The riboflavin kinase encoding gene ribR of Bacillus subtilis is a part of a 10 kb operon, which is negatively regulated by the yrzC gene product

Abstract

The riboflavin kinase encoding gene ribR is situated within a 12 genes locus ytmI–ytnM of the Bacillus subtilis chromosome. Here we demonstrate that ribR is transcribed as part of a 10 kb ytmI–ytnM operon. The riboflavin overproduction phenotype of B. subtilis ribC mutant strains, which is a result of the strongly reduced flavokinase activity of the riboflavin kinase/FAD synthetase RibC, was suppressed by ribR expression. Analysis of mutations with an upregulated ribR gene revealed 2 different groups of mutants. One class of mutants contained base substitutions in an 8 nucleotide sequence of the promoter region of the ytmI–ytnM operon. A second class of mutants had single point mutations within the yrzC gene or in the RBS of this gene. Dot-blot analysis of ytmI–ytnM transcription and the results of in trans complementation experiments for the yrzC mutants confirmed a role of the yrzC gene product as a negative regulator for the ytmI–ytnM operon.

Bacillus subtilis, Riboflavin kinase, Suppressor mutations, Operon regulation

1 Introduction

The system of flavinogenesis in Bacillus subtilis includes the riboflavin operon (ribGBAHTD), whose gene products catalyze the conversion of GTP and ribulose-5-phosphate to riboflavin ( [1], for review see [2]), and bifunctional riboflavin kinase/ FAD synthetase (RibC) that converts riboflavin to FMN and FAD [3,4]. Current evidence suggests, that expression of the riboflavin (rib) operon and the ribC gene is controlled by flavins [4,,6]. Mutations in the flavokinase/FAD synthetase gene (ribC-mutations), affecting the riboflavin kinase activity of the enzyme, cause derepression of the riboflavin biosynthetic genes and up to 30 μg ml⁻¹ riboflavin accumulation in the growth medium [3,7].

In addition to RibC, B. subtilis has another enzyme with riboflavin kinase activity-monofunctional riboflavin kinase, encoded by the ribR gene [8]. An additional copy of the ribR gene, introduced on an expression plasmid into B. subtilis cells containing the ribC mutation, suppressed the effect of ribC mutations and restored normal expression of the rib-operon and low riboflavin production, typical for the WT strains [8]. In our previous work using the riboflavin analogue 7, 8-dimethyl-10-(O-methylacetoxime)-isoalloxazine (MO) [9], we obtained B. subtilis chromosomal mutants with the same effect: they almost completely eliminated rib expression, but retained the original ribC mutation in the chromosome [10]. It has been proposed that increased expression of the ribR gene in these mutants led to the suppression of the riboflavin synthesis.

The ribR gene is located in a locus containing 12 genes (here designated as ytmI–ytnM), which seem to form an operon. In the work of Coppee et al. [11], coordinated expression of some genes of this putative operon, which is strongly increased in the presence of glutathione, taurine and methionine, was shown.

Here we show a correlation between ribR expression and riboflavin accumulation in ribC mutation strains and use this phenomenon for an investigation of the regulation of ribR expression. The coordinated transcription of the 12 genes of the putative ytmI–ytnM operon was confirmed by Northern-blots experiments, which revealed a single 10 kb ytmI–ytnM transcript. The riboflavin analogue MO was used to select B. subtilis mutants with an increased RibR activity. We have examined these mutations and identify the yrzC gene product as a negative regulator for the ytmI–ytnM operon and an 8 nucleotide sequence in the promoter region of ytmI–ytnM, which is important for the regulation of the operon.

2 Materials and methods

2.1 Bacterial strains and culture conditions

The B. subtilis strains used in this work are listed in Table 1. B. subtilis was cultivated at 37 °C in tryptic soy broth (TSB), Luria–Bertani (LB) medium, or in Spizizen minimal medium supplemented with the required nutrients [12]. Escherichia coli was grown in LB broth (Sigma). The solid medium was supplemented with 1.5% agar. Antibiotics were added to the following concentrations: 100 μg ml⁻¹ ampicillin, 5 μg ml⁻¹ chloramphenicol, 5 μg ml⁻¹ erythromycin.

1

Bacterial strains and plasmids

Strain or plasmid	Relevant genotype	Source or reference
E. coli strain DH5α	(sup E44 Δlac U169 (Δ80 lac Z ΔM15) hsd R17 rec A1 end A1 gyr A96 thi -1 rel A1)	Laboratory stock
B. subtilis strains
H25	hisB
RK612	hisB ribC1
RK399a	hisB ribC1 MOR5	Kreneva and Perumov [10]
RK399d	hisB ribC1 MOR6	This publication
RK612-7	hisB ribC1 MOR7
RK612-8	hisB ribC1 MOR8
RK612-16	hisB ribC1 MOR16
RK612-21	hisB ribC1 MOR21
RK612-13	hisB ribC1 MOR13
RK613	hisB ribC1 MOR5 ytnJ′-lacZ, erm, ΔytnJ
RK614	hisB ribC1 MOR5 ytmO′-lacZ, erm, ΔytmO
RK615	hisB ribC1 MOR5 ytmM′-lacZ, erm, ΔytmM
RK399aΔ R	hisB ribC1 MOR5 ribR::cat	pSI2 in RK399a
ISZ7	hisB ribC1 MOR5 amiE::yrzC-flag, cat	pSIZ7 in RK399a
ISV1	hisB ribC1 MOR5 amyE::yrvO, cat	pSIV1 in RK399a
Plasmids
pUC19		Laboratory stock
pCE26
PMUTin4		Vagner et al. [16]
pX		Kim et al. [17]
pSI2	ribR1-cat-ribR2 in pUC19	This publication
pSIZ7	yrzC-flag in pX
pSIV1	yrvO in pX

2.2 DNA manipulations and genetic techniques

Chromosomal DNA was isolated according to Saito and Miura [13], plasmid DNA according Sambrook et al. [14]. E. coli cells were transformed by the method of Mandel and Higa [15], and B. subtilis by the method of Spizizen and coworker [12]. Standard molecular genetic techniques were used [14]. Restriction, ligation, dephosphorylation enzymes and Taq polymerase were purchased from “Promega” and used according to the manufacturer's instructions. The polymerase chain reaction (PCR) was carried out in an Eppendorf MicroCycler E apparatus.

2.3 Northern hybridization and RNA dot blotting

Northern hybridization was performed using the DIG DNA labeling kit (Boehringer Mannheim). The RNAase Mini kit (Qiagen) was used for RNA extraction. Total RNA was extracted from H25 wild type (WT), RK612 and RK399a cells that were harvested in the late exponential phase. Samples of 30 μg RNA were loaded onto the slots of a 1% agarose gel containing 2.2 M formaldehyde. After electrophoresis, the RNA was transferred onto a nylon membrane (Hybond-N, Amersham). For RNA dot blotting, a 96-well dot blotter (Bio-Rad) was used. Total RNA was extracted from the ISZ7 cells at 1, 2 or 3 h after the addition of xylose. RNA was hybridized with the DIG-labeled 500 bp PCR product, including a middle part of the ribR gene in accordance with a supplier's protocol. Hybridization was performed for 16 h at 42 °C. Hybridizing fragments were detected by chemiluminescence.

2.4 Construction of ytmM, ytmO, ytnJ and ribR disruption mutants

To inactivate the ytnJ, ytmO and ytmM genes, the strategy described for a European project on the functional analysis of the genome of B. subtilis was used (see http://locus.jouy.inra.fr/cgi-bin/genmic/madbase/progs/madbase.operl). An internal fragment of each gene was amplified by PCR using primers creating HindIII and BamHI restriction sites at the 5′ and 3′ ends of the PCR product, respectively. After digestion with HindIII and BamHI, these PCR products were cloned into the pMUTIN4 vector [16]. The pMUTIN derivatives were then integrated into the B. subtilis chromosome of the RK399a strain by homologous recombination at the target locus (Table 1).

An integrative plasmid pSI12 was constructed for the inactivation of ribR. A 630 bp fragment containing part of the ribR gene from position 1–630 (numbering is relative to the translational start site) was amplified by PCR using chromosomal DNA as template and two specific primers containing a HindIII restriction site. The HindIII fragment was cloned into the pUC19 vector to give pSI2. A PCR copy of the cat gene amplified from plasmid pCE26 with primers, containing SmaI sites was digested with this restriction enzyme and inserted into the DraI site of the ribR gene in the pSI2. The resulting plasmid pSI12 linearized with ScaI was used to transform B. subtilis RK399a, leading to the disruption of the ribR gene by insertion of a chloramphenicol resistance gene (Table 1).

The correct insertion in strains was verified by PCR. The organization of the genes in these strains is shown in Fig. 1.

1

Organization of the ytmI–ytnM operon and construction of the RK613 and RK613ΔR strains. For each gene, the direction of transcription is indicated by an arrow. Numbers indicate the base pair positions of the translation start of ytmI and translation end of ytnM on the B. subtilis chromosome.

2.5 Construction of plasmids for the yrvO and yrzC gene expression and FLAG modification of YRZC

The E. coli–B. subtilis pX vector [17] was used for the expression of yrvO and yrzC in B. subtilis. The pX expression vector contains the cat gene and a xylose-controlled xylA promoter between 5′- and 3′-ends of amyE and can be inserted into the amyE locus of B. subtilis. A 1180 bp DNA fragment corresponding to the yrvO gene (from position −19 to 1161 relative to the translational start site) was amplified by PCR. The oligonucleotides RVO1 (5′gatcagaggtgtactagtatggaacg 3′) and RVO2 (5′ ctccaattactacggatccttatgtcag 3′) contained a SpeI restriction site and a BamHI restriction site, respectively (underlined). After digestion of the PCR product with SpeI and BamHI, it was ligated into the SpeI–BamHI site of plasmid pX resulting in plasmid pSIV1. pSIV1 was integrated at the amyE locus of the RK399a strain resulting in strain ISV1 (Table 1).

A 454 bp DNA fragment corresponding to the yrzC gene (from position −11 to 443 relative to the translational start site) was amplified by PCR. The 5′ end oligonucleotide ZC1 (cagagggatccatgttgaaaatatc) contained a BamHI restriction site (underlined) and the 3′ end oligonucleotide ZC2-FLAG (aataaatcggatccatttaTTT ATC ATC GTC CTT ATA ATCgaac) contained a BamHI restriction site (underlined) and also a sequence for the FLAG epitope (block capital letters). The chosen oligos allowed insertion of the FLAG epitope immediately upstream of the stop codon of yrzC. After digestion of the PCR product with BamHI, it was ligated into the BamHI site of the plasmid pX, resulting in plasmid pSIZ7. pSIZ7 was integrated at the amyE locus of the RK399a strain resulting in strain ISZ7 (Table 1). A proper integration of the pSIZ7 and pSIV1 into the amyE locus of the chromosome was verified by PCR.

2.6 Mutagenesis of B. subtilis and sequencing analysis of the mutants

B. subtilis RK612 strain (ribC mutation derivative of the wild type strain H25, which originates from the 168trp C2) was mutagenized by 1-methyl-3-nitro-1-nitrosoguanidine as previously described [18] and selected on TY plates containing 4 μg ml¹ of the MO. Selected clones were analyzed further for the riboflavin accumulation and riboflavin kinase activity.

For the sequencing analysis of the mutants the corresponding 200–500 bp fragments of the chromosomal DNA from the mutant were amplified by PCR. The sequence analysis of these fragments was performed by Dye Terminator Sequencing carried out using Amplitaq DNA polymerase FS with an ABI377 automated sequencer (Perkin–Elmer Applied Biosystems). For each substitution found, several independent PCR amplifications with different oligos combinations were performed to insure that the observed substitutions were not additional mutations that potentially could occur in the PCR products.

2.7 Protein immunoblotting

Western blotting was performed by standard techniques [14]. After separation by SDS–PAGE, proteins were transferred to polyvinylidene difluoride membranes (Bio-Rad). Immunodetection of FLAG-containing proteins was accomplished by using a monoclonal anti-FLAG M2 antibody (Sigma) at a 1:1000 dilution and horseradish peroxidase-conjugated anti-mouse antibody (Sigma) at a 1:10,000 dilution. Peroxidase activity was detected by the ECL Western blotting detection system (Amersham).

2.8 Riboflavin kinase activity and riboflavin accumulation assays

Riboflavin kinase activity was determined as described previously [8]. One unit of the flavokinase activity corresponds to the formation of 1 nmol min⁻¹ (mg total protein)⁻¹ FMN. Vitamin accumulation in the growth medium was measured spectrophotometrically by monitoring the A₄₇₀ [5].

3 Results

3.1 Analysis of coordinated expression of the ytmI–ytnM locus

The strain RK399a obtained in our previous work [10] shows a WT level of riboflavin biosynthesis in a ribC1 (ribC point mutation) background. In order to check that increased expression of ribR in this strain is the reason for the suppression of the ribC-mutation, the ribR and 3 other genes located in front of ribR in the ytmI–ytnM operon were inactivated. In the strains RK 613–615, genes ytnJ, ytmO and ytmM, respectively, were insertionally inactivated by the integration of pMUTIN4 into the RK399a genome and the ribR gene was placed under the control of the IPTG-inducible promoter. In the strain RK399aΔR, the ribR gene was disrupted by the cat gene (Fig. 1). The riboflavin accumulation under non-inducing conditions and after IPTG-induction was measured (Table 2). The results presented in Table 2 indicate that the effect of the riboflavin production in the ribC1 strain is dependent on ribR expression and that ribR coexpresses with the ytnJ, ytmM and ytmO genes.

2

The riboflavin accumulation after inactivation of the ytmM, ytmO and ytnJ genes

Strain	Riboflavin accumulation (μg ml−1)
	−IPTG	+IPTG
RK399a	1 ± 0.5	1 ± 0.5
RK612	24 ± 5	24 ± 5
RK613	22 ± 5	1 ± 0.5
RK614	25 ± 5	1 ± 0.5
RK399ΔR	25 ± 5	25 ± 5

3.2 Northern hybridization analysis of the ytmI–ytnM operon transcription

To confirm the existence of the putative ytmI–ytnM operon, the H25 (WT), RK612 and RK399a strains were analyzed for the presence of the ribR transcript (Fig. 2). RibR transcript has been detected neither in the WT strain, nor in the RK612 strain. A transcript of ∼10 kb, the size expected from the length of the ytmI–ytnM operon, was found in the strain RK399a. The transcript is not stable: its degradation, presumably, during the RNA isolation, can be seen on the blot, which is not unexpected for a transcript of that size.

2

Northern blot analysis of ribR transcription. Northern hybridization experiments were performed with total RNA isolated from strains H25WT (lane 1), RK612 (lane 2) or RK399a (lane 3). M-RNA size marker is from Roche Molecular Biochemical. Transcripts were hybridized with the 600 bp ribR* probe. The arrow shows the position of ytmI–ytnM the transcript.

These results strongly suggest the existence of a large operon (from ytmI to ytnM) and show that transcription of this entire operon is repressed in the WT and RK612 strains.

3.3 Genetic and sequence analysis of mutations affecting the regulation of ytmI–ytnM operon expression

The difference in the tolerance to the riboflavin analogue MO between the WT and the ribC1 strain (RK612) was used for selection of the mutants showing suppressed riboflavin synthesis in a ribC1 background. The mutations with decreased constitutive expression of the rib operon (designated as MO_R-mutations) fell into 2 different groups. Results of transduction and transformation experiments demonstrated that the 4 mutations (MO_R7, MO_R8, MO_R16 and MO_R21) were linked to the ytmI–ytnM operon, 2 other mutations (MO_R6 and MO_R13) and a mutation in the RK399a strain (MO_R5) showed 85–90% linkage with the yrvN gene located at the position of 240⁰ of the B. subtilis chromosome.

The riboflavin accumulation in all MO_R-mutation strains was 1–2 μg ml⁻¹. The riboflavin kinase activity, which is 0.01 nm (mg min)⁻¹ in the WT strain and non–detectable in the RK612 strain, was 0.04 nm (mg min)⁻¹ for the MO_R7, MO_R8 and MO_R16 mutants, 0.06 nm (mg min)⁻¹ for the MO_R21 mutant and 0.08 nm (mg min)⁻¹ for the MO_R5, MO_R6 and MO_R13 mutants.

For the identification of the mutations MO_R7, MO_R8, MO_R16 and MO_R21, a chromosomal DNA from the mutant strains was isolated and the 200 bp fragment in front of the ytmI gene was sequenced. Sequence analysis of this fragment revealed that all 4 mutations were within the 8 nucleotide sequence AAGCTTAG, between the hypothetical promoter TAGTCA-16 nucleotides-TATAGT and the start codon of the ytmI gene. MO_R7, MO_R8 and MO_R16 were base replacements of G₈ to A and MO_R21 was a base replacement of A₁ to C (Fig. 3(a)).

3

Mutations regulating ytmI–ytnM operon expression. (a) The leader region of the ytmI–ytnM operon. (b) The yrzC gene with the leader region. The sequence of the YrzC peptide is shown in one letter amino acid code. Mutations that were found and analyzed in this work are indicated in bold. Nucleotide replacements in the mutations are shown with arrows. An additional cytosine after 89th codon is capitalized.

For the identification of mutations which showed linkage to the yrvN gene, we sequenced the 3 kb region of the chromosomal DNA including yrvP, yrvO, yrzC and yrvN genes from the mutant strains. We found that mutations MO_R5 and MO_R6 involved a single replacement of G to A in the SD sequence of the yrzC gene, and the MO_R13 concerned a G to A replacement within the yrzC gene, which led to the substitution of Ser to Asn at the position 58 (Fig. 3(b)). The yrzC sequence reported in the SubtiList database (http://genolist.pasteur.fr/SubtiList/) identifies yrzC as a 333 bp ORF coding for a protein with sequence similarity to transcriptional regulators. In the course of this work, we found one difference relative to the previously reported yrzC sequence: an additional nucleotide (cytosine) between codons 89 and 90. It changes all codons starting from the position 90 and extends the ORF from 333 to 417 bp. Sequencing analysis was performed for differentB. subtilis strains (H25, 168, RK399 and RK612) for several independent PCR amplifications. This change is present in all B. subtilis strains tested and has been brought to the attention of the curators of the SubtiList database (http://genolist.pasteur.fr/SubtiList/). The yrzC gene ends 18 bases upstream of the yrvO gene, which encodes a protein similar to NifS proteins. This suggests that these two genes constitute a single transcription unit.

3.4 Effect of the yrzC gene expression on the regulation of the ytmI–ytnM operon

The results of the sequence analysis indicated a possible role of YrzC in the regulation of the ytmI–ytnM operon. To confirm that yrzC indeed encodes a regulator for this operon, this gene was cloned behind a strong xylose inducible promoter and integrated into the genome of the RK399a strain (see the ISZ7 strain construction).

To investigate the possible involvement of yrvO in the regulation of the ytmI–ytnM operon, a similar construct was created for the yrvO gene (strain ISV1 construction). The ISV1 strain didn't differ from the RK399a in the riboflavin accumulation or in the riboflavin kinase activity.

Riboflavin accumulation in the ISZ7 strain under non-inducing conditions was typical for the RK399a strain and amounted to (1–2) μg ml⁻¹, but increased up to 40 μg ml⁻¹ after 16 h of growth in xylose containing medium. The difference could be clearly seen by the fluorescence of the colonies on the plates with 1% xylose (Fig. 4). Expression of YrzC in all MO_R-mutation strains has no effect on riboflavin accumulation and riboflavin kinase activity.

4

Riboflavin accumulation in the ISZ7 strain expressing YrzC. Strains RK399a and ISZ7 were streaked on LB or LB + 1% xylose agar plates. The picture of the plates is made under UV-light to reveal the fluorescence of riboflavin.

The C terminus of YrzC was genetically modified and contained the FLAG epitope recognizable by the M2 monoclonal antibody. The FLAG-modified YrzC did not differ from the corresponding unmodified YrzC in the ability to increase the riboflavin production in the RK399a strain (data not shown). After induction of ISZ7 with 1% xylose, the YrzC content was followed by the immunoblotting and the changes in ribR transcription were determined by dot-blot analysis (Fig. 5). The correlation between yrzC expression, ribR (and thus the ytmI–ytnM operon) transcription and riboflavin accumulation in the growth medium is demonstrated in Fig. 5. The ribR transcript disappeared in the yrzC expressing cells 1 h after induction. The riboflavin accumulation was delayed and started about 2 h after addition of the inductor.

5

YrzC is involved in the regulation of the ytmI–ytnM operon. Cells of the ISZ7 strain were grown in LB broth to an OD₆₀₀= 0.5 before xylose was added. Extracts from the ISZ7 were prepared 1, 2 or 3 h after induction with xylose. The riboflavin accumulation measured in the growth medium is shown in the lower panel of the figure. (a) YrzC-FLAG expression. ISZ7 cell extracts were separated by SDS–PAGE and immunoblotted with anti-FLAG M2 monoclonal antibody. Approximately 40 g of total protein was loaded onto each lane. (b) ribR gene transcription as measured by RNA dot blotting. Total RNA isolated from the ISZ7 cell extract was blotted at 10, 5 or 2.5 μg. The DNA hybridization probe was prepared against ribR using the DIG labeling kit.

4 Discussion

Recent investigations on the mechanism of the riboflavin biosynthesis in B. subtilis revealed the importance of the flavins (FMN and FAD) in the regulation of the rib-operon [6]. In particular, the phenotype of riboflavin overproduction of the ribC mutant strains is the result of the low intracellular FMN content due to the decreased riboflavin kinase activity of RibC [4,6]. After the finding and characterization of the additional riboflavin kinase encoded by the ribR gene [8,19], it was hypothesized that expression of ribR could restore the flavin balance in the ribC mutant cells. The results of our present studies confirm this hypothesis, because the derepression of the rib-operon, which in turn leads to riboflavin accumulation in the growth medium, depended on the level of ribR gene expression. This phenomenon was used for investigation of the regulation of the ytmI–ytnM operon.

Inactivation of the genes ytmM, ytmO and ytnJ upstream of ribR revealed the coordinated expression of these genes and ribR. The existence of the large 10 kb transcript corresponding to the ytmI–ytnM operon was further confirmed by Northern blot experiments. Notably, in the WT or RK (ribC1) strains this transcript was not detectable.

The expression of this operon was recently investigated in the context of the growth of B. subtilis in the presence of sulfate or methionine as the sole sulfur source [11,20]. The transcriptional level of the ytmI gene was very weak during growth with sulfate, cysteine and thiosulfate and increased in the presence of methionine, taurine or glutathione [20]. It was hypothesised that the expression of this operon is induced during sulfur limitation (glutathione and taurine) and in the presence of methionine. YtlI was shown to be a positive regulator of the ytmI–ytnM operon [11]. The functions of most of the proteins encoded by this operon are unknown and could be assigned only based on sequence similarities. The YtmJ-N proteins exhibit sequence similarity to ABC transporters specific for polar amino acids, HipO protein is homologous to amino acid amidohydrolases and the ytnJ gene product shares similarities with monoxygenases. Noteworthy, at least 2 proteins (YtmO and YtnI) show a similarity to the flavoproteins [21] and, probably, require the flavokinase activity of RibR for their function.

The mutants with the upregulated ribR gene, which have been investigated in this work, were selected for resistance to MO. The riboflavin analogue MO blocks the formation of FMN and inhibits the normal activities of the flavoproteins in the cells. It is not surprising, that our mutagenesis experiments resulted in the selection of mutations, which cause derepression of the operon containing the ribR gene. All mutations in the region upstream of ytmI, the first gene of the ytmI–ytnM operon, fall into an 8 nucleotide sequence. This observation suggests that this region is a cis-acting target in the promoter of the ytmI–ytnM operon and plays a key role in the regulation of the expression of this operon. These mutations could reduce the binding affinity of the hypothetical DNA binding repressor or increase the DNA binding affinity of YtlI, a putative transcriptional activator of the operon [11]. The effect of mutations in the SD sequence or within the yvzC gene indicates that the YrzC protein is involved in the regulation of ytmI–ytnM. The results of in trans complementation experiments for the yrzC mutants demonstrate that the expression of yrzC stops the transcription of this operon and identify YrzC as a negative regulator. Expression of YrzC has no effect on the cis-acting mutations in the ytmI-promotor region. Based on the deduced sequence of YrzC, which has a DNA-binding domain, one can hypothesize that YrzC is a DNA binding repressor, and mutations in the promoter region of the ytmI–ytnM operon reduce its affinity for the target DNA. However, more complicated mechanism for the regulation can not be excluded. For example, sequence analysis suggests that yrzC is cotranscribed with the yrvO-a gene, encoding a cystein desulfurase [22]. The results of our experiments exclude a direct role of YrvO in the regulation of the ytmI–ytnM operon, but repression or derepression of a cystein desulfurase could influence the Fe-S cluster proteins, which appear to have regulatory functions [23]. The investigation of the mechanism of the regulation of the ytmI–ytnM operon and elucidation of the role of YrzC, YtlI and YrvO in this regulation is a subject for future experimental work.

Acknowledgements

This work was supported by the EMBO (Short term fellowship programme, project ASTF No. 9523) and the Russian Foundation for Basic Research (project 03-04-9428).