Abstract

Pseudomonas aeruginosa, a Gram-negative opportunistic pathogen, translocates exoenzymes (Exo) directly into the eukaryotic cell cytoplasm. This is accomplished by a type III secretion/translocation machinery. Here, we show that the P. aeruginosa type III secretory needle structure is composed essentially of PscF, a protein required for secretion and P. aeruginosa cytotoxicity. Partially purified needles, detached from the bacterial surface, are 60–80 nm in length and 7 nm in width, resembling needles from Yersinia spp. YscF of Yersinia enterocolitica was able to functionally complement the pscF deletion, but required 11 P. aeruginosa-specific amino acids at the N-terminus for its function.

Introduction

Pseudomonas aeruginosa is a major opportunistic Gram-negative pathogen responsible for severe nosocomial infections, notably in immunocompromised patients with pathologies such as cancer, burns and AIDS. In chronic cystic fibrosis disease, P. aeruginosa is a predominant pathogen provoking pulmonary damage and major inflammation reactions, leading to morbidity and mortality of infected patients [1,2]. Among an important number of virulence factors identified to date, type III-secreted toxins play a crucial role in different kinds of P. aeruginosa infections [3,4]. All P. aeruginosa clinical strains possess a chromosome locus encoding type III injectisome components and genes for effectors-exoenzymes ExoS, ExoT, ExoU and ExoY, whose activities modify normal cellular functions [5–7].

Type III secretion/translocation systems are complex nano-machines allowing the secretion and injection of bacterial toxins (effectors) directly into the eukaryotic host cell cytoplasm. They are composed of approximately 20 conserved components that are assembled in a supramolecular structure imbedded in the two bacterial membranes [8–10]. Bacterial proteins are thought to travel partially unfolded through a structure resembling a 20 nm-hollow needle. In most of the bacterial species, the needle is composed essentially of one low molecular weight protein (PrgI in Salmonella spp.; MxiH in Shigella spp., and YscF in Yersinia spp.) which polymerizes and forms a structure of 60–100 nm in length [11–15]. Notably, the secretory needle length is strictly controlled by a protein, YscP in Yersinia enterocolitica, acting as a molecular ruler [16,17]. Recently, it has been suggested that the needle proteins could have immuno-protection activities, since vaccination of mice with the YscF recombinant protein provides significant protection against challenge with Y. pestis [18].

To obtain initial insights into P. aeruginosa needle biogenesis, we constructed a deletion mutant in a gene encoding the putative needle component PscF and raised antibodies against recombinant PscF. The PscF-deficient mutant was non-cytotoxic toward macrophages and unable to secrete type III proteins in vitro. Partially purified P. aeruginosa type III needles, visualized by electron microscopy, contained PscF as their major component. The complementation studies with YscF of Yersinia enterocolitica, or a YscF/PscF hybrid molecule showed that the first 11 N-terminal residues of PscF are species-specific and essential for the export/assembly and function of needle components.

Materials and methods

Bacterial strains and growth conditions

P. aeruginosa strains used in this study are listed in Table 1. Cytotoxic CF isolate CHA was used as parental strain [19,20]. P. aeruginosa was grown on Pseudomonas Isolation Agar (PIA; Difco) plates or in liquid Luria Broth (LB) medium at 37 °C with agitation. The antibiotic used for selection was carbenicillin at 500 μg/ml for PIA plates and 300 μg/ml in LB and Gm at 400 μg/ml. T3S was induced in vitro by growing P. aeruginosa in LB containing 5 mM EGTA and 20 mM MgCl2, until the cultures reached OD600 of 1.5. Escherichia coli DH5α (Invitrogen) was used for standard cloning experiments. E. coli Top10 strain was employed when using TOPO blunt-ended cloning kit (Invitrogen). E. coli BL21(DE3)Star (Invitrogen) was used for overproduction of 6His-tagged PscF.

1

Strains and plasmids

Strain or plasmid Relevant genotype or phenotype Source or reference(s) 
Strains   
E. coli DH5α  Invitrogen 
P. aeruginosa   
CHA Mucoid, cytotoxic cystic fibrosis isolate  [19,20
CHAΔF CHA with an internal deletion of the pscF gene This study 
CHA fliC CHA with the gentamycin cassette inserted within fliC This study 
CHA fliCΔF CHA fliC with an internal deletion of the pscF gene This study 
   
Plasmids   
pRK2013 Kmr, ColE1 mob+tra+ (RK2) helper plasmid  [21
pGEM-T Apr, cloning vector Promega 
pYV40 Pathogenicity plasmid of Yersinia enterocolitica  [29
PGEM-T/pscF Apr, Nde I/Bam HI PCR fragment of pscF in pGEM-T This study 
pGEM-T/fliC34 Apr, PCR fragment of fliC in pGEM-T This study 
pGEM-T/fliCGm Apr, Gmr, gentamycin cassette inserted within fliC This study 
pGEM-T/5′F Apr, PCR fragment containing the 5′ flanking region of pscF This study 
pGEM-T/3′F Apr, PCR fragment containing the 3′ flanking region of pscF This study 
pUC19 Apr, cloning vector New England Biolabs 
pUCΔF Apr, pUC19 containing the 5′ and 3′pscF flanking regions This study 
pEX100-T Apr, sacB  [23
pUCGm Apr, Gmr  
pEX100-T/fliCGm Apr, Gmr, pEX100-T containing inactivated fliC This study 
pEXΔF Eco RI/Hin dIII insert from pUCΔF cloned into Sma I in pEX100-T This study 
pIApG Fusion between the pcrGVH-popBD promoter (pG) and gfp mut3  [24
pIApG/pscF pscF cloned downstream of pG into pIApG This study 
pIApG/yscF yscF cloned downstream of pG into pIApG This study 
pIApG/FHyb FHyb cloned downstream of pG into pIApG This study 
pET15b Apr, overexpression plasmid Novagen 
pET15/F pscF cloned into Nde I–Bam HI of pET15b This study 
Strain or plasmid Relevant genotype or phenotype Source or reference(s) 
Strains   
E. coli DH5α  Invitrogen 
P. aeruginosa   
CHA Mucoid, cytotoxic cystic fibrosis isolate  [19,20
CHAΔF CHA with an internal deletion of the pscF gene This study 
CHA fliC CHA with the gentamycin cassette inserted within fliC This study 
CHA fliCΔF CHA fliC with an internal deletion of the pscF gene This study 
   
Plasmids   
pRK2013 Kmr, ColE1 mob+tra+ (RK2) helper plasmid  [21
pGEM-T Apr, cloning vector Promega 
pYV40 Pathogenicity plasmid of Yersinia enterocolitica  [29
PGEM-T/pscF Apr, Nde I/Bam HI PCR fragment of pscF in pGEM-T This study 
pGEM-T/fliC34 Apr, PCR fragment of fliC in pGEM-T This study 
pGEM-T/fliCGm Apr, Gmr, gentamycin cassette inserted within fliC This study 
pGEM-T/5′F Apr, PCR fragment containing the 5′ flanking region of pscF This study 
pGEM-T/3′F Apr, PCR fragment containing the 3′ flanking region of pscF This study 
pUC19 Apr, cloning vector New England Biolabs 
pUCΔF Apr, pUC19 containing the 5′ and 3′pscF flanking regions This study 
pEX100-T Apr, sacB  [23
pUCGm Apr, Gmr  
pEX100-T/fliCGm Apr, Gmr, pEX100-T containing inactivated fliC This study 
pEXΔF Eco RI/Hin dIII insert from pUCΔF cloned into Sma I in pEX100-T This study 
pIApG Fusion between the pcrGVH-popBD promoter (pG) and gfp mut3  [24
pIApG/pscF pscF cloned downstream of pG into pIApG This study 
pIApG/yscF yscF cloned downstream of pG into pIApG This study 
pIApG/FHyb FHyb cloned downstream of pG into pIApG This study 
pET15b Apr, overexpression plasmid Novagen 
pET15/F pscF cloned into Nde I–Bam HI of pET15b This study 

Construction of CHAΔF, CHAfli C and CHAfli CΔF mutant strains

All plasmids and primers used in this study are listed in Tables 1 and 2, respectively. The CHAΔF mutant was created using the following strategy. The 5′ and 3′ flanking regions of pscF were amplified in two separate PCR reactions using genomic DNA from the strain CHA as template. The oligonucleotides used to amplify the 5′ flanking region of pscF were Fnew5 and Fnew6 and amplification of the 3′ flanking region of pscF was achieved with F5 and F6. The two PCR products were ligated together in pUC19, giving the plasmid pUCΔF. To carry out gene replacement on the P. aeruginosa chromosome, the Eco RI-Hin dIII insert from pUCΔF was blunt-ended with the Klenow enzyme and subcloned into Sma I-digested pEX100-T. The resulting suicide plasmid, pEXΔF, was then transferred to P. aeruginosa CHA by triparental mating using pRK2013 as a helper plasmid as described [21]. Double recombinants were isolated by a negative selection strategy using 5% sucrose PIA plates as described [22]. The correct double recombination event at the psc locus was verified by Southern blot and genomic sequencing. For needle purifications, the pscF mutation was transferred into non-flagellated CHA fliC mutant which was constructed as follows. The fliC gene was amplified with oligonucleotides fliC3 and fliC4 and the PCR product cloned into pGEM-T (Promega). The Gentamicin cassette (Gm) from pUCGm [23] was extracted by Sma I digestion and inserted into pGEM-T/fliC34. The whole insert fliC-Gm was cloned into pEX100-T, and the mutation conjugated into CHA by triparental mating. The double recombinants were screened for Gm-resistance and Cb-sensitivity. Non-motile mutants were further verified by Southern blot.

2

Oligonucleotides

Primer DNA sequencea 
fliC3 5′-ATGGCCCTTACAGTCAACAC 
fliC4 5′-TTAGCGCAGCAGGCTCAGGAC 
Fnew5 5′-CA GAATTC CGCGAGCGCGGCGA 
Fnew6 5′-AC GGATCC GGTTGAATATCTGCGCCATG 
F5 5′-CA GGATCC TGCAGAAGATCTGAACATG 
F6 5′-AC AAGCTT GCAGCGGCTGGGCAAAGCG 
FNde 5′-C CATATG GCGCAGATATTCAACCC 
FBam 5′-GA GGATCC TCAGATCTTCTGCAGGATGC 
FHind 5′-CC AAGCTT TCAGATCTTCTGCAGGATG 
YscFNde 5′-C CATATG AGTAATTTCTCTGGGTTTGC 
YscFHind 5′-CC AAGCTT ATGGGAACTTCTGTAGG 
YscFmod 5′-C CATATG GCGCAGATATTCAACCCCAACCCGATCACAGACTTAGATGCGG 
Primer DNA sequencea 
fliC3 5′-ATGGCCCTTACAGTCAACAC 
fliC4 5′-TTAGCGCAGCAGGCTCAGGAC 
Fnew5 5′-CA GAATTC CGCGAGCGCGGCGA 
Fnew6 5′-AC GGATCC GGTTGAATATCTGCGCCATG 
F5 5′-CA GGATCC TGCAGAAGATCTGAACATG 
F6 5′-AC AAGCTT GCAGCGGCTGGGCAAAGCG 
FNde 5′-C CATATG GCGCAGATATTCAACCC 
FBam 5′-GA GGATCC TCAGATCTTCTGCAGGATGC 
FHind 5′-CC AAGCTT TCAGATCTTCTGCAGGATG 
YscFNde 5′-C CATATG AGTAATTTCTCTGGGTTTGC 
YscFHind 5′-CC AAGCTT ATGGGAACTTCTGTAGG 
YscFmod 5′-C CATATG GCGCAGATATTCAACCCCAACCCGATCACAGACTTAGATGCGG 

aRestriction sites incorporated into primers are underlined.

Construction of complementation plasmids

All complementations were performed using pIApG in which the gfp cassette was replaced by a gene of interest, thus placing it under the control of the type III promotor ppcrG, as described in [24]. The pscF gene was PCR amplified by oligonucleotides FNde1 and FHind, cloned into TOPO blunt-ended (Invitrogen) and sequenced before the transfer into Nde I–Hin dIII-digested pIApG. The yscF gene from the pathogenicity plasmid pYV40 of Y. enterocolitica was PCR amplified by oligonucleotides YscFNde and YscFHind, cloned into TOPO (Invitrogen) and sequenced before the transfer into Nde I–Hin dIII-digested pIApG. The hybrid gene pscFyscF was obtained by PCR and cloned into pIApG.

Purification of 6His-tagged PscF, antibody production and immunoblotting

The pscF gene was amplified with oligonucleotides FNde and FBam, cloned into pGEM-T and sequenced. The Nde I–Bam HI fragment was cloned into pET15b, generating pET15/F. The final construct was introduced into E. coli BL21(DE3)Star (Invitrogen). Induction with isopropyl-β-d-thiogalactopyranoside (IPTG, 1 mM) was done in LB medium at 37 °C for 3 h. Cells were harvested by centrifugation and cleared lysate was obtained by sonication and subsequent centrifugation. The lysate was charged on a 1 ml HiTrap Chelating HP column (Amersham Pharmacia) and 6His-tagged PscF was eluted with increasing concentrations of imidazole in 50 mM Tris–HCl pH 8, 0.5 M NaCl, 10% glycerol buffer, following manufacturer's instructions. The purified protein was used to produce polyclonal antibodies in rabbits (Eurogentec). Specific anti-PscF antibodies were further affinity-purified from the serum employing preactivated CH Sepharose 4B resin (Amersham Pharmacia) coupled with recombinant 6His-PscF as described in the manufacturer's protocol. For immunoblot analysis membranes were developed using the ECL kit (Amersham Pharmacia). Antibodies Anti-PscF were used at concentration of 1:3000. Anti-YscF antibodies were a gift from Yan Olsson and Åke Forsberg (Umeå University, Sweden). They were used at 1:2000 dilution.

Needle preparation and transmission electron microscopy

In order to purify needles, bacteria were cultivated for 3 h in LB under TTS inducing. Bacteria were harvested by centrifugation (10 min at 5700g) and washed once in 1/30 of the culture volume with 20 mM Tris–HCl (pH 7.5). The washing supernatant was passed through a 0.45 μm mesh filter and centrifuged for 30 min at 18,000g. The pellet was resuspended in 1/60 of the initial culture volume of Tris–HCl 20 mM (pH 7.5), CHAPS 0.1% (w/v) and centrifuged again for 30 min at 50,000g. The supernatant was collected and the needles were precipitated for 1 h on ice with polyethylene glycol 6000 (10% w/v) and NaCl (100 mM). The needles were then collected by 30 min centrifugation at 50,000g and resuspended in 1/300 of initial volume of 20 mM Tris–HCl (pH 7.5). Samples were applied to a grid covered by carbon and negatively stained with 1% sodium silicotungstate; pH 7.5. Micrographs were taken under low-dose conditions with a JEOL 1200 EX II microscope at 100 kV and a calibrated magnification of 39,750×.

Protein digestion

Selected spots were manually excised from silver-stained gels, washed several times with destaining solutions (25 mM NH4HCO3 for 15 min and then with 50% (v/v) acetonitrile containing 25 mM NH4HCO3 for 15 min) and finally dehydrated with 100% acetonitrile and subjected to drying. Gel pieces were then incubated with a reducing solution (25 mM NH4HCO3 containing 10 mM dithiothreitol) for 1 h at 37 °C, and subsequently with an alkylating solution (25 mM NH4HCO3 containing 55 mM iodoacetamide) for 30 min at 37 °C. In-gel digestion was performed using trypsin (sequencing grade, Promega, Madisson, WI) at a 1:20 protease to protein ratio, in 25 mM NH4HCO3 for 5 h at 37 °C. Peptides were extracted from the gel using passive diffusion in the following solutions: 50% CH3CN, then formic acid 5%, and finally CH3CN 100%. The extract was dried by vacuum centrifugation.

The dried gel-extracted tryptic peptides were resolubilized in 95% water (v/v) containing 2.5% acetonitrile and 2.5% trifluoroacetic acid for nano-LC-MS and nano-LC–MS/MS analysis (CapLC and Q-TOF Ultima, Waters, Milford, MA). The method consisted in a 50 min run at a flow rate of 200 nL/min using a two-solvent gradient: solvent A (2% acetonitrile: 97.9% water: 0.1% formic acid) and solvent B (80% acetonitrile: 19.9% water: 0.1% formic acid). The system includes a 300 μm × 5 mm PepMap C18 precolumn (LC-Packings, Dionex, Sunnivale, CA) to concentrate peptides before injection onto a 75 μm × 150 mm C18 column (LC-Packings) directly coupled to the mass spectrometer (Q-TOF Ultima, Waters).

Protein identification

MS/MS data were acquired and processed automatically using MassLynx 3.5 software (Waters). Database searching was carried out on an updated compilation of SwissProt and Trembl (http://us.expasy.org/databases/sp_tr_nrdb/) using the MASCOT 1.7 program. All the peptide sequences were checked manually.

Infection experiments

The macrophage cell line J774 (ATCC) was grown in DMEM (Gibco) supplemented with 10% heat-inactivated fetal calf serum (FCS; Gibco). The cells were seeded in 24-well culture plates at 3 × 105 cells per well 20 h before infection. The bacterial strains were grown in LB overnight, diluted to an optical density of 0.1 at 600 nm (OD600) and grown further for 3 h to an OD600 of between 1.0 and 1.5. Macrophages were infected with bacteria with an multiplicity of infection (MOI) of 5. Cytotoxicity was assessed at 3 h post-infection by determination of LDH release into infected supernatants using a cytotoxicity detection kit (Roche) as described previously [25].

Results and discussion

PscF is required for type III-dependent secretion and cytotoxicity in P. aeruginosa

In P. aeruginosa, the putative type III needle subunit is encoded by the pscF gene localised within the large operon exsD-pscC-L ( [26]; http://www.pseudomonas.com). To ascertain the role of PscF in P. aeruginosa cytotoxicity and type III secretion, we constructed in the cytotoxic clinical isolate CHA a non-polar pscF deletion by allelic exchange techniques. The mutant, named CHAΔF, was then complemented in trans with the wild-type pscF gene cloned under the control of the type III promotor ppcrG [24] to verify that the mutation did not affect the expression of downstream genes. To be able to identify PscF within P. aeruginosa we raised polyclonal serum against the recombinant 6His-PscF protein. When total cell extracts from P. aeruginosa were analyzed by immunoblot, anti-PscF antibodies recognized one polypeptide of 9 kDa corresponding to the predicted molecular mass of PscF (Mw 9396 Da). This polypeptide was absent in the deletion mutant and restored when the pscF gene was reintroduced in the mutant by the plasmid pIApG/pscF (Fig. 1A). Strains were then examined for their secretory phenotype in vitro and for their cytotoxicity on macrophage cell line J774. The wild-type strain CHA secretes two type III effectors ExoS and ExoT, and translocators PcrV, PopB and PopD ( [19] and Fig. 1B) under type III-inducing conditions (LB + EGTA). The pscF mutation abolished type III secretion, which was restored in the complemented strain (ΔF/F; Fig. 1B). As secretion in vitro is a prerequisite for cytotoxicity, we also examined the capacity of the strains to provoke macrophage cell death. As previously reported, at a low multiplicity of infection of 5, the wild type strain CHA killed 70–80% of cells within 3 h. PscF-deficiency completely abolished the cytotoxicity to basal levels, while the complemented strain regained the cytotoxic phenotype to the wild-type levels (Fig. 1C).

1

PscF is essential for type III secretion and cytotoxicity. (A) Characterization of the CHAΔF mutant. Whole-cell extracts were analyzed on SDS–15% PAGE run in Tris–Tricine buffer and immuno-analyzed with anti-PscF antibodies and anti-PcrV antibodies, used as loading control. (B) Whole secretion profiles of PscF-deficient strain. TTS-induced culture supernatants (+) were resolved on SDS–12% PAGE, transferred to the nitrocellulose membrane and immunobloted with anti-ExoS, anti-PopB, anti-PopD and anti-PcrV. Non-induced wild-type culture supernatants were loaded as control (−). (C) Cytotoxicity assay. Macrophage cell line J774 was infected at MOI of 5 with bacteria grown to mid-exponential phase (OD600 of 1.2–1.5) in LB medium. Cell death was assayed at 3 h-post-infection by measuring the release of lactate dehydrogenase into cell supernatants using LDH cytototoxicity kit (Roche). The values are the means of three experiments; error bars indicate standard deviation.

1

PscF is essential for type III secretion and cytotoxicity. (A) Characterization of the CHAΔF mutant. Whole-cell extracts were analyzed on SDS–15% PAGE run in Tris–Tricine buffer and immuno-analyzed with anti-PscF antibodies and anti-PcrV antibodies, used as loading control. (B) Whole secretion profiles of PscF-deficient strain. TTS-induced culture supernatants (+) were resolved on SDS–12% PAGE, transferred to the nitrocellulose membrane and immunobloted with anti-ExoS, anti-PopB, anti-PopD and anti-PcrV. Non-induced wild-type culture supernatants were loaded as control (−). (C) Cytotoxicity assay. Macrophage cell line J774 was infected at MOI of 5 with bacteria grown to mid-exponential phase (OD600 of 1.2–1.5) in LB medium. Cell death was assayed at 3 h-post-infection by measuring the release of lactate dehydrogenase into cell supernatants using LDH cytototoxicity kit (Roche). The values are the means of three experiments; error bars indicate standard deviation.

PscF is a major component of the P. aeruginosa TTS needle

Taking into account the requirement for PscF in the TTS-dependent secretion and cytotoxicity and its sequence homology with the major Yersinia needle component YscF [13,16] we prepared bacterial fractions containing extracellular appendages and searched for structures resembling Yersinia type III needles by transmission electron microscopy. In the preliminary experiments, samples prepared from the wild-type P. aeruginosa strain CHA cultivated in Ca2+-depleted medium contained mostly long bacterial flagella (not shown). To eliminate these structures that interfered with the isolation of the needle-like structures of the type III apparatus, the gene fliC encoding the major subunit of the P. aeruginosa flagellum was inactivated on the CHA chromosome as described in Section 2. The purification of extracellular structures from the CHA fliC mutant precultured in the type III-inducing conditions, following the procedure described for Yersinia needles [13], allowed the visualization of small needle-like structures approximately 60–80 nm long and 6–7 nm wide (Fig. 2A) that were absent from the CHA fliCΔF mutant. Furthermore, these extrabacterial preparations mostly contained the PscF protein as assayed by Western blotting analysis using anti-PscF antibodies. To analyze in detail the protein composition of semi-purified needle samples, preparations were analyzed on SDS–PAGE and proteins were visualized by silver-nitrate staining and identified by mass spectrometry as described in Section 2 (Fig. 2B). In addition to a 9-kDa majority band corresponding to PscF, the sample contained several additional polypeptides identified by nano-LC–MS/MS such as the fimbrial protein precursor (PilA, Acc. No: P17836), the outer membrane porin F precursor (OprF, P13794, P. aeruginosa Gene No. PA1777) and putative bacteriophage proteins (Q9I5S9; PA0623 and Q9S574; PA0622). No other type III-related proteins could be detected in detached needle fractions.

2

PscF is a major component of partially purified P. aeruginosa needles. (A) Partially purified needles obtained from the CHA fliC strain were visualized by transmission electron microscopy. (B) The same sample was analyzed by silver-nitrate (SN) stained polyacrylamide gel and immunoblotting (WB) by using affinity-purified anti-PscF antibodies.

2

PscF is a major component of partially purified P. aeruginosa needles. (A) Partially purified needles obtained from the CHA fliC strain were visualized by transmission electron microscopy. (B) The same sample was analyzed by silver-nitrate (SN) stained polyacrylamide gel and immunoblotting (WB) by using affinity-purified anti-PscF antibodies.

The P. aeruginosa-specific N-terminal sequence of PscF is important for needle function

PscF shares 57% amino acid identity with the Yersinia major needle component YscF (Fig. 3A). To see whether YscF is able to complement the PscF-deficient mutant of P. aeruginosa, the gene encoding YscF was amplified from the Y. enterocolitica genome and cloned into pIApG, creating pIApG/yscF. The YscF protein was synthesized, as detected by the anti-YscF antibodies, in whole-cell lysates, but was not able to restore the type III secretion phenotype and cytotoxicity of the pscF mutant (Fig. 3), suggesting that YscF is not exported or properly polymerized into the needle on the bacterial surface. Interestingly, the first 15 amino acids of YscF and first 12 amino acids of PscF show no sequence identity, whereas the rest of the protein shares 67% of identity. To see whether the first 11 amino acids from the N-terminus are important for YscF export in P. aeruginosa, the hybrid pscF-yscF gene was created by PCR and introduced into the complementation vector pIApG. The PscF-YscF hybrid protein (FHyb) was synthesized at levels similar to YscF, but only the hybrid was capable of complementing the P. aeruginosa mutant for secretion and cytotoxicity, albeit at a level lower than that obtained with the native PscF protein (Fig. 3). This may indicate either less efficient transport/polymerization of the hybrid protein or a lower stability of the needle.

3

Complementation assay with Y. enterocolitica YscF and a PscF-YscF hybrid protein. (A) Amino acid sequence comparison between PscF and YscF. The hybrid protein, FHyb, contains the first 11 amino acids of PscF fused to the 15th amino acid of YscF. The coiled-coil domain of PscF is underlined. (B) Whole cell extracts were analysed by immunoblotting with anti-PscF or anti-YscF antibodies. (C) Secretion capacity of complemented strains was checked by immunoblotting as described in Fig. 1. (D) Cytotoxicity of complemented strains on macrophage cell line J774, as described in the legend to Fig. 1.

3

Complementation assay with Y. enterocolitica YscF and a PscF-YscF hybrid protein. (A) Amino acid sequence comparison between PscF and YscF. The hybrid protein, FHyb, contains the first 11 amino acids of PscF fused to the 15th amino acid of YscF. The coiled-coil domain of PscF is underlined. (B) Whole cell extracts were analysed by immunoblotting with anti-PscF or anti-YscF antibodies. (C) Secretion capacity of complemented strains was checked by immunoblotting as described in Fig. 1. (D) Cytotoxicity of complemented strains on macrophage cell line J774, as described in the legend to Fig. 1.

In conclusion, exchanging the first 15 amino acids of YscF by 11 N-terminal amino acids of PscF allowed the functional complementation of the pscF P. aeruginosa mutant by the hybrid protein. The absence of YscF export and function in P. aeruginosa seems not to be a general recognition problem between Psc and Ysc export machines, since a sub-set of translocators (PopB and PopD of P. aeruginosa, and YopB and YopD of Yersinia) are secreted by the heterologous host and are functionally interchangeable ( [27], J. Goure and I. Attree, unpublished results). In addition, the P. aeruginosa ExoS effector is secreted by the Ysc secreton and translocated into host cells [28]. It is possible that the N-terminal region of PscF is required for specific interaction with its intrabacterial or extrabactarial partners, that may be species-specific. Further biochemical and genetic studies are underway to elucidate the assembly mechanism involved in functional needle biogenesis in P. aeruginosa.

Acknowledgements

We thank Sylvie Elsen for helpful discussions and critical reading of the manuscript and Guy Schoehn for the electron microscopy. Thanks to Drs. Yan Olsson and Åke Forsberg for providing anti-YscF antibodies. A.P. is a PhD student granted by French Cystic Fibrosis association “Vaincre la Mucoviscidose”. This work was supported by CNRS and the grants from Rhône-Alpes region and from “Vaincre la Mucoviscidose”.

References

[1]
Lyczak
J.B.
Cannon
C.L.
Pier
G.B.
(
2000
)
Establishment of Pseudomonas aeruginosa infection: lessons from a versatile opportunist
.
Microbes. Infect.
 
2
,
1051
1060
.
[2]
Lyczak
J.B.
Cannon
C.L.
Pier
G.B.
(
2002
)
Lung infections associated with cystic fibrosis
.
Clin. Microbiol. Rev.
 
15
,
194
222
.
[3]
Berthelot
P.
Attree
I.
Plesiat
P.
Chabert
J.
De Bentzmann
S.
Pozzetto
B.
Grattard
F.
(
2003
)
Genotypic and phenotypic analysis of type III secretion system in a cohort of Pseudomonas aeruginosa bacteremia isolates: evidence for a possible association between O serotypes and exo genes
.
J. Infect. Dis.
 
188
,
512
518
.
[4]
Roy-Burman
A.
Savel
R.H.
Racine
S.
et al.   (
2001
)
Type III protein secretion is associated with death in lower respiratory and systemic Pseudomonas aeruginosa infections
.
J. Infect. Dis.
 
183
,
1767
1774
.
[5]
Dacheux
D.
Attree
I.
Toussaint
B.
(
2001
)
Expression of ExsA in trans confers type III secretion system-dependent cytotoxicity on noncytotoxic Pseudomonas aeruginosa cystic fibrosis isolates
.
Infect. Immun.
 
69
,
538
542
.
[6]
Frank
D.W.
(
1997
)
The exoenzyme S regulon of Pseudomonas aeruginosa
.
Mol. Microbiol.
 
26
,
621
629
.
[7]
Jain
M.
Ramirez
D.
Seshadri
R.
et al.   (
2004
)
Type III secretion phenotypes of Pseudomonas aeruginosa strains change during infection of individuals with cystic fibrosis
.
J. Clin. Microbiol.
 
42
,
5229
5237
.
[8]
Cornelis
G.R.
van Gijsegem
F.
(
2000
)
Assembly and function of type III secretory systems
.
Annu. Rev. Microbiol.
 
54
,
735
774
.
[9]
Galan
J.E.
Collmer
A.
(
1999
)
Type III secretion machines: bacterial devices for protein delivery into host cells
.
Science
 
284
,
1322
1328
.
[10]
Marlovits
T.C.
Kubori
T.
Sukhan
A.
Thomas
D.R.
Galan
J.E.
Unger
V.M.
(
2004
)
Structural insights into the assembly of the type III secretion needle complex
.
Science
 
306
,
1040
1042
.
[11]
Blocker
A.
Jouihri
N.
Larquet
E.
Gounon
P.
Ebel
F.
Parsot
C.
Sansonetti
P.
Allaoui
A.
(
2001
)
Structure and composition of the Shigella flexneri“needle complex”, a part of its type III secreton
.
Mol. Microbiol.
 
39
,
652
663
.
[12]
Cordes
F.S.
Komoriya
K.
Larquet
E.
Yang
S.
Egelman
E.H.
Blocker
A.
Lea
S.M.
(
2003
)
Helical structure of the needle of the type III secretion system of Shigella flexneri
.
J. Biol. Chem.
 
278
,
17103
17107
.
[13]
Hoiczyk
E.
Blobel
G.
(
2001
)
Polymerization of a single protein of the pathogen Yersinia enterocolitica into needles punctures eukaryotic cells
.
Proc. Natl. Acad. Sci. USA
 
98
,
4669
4674
.
[14]
Kimbrough
T.G.
Miller
S.I.
(
2000
)
Contribution of Salmonella typhimurium type III secretion components to needle complex formation
.
Proc. Natl. Acad. Sci. USA
 
97
,
11008
11013
.
[15]
Kubori
T.
Matsushima
Y.
Nakamura
D.
Uralil
J.
Lara-Tejero
M.
Sukhan
A.
Galan
J.E.
Aizawa
S.I.
(
1998
)
Supramolecular structure of the Salmonella typhimurium type III protein secretion system
.
Science
 
280
,
602
605
.
[16]
Journet
L.
Agrain
C.
Broz
P.
Cornelis
G.R.
(
2003
)
The needle length of bacterial injectisomes is determined by a molecular ruler
.
Science
 
302
,
1757
1760
.
[17]
Mota
L.J.
Journet
L.
Sorg
I.
Agrain
C.
Cornelis
G.R.
Bacterial injectisomes: needle length does matter
.
Science
 
307
2005
1278
.
[18]
Swietnicki
W.
Powell
B.S.
Goodin
J.
(
2005
)
Yersinia pestis Yop secretion protein F: purification, characterization, and protective efficacy against bubonic plague
.
Protein Exp. Purif.
 
42
,
166
172
.
[19]
Dacheux
D.
Attree
I.
Schneider
C.
Toussaint
B.
(
1999
)
Cell death of human polymorphonuclear neutrophils induced by a Pseudomonas aeruginosa cystic fibrosis isolate requires a functional type III secretion system
.
Infect. Immun.
 
67
,
6164
6167
.
[20]
Toussaint
B.
Delic-Attree
I.
Vignais
P.M.
(
1993
)
Pseudomonas aeruginosa contains an IHF-like protein that binds to the algD promoter
.
Biochem. Biophys. Res. Commun.
 
196
,
416
421
.
[21]
Konyecsni
W.M.
Deretic
V.
(
1988
)
Broad-host-range plasmid and M13 bacteriophage-derived vectors for promoter analysis in Escherichia coli and Pseudomonas aeruginosa
.
Gene
 
74
,
375
386
.
[22]
Schweizer
H.P.
(
1992
)
Allelic exchange in Pseudomonas aeruginosa using novel ColE1-type vectors and a family of cassettes containing a portable oriT and the counter-selectable Bacillus subtilis sacB marker
.
Mol. Microbiol.
 
6
,
1195
1204
.
[23]
Schweizer
H.D.
(
1993
)
Small broad-host-range gentamycin resistance gene cassettes for site-specific insertion and deletion mutagenesis
.
Biotechniques
 
15
,
831
834
.
[24]
Goure
J.
Pastor
A.
Faudry
E.
Chabert
J.
Dessen
A.
Attree
I.
(
2004
)
The V antigen of Pseudomonas aeruginosa is required for assembly of the functional PopB/PopD translocation pore in host cell membranes
.
Infect. Immun.
 
72
,
4741
4750
.
[25]
Dacheux
D.
Toussaint
B.
Richard
M.
Brochier
G.
Croize
J.
Attree
I.
(
2000
)
Pseudomonas aeruginosa cystic fibrosis isolates induce rapid, type III secretion-dependent, but ExoU-independent, oncosis of macrophages and polymorphonuclear neutrophils
.
Infect. Immun.
 
68
,
2916
2924
.
[26]
Stover
C.K.
Pham
X.Q.
Erwin
A.L.
et al.   (
2000
)
Complete genome sequence of Pseudomonas aeruginosa PA01, an opportunistic pathogen
.
Nature
 
406
,
959
964
.
[27]
Frithz-Lindsten
E.
Holmstrom
A.
Jacobsson
L.
Soltani
M.
Olsson
J.
Rosqvist
R.
Forsberg
A.
(
1998
)
Functional conservation of the effector protein translocators PopB/YopB and PopD/YopD of Pseudomonas aeruginosa and Yersinia pseudotuberculosis
.
Mol. Microbiol.
 
29
,
1155
1165
.
[28]
Frithz-Lindsten
E.
Du
Y.
Rosqvist
R.
Forsberg
A.
(
1997
)
Intracellular targeting of exoenzyme S of Pseudomonas aeruginosa via type III-dependent translocation induces phagocytosis resistance, cytotoxicity and disruption of actin microfilaments
.
Mol. Microbiol.
 
25
,
1125
1139
.
[29]
Sarker
M.R.
Neyt
C.
Stainier
I.
Cornelis
G.R.
(
1998
)
The Yersinia Yop virulon: LcrV is required for extrusion of the translocators YopB and YopD
.
J. Bacteriol.
 
180
,
1207
1214
.