilus ducrei | Predicted | 79 |
| Salmonella typhimurium | Sequenced | 79 |
| Yersinia pestis | Sequenced | 75 |
| Vibrio cholerae | Predicted | 72 |
| Pasteurella multocida | Predicted | 71 |
| Pseudomonas aeruginosa | Sequenced | 62 |
By using DAS transmembrane prediction software two putative transmembrane sites were found, one in the position 186–192 and another in the position 249–257, indicating a possible anchorage of the protease to the membrane (Fig. 2A). A protease recognition site (position 164) corresponding to a leader peptide signal was also identified by using SignalP V1.1 software (http://www.cbs.dtu.dk/services/SignalP/.21). Two more putative cleavage sites were identified at positions 279 and 685 (Fig. 2A). Molecular mass of the protease was calculated as 101,131 Da by using ProtParamTool software (http://www.expasy.org/tools/protparam.html). Processing of the protease into the putative cleavage sites could produce lower molecular mass proteolytic activities (Fig. 2B).
3.4 Protease immune recognition on bacteria and lung tissue
Using a polyclonal serum against A. pleuropneumoniae purified protease, immune fluorescence was observed on the whole bacterial cell surface (Fig. 3A), suggesting a homogeneous distribution of the protease. This suggestion was further supported by the predicted presence of the protease on the bacterial surface by the DAS transmembrane prediction software. Protease was also immune detected in lung tissues from porcine pleuropneumoniae deceased pigs (Fig. 3B). This recognition was mainly observed in the epithelial portion of bronchioles and was not observed with healthy pig-lung tissues (Fig. 3C) or when the primary antibody was omitted (data not shown).
Detection of the A. pleuropneumoniae protease by immune fluorescence using a polyclonal serum against the >200-kDa purified A. pleuropneumoniae protease. (A) Immune fluorescence on the A. pleuropneumoniae cell surface; (B) in lung tissues of pigs deceased of porcine pleuropneumonia and, (C) in lung tissues of healthy pigs.
Detection of the A. pleuropneumoniae protease by immune fluorescence using a polyclonal serum against the >200-kDa purified A. pleuropneumoniae protease. (A) Immune fluorescence on the A. pleuropneumoniae cell surface; (B) in lung tissues of pigs deceased of porcine pleuropneumonia and, (C) in lung tissues of healthy pigs.
4 Discussion
The cloning and sequencing data show that the A. pleuropneumoniae serotype 1 metalloprotease molecular mass is of approximately 101 kDa as a complete protein. However, if this protein is processed into the several putative cleavage sites, different proteolytic activities can be obtained on several molecular mass ranges (Fig. 2B). This could explain the presence of proteolytic bands of approximately 50, 70, 90, 100, 200, and >200 kDa observed when A. pleuropneumoniae secreted proteins were analyzed [9,10]. Proteolytic activities detected at molecular mass higher than 100 kDa could be explained by the formation of oligomers of this protein.
The metalloprotease of A. pleuropneumoniae [9,10], like other neutral bacterial metalloproteases [7,14], can be inhibited by metal ion chelators. Accordingly, a potential zinc-binding site was identified. This site corresponds to the sequence HEYFHNW, which shows homology with the HEXXH motif of the zincins family, to which Pseudomonas aeruginosa elastase and metalloproteases from Legionella pneumophila, Vibrio cholerae and V. vulnificus belong [7]. Furthermore, A. pleuropneumoniae metalloprotease amino acid sequence showed high homology with other sequenced or predicted aminopeptidases from several Gram-negative bacteria including E. coli, Salmonella typhimurium, and H. influenzae. On the other hand, when the A. pleuropneumoniae metalloprotease nucleotide sequence was compared with other aminopeptidases nucleotide sequences, it showed 80% of homology with 248 aligned nucleotides of H. ducrei, 83% with 143 nucleotides of Pasteurella mulltocida, 80% with 129 nucleotides of H. influenzae, and 89% with only 65 aligned nucleotides of E. coli. This strongly suggests that metalloproteases could be interrelated by motifs or structural domains beyond their nucleotide sequences. The gene sequence obtained from cloned metalloprotease was located between the 33,925 and 36,534 position of the A. pleuropneumoniae serotype 1 complete sequence reported, showing a 99% of homology.
According with the predicted transmembranal position domain found using the DAS transmembrane prediction software [15], this metalloprotease could present a membrane location. This result is in good agreement with the protease immune detection on the bacterial external surface when bacteria were put in contact with polyclonal serum against the A. pleuropneumoniae serotype 1 purified protease. It also agrees with previous reports concerning to the presence of the protease on the surface of microvesicles released by A. pleuropneumoniae serotype 1 detected by immunogold electron microscopy [16]. The anchorage of the protease to the bacterial membrane possibly allows an LPS-protease association and explains the heat and chemical resistance to denaturing conditions observed with the purified protease [10]. A similar behavior was also described for the leukotoxin produced by Mannheimia (Pasteurella) haemolytica [17,18]. This kind of LPS-RTX protein association has been described in different RTX proteins [19], and permits them to form oligomers of high molecular mass. In addition, this association modifies the protein properties, conferring resistance to denaturing agents such as urea, guanidine or SDS [17].
Immune reaction detected with antibodies against the purified protease on porcine pleuropneumoniae infected lung tissues, but not on healthy lungs, indicates the protease expression during the disease stages. Besides, immune recognition was found specifically on areas with macroscopic lesions, suggesting a possible participation of the protease in tissue damage.
A classic type of the damage mechanism caused by the microbial proteases is the direct digestion and liquefaction of tissues of the infected foci as has been observed in corneal keratitis caused by Pseudomonas sp. or Serratia sp. [20,21]. In addition to the direct action of microbial proteases, it is now evident that the activation of endogenous host protease zymogens such as clotting cascade and the inactivation of most of the plasma protease inhibitors contribute to damaging host tissues. Bacterial proteases may also potentate inflammatory processes, activate the bradykinin generating system, degrade immunoglobulins, and complement factors amongst other effects [22–25]. The precise role of the protease produced by A. pleuropneumoniae and its participation in porcine pleuropneumonia pathogenesis remains to be demonstrated.
Acknowledgements
We thank Alejandro Monsalvo for his technical assistance. This work was supported by CONACYT, project G38590-B, and PAPIIT IN219203 UNAM. English version was revised by Isabelle Blanckaert.


![(A) Predicted amino acid sequence of A. pleuropneumoniae serotype 1 protease obtained from nucleotide sequence (GenBank AY545035). Putative cleavage sites (a.a. 64, 279, and 685) are in bold and underlined. Putative transmembranal segments (a.a. 186–192, and 249–257) are shaded, and zinc binding signature (a.a. 297–303) is underlined. (B) Schematic representation of putative proteolytic cleavage sites [1 (a.a. 164), 2 (a.a. 279), 3 (a.a. 685)] on the A. pleuropneumoniae protease and the different molecular mass proteolytic activities observed in substrate gels. Zn indicates the zinc binding signature (a.a. 297–303).](https://oup.silverchair-cdn.com/oup/backfile/Content_public/Journal/femsle/234/1/10.1111_j.1574-6968.2004.tb09516.x/1/m_FML_81_f2.jpeg?Expires=1528934421&Signature=up-4YYBYSsnmUcd8~q3Hi1zpg-oL2LMgtMJqCMME4-J4Z7bpWcTNKA3E7ICTxhELsLNRZBBFEbrz6zZbfkBUaL~pYvnOpozZbPFp3IpWf~QOKJ8dgGnW2HwzfIjCaRT0J2EGJXfAhnpL~-alfbxFi6kFrltZSQoWFuxrKsNRLDKT0jHVH0JmbbDwfrCF0QR~H5m1JpJxUPXbqvFk4gMZXCE8bRufePgFLrubesFe8sttp1LuCWjpltxt54ZNBQZ0ZcCdbKupIx0A-98F0vmnvaBaZRhRaiMoinCj3xvXg7ASpoC~COeLROKD7AWsifsGWwrb5fDMPdno9DmcLp3LlA__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA)
