Abstract

Coxiella burnetii is the causative agent of Q fever. The bacterium is highly infectious and is classified as a category B biological weapon. The tools of molecular biology are of utmost importance in a rapid and unambiguous identification of C. burnetii in naturally occurring Q fever outbreaks, or in cases of a deliberate release of the infectious agent. In this work, development of a multiple locus variable number tandem repeats (VNTR) analysis (MLVA) for the characterization of C. burnetii is described. Sixteen C. burnetii isolates and five passage history/laboratory variants were characterized. The VNTR markers revealed many polymorphisms resulting in nine unique MLVA types that cluster into five different clusters. This proves that the MLVA system is highly discriminatory. The selected VNTR markers were stable. The MLVA method developed in this report is a promising tool for the characterization of C. burnetii isolates and their epidemiological study.

Introduction

Coxiella burnetii is an obligate intracellular, highly pleomorphic bacterium (Baca & Paretsky, 1983). It is highly infectious and causes Q fever, a zoonotic disease that is capable of transmission from animals to humans. Q fever infections occur worldwide with the exception of New Zealand (Hilbink , 1993). Acute Q fever is a self-limiting febrile flu-like illness that can be resolved in a few weeks with antibiotics (Sawyer , 1987). Chronic Q fever is usually presented as endocarditis or hepatitis (Stein & Raoult, 1995). Coxiella burnetii is extremely resistant to heat, desiccation, disinfectants and UV radiation (Madariaga , 2003). Thus, it can persist in the environment under harsh conditions for long periods and can produce infection for weeks or months after exposure. The extremely low-infective dose of C. burnetii and its relative stability attribute to the listing of this organism as a category B biological weapon by the Center for Disease Control and Prevention, Atlanta, GA, USA (http://www.bt.cdc.gov) (Lederberg, 2000).

Identification of C. burnetii isolates by genotyping is a prerequisite for surveillance purposes and for epidemiological investigation in cases of natural outbreak or in deliberate release events. However, knowledge of the genetic heterogeneity in C. burnetii isolates is limited. The ribosomal RNA genes are conserved among isolates (Stein & Raoult, 1993). Pulsed field gel electrophoresis and a whole genome genotyping approach have classified the C. burnetii isolates into several groups (Heinzen , 1990; Jager , 1998). Moreover, the isolates have been differentiated into six genomic groups on the basis of DNA restriction fingerprints (Hendrix , 1991). A limited heterogeneity was also detected in a few genes that were investigated (Zhang , 1997; Nguyen & Hirai, 1999; Sekeyova , 1999). However, it is difficult to compare information obtained by these various methods. Based on the published data and the fact that the C. burnetii genome has recently been sequenced (Seshadri , 2003), a multiple locus variable number tandem repeats (VNTR) analysis (MLVA) genotyping approach seems to be feasible for this bacterium.

In this report, we describe an MLVA system that uses seven marker loci to discriminate C. burnetii isolates.

Materials and methods

Samples

In this study, the MLVA genotyping scheme has been developed using 16 isolates and five passage history/laboratory variants of the Coxiella burnetii isolates Nine Mile (NM), Priscilla and S (Table 1). Materials were obtained as killed bacterial lysates (isolates from Bratislava) or DNA (isolates from Marseille and Rijswijk).

1

Isolates/variants of Coxiella burnetii

 Isolation   
Isolate/variant Country Year Source of isolation Obtained from 
NM-I RSA 493, EP3 Montana, USA 1937 Dermacentor andersoni (tick) Bratislava, Slovakia 
NM-I RSA 493 Montana, USA 1937 Dermacentor andersoni (tick) Rijswijk, the Netherlands 
Unknown origin    Rijswijk, the Netherlands 
NM-II RSA 439, EP165 Montana, USA 1937 Dermacentor andersoni (tick) Bratislava, Slovakia 
NM-II RSA 111   Dermacentor andersoni (tick) Marseille, France 
1/IIA, EP3 Slovakia 1968 Dermacentor marginatus (tick) Bratislava, Slovakia 
DER, EP3 Slovakia 1967 Dermacentor marginatus (tick) Bratislava, Slovakia 
L, EP3 Slovakia 1968 Dermacentor marginatus (tick) Bratislava, Slovakia 
27, EP5 Slovakia 1968 Dermacentor marginatus (tick) Bratislava, Slovakia 
RAK8, EP5 Tirol, Austria 1990 Ixodes ricinus (tick) Bratislava, Slovakia 
IXO, EP3 Slovakia 1957 Ixodes ricinus (tick) Bratislava, Slovakia 
48, EP3 Slovakia 1967 Haemaphysalis punctata (tick) Bratislava, Slovakia 
Henzerling, EP3 Italy 1945 Human blood, acute Q fever Bratislava, Slovakia 
L35, EP3 Slovakia 1954 Human blood, acute Q fever Bratislava, Slovakia 
Florian, EP5 Slovakia 1956 Human blood, acute Q fever Bratislava, Slovakia 
S Q217 Montana, USA 1981 Human heart valve, endocarditis, chronic Q fever Rijswijk, the Netherlands 
S, EP3 Montana, USA 1981 Human heart valve, endocarditis, chronic Q fever Bratislava, Slovakia 
Priscilla Q117 Montana, USA 1980 Goat placenta, abortion Rijswijk, the Netherlands 
Priscilla, EP3 Montana, USA 1980 Goat placenta, abortion Bratislava, Slovakia 
LUGA, EP3 Russia 1958 Apodemus flavicollis (mouse, spleen) Bratislava, Slovakia 
Dugway 5J108-111 Utah, USA 1958 Rodent Rijswijk, the Netherlands 
 Isolation   
Isolate/variant Country Year Source of isolation Obtained from 
NM-I RSA 493, EP3 Montana, USA 1937 Dermacentor andersoni (tick) Bratislava, Slovakia 
NM-I RSA 493 Montana, USA 1937 Dermacentor andersoni (tick) Rijswijk, the Netherlands 
Unknown origin    Rijswijk, the Netherlands 
NM-II RSA 439, EP165 Montana, USA 1937 Dermacentor andersoni (tick) Bratislava, Slovakia 
NM-II RSA 111   Dermacentor andersoni (tick) Marseille, France 
1/IIA, EP3 Slovakia 1968 Dermacentor marginatus (tick) Bratislava, Slovakia 
DER, EP3 Slovakia 1967 Dermacentor marginatus (tick) Bratislava, Slovakia 
L, EP3 Slovakia 1968 Dermacentor marginatus (tick) Bratislava, Slovakia 
27, EP5 Slovakia 1968 Dermacentor marginatus (tick) Bratislava, Slovakia 
RAK8, EP5 Tirol, Austria 1990 Ixodes ricinus (tick) Bratislava, Slovakia 
IXO, EP3 Slovakia 1957 Ixodes ricinus (tick) Bratislava, Slovakia 
48, EP3 Slovakia 1967 Haemaphysalis punctata (tick) Bratislava, Slovakia 
Henzerling, EP3 Italy 1945 Human blood, acute Q fever Bratislava, Slovakia 
L35, EP3 Slovakia 1954 Human blood, acute Q fever Bratislava, Slovakia 
Florian, EP5 Slovakia 1956 Human blood, acute Q fever Bratislava, Slovakia 
S Q217 Montana, USA 1981 Human heart valve, endocarditis, chronic Q fever Rijswijk, the Netherlands 
S, EP3 Montana, USA 1981 Human heart valve, endocarditis, chronic Q fever Bratislava, Slovakia 
Priscilla Q117 Montana, USA 1980 Goat placenta, abortion Rijswijk, the Netherlands 
Priscilla, EP3 Montana, USA 1980 Goat placenta, abortion Bratislava, Slovakia 
LUGA, EP3 Russia 1958 Apodemus flavicollis (mouse, spleen) Bratislava, Slovakia 
Dugway 5J108-111 Utah, USA 1958 Rodent Rijswijk, the Netherlands 

All isolates are in phase I except the NM-II isolates that are in phase II.

*

Coxiella burnetii lysates have been provided by Prof. Rudolf Toman (Institute of Virology, Slovak Academy of Sciences, Bratislava, Slovakia).

Coxiella burnetii DNA was kindly provided by Dr Martien Broekhuijsen (TNO Prins Maurits Laboratory, Rijswijk, the Netherlands) with permission of Dr Judith Tyczka (Institute for Hygiene and Infectious Diseases of Animals, Giessen, Germany).

The origin of this C. burnetii isolate kindly provided by Dr Martien Broekhuijsen and labeled as NM-I RSA is unknown.

§

Coxiella burnetii DNA was kindly provided by Prof. Didier Raoult (Unité des Rickettsies, Marseille, France).

NM-I, Nine Mile phase I; NM-II, Nine Mile phase II; EP, egg passage.

Tandem repeat search and primer design

The complete genome sequence of C. burnetii RSA 493 is known (Seshadri , 2003) and available from Blast (http://www.ncbi.nlm.nih.gov/genomes/lproks.cgi). This sequence was used for a search of tandem repeats and development of the primer sets for MLVA of C. burnetii. The whole genome sequence of the bacterium was screened for the presence of tandem repeats using the Tandem Repeats Finder software (Benson, 1999). From the list of results obtained, a selection of eight different loci was made. The selection was based on the following criteria: (1) the number of the repeats should be greater than 4; (2) the repeat size should not exceed 30 base pair (bp) (this criterion was included so as to be able to analyze the sizes of the tandem repeats on agarose gels); (3) the conservation among the repeats should be more than 90%. The most suitable repeats were selected and the primers were developed flanking these repeats using the primer developing program Kodon (Kodon 2.0 software, Total Genome and sequence analysis, Applied Maths, Sint-Martens-Latem, Belgium).

Multiple locus variable number tandem repeats analysis

Each VNTR locus was amplified using a forward primer labeled at the 5′ site with 6-carboxyfluorescein and an unlabeled reverse primer (Table 2). The PCR reactions were optimized for annealing temperature using a gradient DNA Engine™ Gradient Cycler apparatus [MJ Research® (Waltham, MA), PTC-200, Peltier Thermal Cycler] and the conditions were selected on the basis of highest product yield on agarose gels. The optimized PCR reactions were performed with an Applied Biosystems 9700 PCR apparatus (Foster City, CA). The PCR reaction (final volume 20 μL) included 10 μL of HotStar Taq master mix (QIAGEN, Hilden, Germany), 1 μL of each primer (10 pmol μL−1), 6 μL of sterile water and 2 μL of DNA or lysate. The PCR program included 15 min of denaturation at 95°C, followed by 25 cycles of amplification consisting of denaturation at 95°C for 20 s, annealing for 30 s at a selected temperature (Tann, Table 2) and elongation at 72°C for 1 min. Amplification was completed by incubation for 30 min at 68°C to ensure a complete terminal transferase activity of the Taq DNA polymerase.

2

Primer sequences, coordinates, annealing temperature, repeat size in base pairs and the nucleotide sequence of the repeat

Primers Nucleotide sequence (5′–3′) Genome coordinate Tann (°C) Repeat length (bp) Nucleotide sequence of repeat (5′–3′) No. of repeats No. of variants 
#1 Cox 1F FAM-AGAAAAAAGCACAGACCTTGA 1471821 53 GAAAAG 2–10 
#1 Cox 1R TTCCTGATTTAAAAGGGTGACT 1471952 
#2 Cox 2F FAM-TTCTTTATTTCAGGCCGGAGT 838419 55 TGAAGA 2–4 
#2 Cox 2R CCGGTAACGCCGATTAGTAA 838581 
#3 Cox 3F FAM-GCAATCCAGTTGGAAAGAA 831215 52 AGAAAATAA 2–18 
#3 Cox 3R ATTGAAGTAATCCATCGATGATT 831367 
#4 Cox 4F FAM-ATGAAGAAAGGATGGAGGG 259502 53 21 GACAGAAGACGGAAGACGGAA 2–9 
#4 Cox 4R TGCAAGGATAGCCTGGA 259854 
#5 Cox 5F FAM-AATGGAGTTTGTTAGCAAAGAAA 839689 58 TAAGAA 3–7 
#5 Cox 5R AAAGACAAGCAAAACGATAAAAA 839841 
#6 Cox 6F FAM-GACAAAAATCAATAGCCCGT 197645 53 GAGGACA 3–8 
#6 Cox 6R GAGTTGTGTGGCTTCGC 197796 
#7 Cox 7F FAM-ACAGGCCGGTATTCTAACC 1418045 56 CAGAGGA 2–5 
#7 Cox 7R CCTCAGCACCCATTCAG 1418197 
Primers Nucleotide sequence (5′–3′) Genome coordinate Tann (°C) Repeat length (bp) Nucleotide sequence of repeat (5′–3′) No. of repeats No. of variants 
#1 Cox 1F FAM-AGAAAAAAGCACAGACCTTGA 1471821 53 GAAAAG 2–10 
#1 Cox 1R TTCCTGATTTAAAAGGGTGACT 1471952 
#2 Cox 2F FAM-TTCTTTATTTCAGGCCGGAGT 838419 55 TGAAGA 2–4 
#2 Cox 2R CCGGTAACGCCGATTAGTAA 838581 
#3 Cox 3F FAM-GCAATCCAGTTGGAAAGAA 831215 52 AGAAAATAA 2–18 
#3 Cox 3R ATTGAAGTAATCCATCGATGATT 831367 
#4 Cox 4F FAM-ATGAAGAAAGGATGGAGGG 259502 53 21 GACAGAAGACGGAAGACGGAA 2–9 
#4 Cox 4R TGCAAGGATAGCCTGGA 259854 
#5 Cox 5F FAM-AATGGAGTTTGTTAGCAAAGAAA 839689 58 TAAGAA 3–7 
#5 Cox 5R AAAGACAAGCAAAACGATAAAAA 839841 
#6 Cox 6F FAM-GACAAAAATCAATAGCCCGT 197645 53 GAGGACA 3–8 
#6 Cox 6R GAGTTGTGTGGCTTCGC 197796 
#7 Cox 7F FAM-ACAGGCCGGTATTCTAACC 1418045 56 CAGAGGA 2–5 
#7 Cox 7R CCTCAGCACCCATTCAG 1418197 

Tann, annealing temperature; bp, base pair.

The PCR products obtained were diluted 100 times, and 2 μL of this dilution were mixed with 10 μL of 200 times diluted MapMarker Rox 400 Low (Eurogentec, Sering, Belgium). The samples were denaturated for 5 min at 95°C and cooled on ice. The separation of PCR fragments was performed on an ABI 3700 DNA sequencer (Applied Biosystems, Foster City, CA) using the standard GeneScan module. The GeneScan data were inputted into the Bionumerics 4.0 software package (Applied Maths). Each isolate was assigned by an MLVA profile, defined by the number of repeats found at the different VNTR loci. Each unique MLVA profile was assigned an MLVA type. To confirm both the accuracy of sizing determined by capillary electrophoresis and the translation of the fragment sizes into repeat numbers, the VNTR PCR fragments of all isolates and their variants were sequenced.

Data analysis

Clustering of the MLVA profiles was performed with BioNummerics 4.0 software using the unweighted pair-group method with arithmetic mean (UPGMA) and the categorical coefficient of similarity or using a graphical method called the minimum spanning tree; the categorical coefficient was used in the latter also (Pourcel , 2004).

DNA sequencing

For DNA sequencing reactions, a fluorescence-labeled dideoxynucleotide technology from Applied Biosystems was used. Sequence reactions were analyzed on an ABI 3700 automated DNA sequencer. The sequences obtained were assembled and edited using Kodon 2.0 software.

Results

Identification of VNTR loci

Using the Tandem Repeat Finder software, eight sequences were selected that contained tandem repeats in the Coxiella burnetii genome. The length of the repeat varied from 6 to 21 bp. The primer sequences, named Cox 1–Cox 8, were designed and eight VNTR loci were tested on 21 C. burnetii samples. One of the eight loci was unsuitable for typing as no product was detected in any of the isolates or variants. The remaining seven VNTR primer sets were suitable for the MLVA typing and their characteristics are listed in Table 2. The human DNA did not yield a product using the seven VNTR PCRs.

The MLVA typing of 16 C. burnetii isolates and five passage history/laboratory variants using the seven selected VNTR markers revealed that the number of repeats varied between two and 18 repeats per VNTR locus and that the number of variant alleles per locus varied between three and six (Table 2). The nine unique marker allele size combinations (MLVA types) that were observed among the 21 C. burnetii samples were designated as A–I (Fig. 1). Sequencing of the VNTR PCR fragments showed a consequent difference of a single repeat unit that was found in excess with respect to the data found with GeneScan. In our work, the repeat number found with GeneScan was used and an inaccurate sizing was probably the result of the secondary structure in the PCR product.

1

Multiple locus variable number tandem repeats analysis clustering of the Coxiella burnetii isolates and their variants by the unweighted pair-group method with arithmetic mean categorical coefficient. For abbreviations, see Tables 1 and 2 or text.

1

Multiple locus variable number tandem repeats analysis clustering of the Coxiella burnetii isolates and their variants by the unweighted pair-group method with arithmetic mean categorical coefficient. For abbreviations, see Tables 1 and 2 or text.

Stability of the MLVA profiles

The stability of the chosen genetic markers was determined by analyzing the samples of NM isolate with different histories. Four NM variants with different numbers of egg passages (EP) in virulent phase I (NM-I) and low-virulent phase II (NM-II), stored at different laboratories, were all identical (Fig. 1). Our finding that RAK8 isolated in a different continent (Table 1) has the identical MLVA type as the NM isolate indicates that the same genotype is found or spread over the continents. In the latter case, this process might last for many years and thus it can be presumed that the RAK8 genotype is stable. Moreover, both NM and RAK8 isolates were isolated from ticks, and the finding of the same MLVA type could indicate migrations of infected ticks. The stability of the markers was further confirmed by the identical MLVA types for two S (MLVA type G) and two Priscilla (MLVA type F) isolates/variants that were stored at different laboratories (Fig. 1). Thus, all the data indicate stability of the genetic markers.

Genotyping of MLVA profiles

The UPGMA cluster analysis of the MLVA data revealed the existence of five major clusters (clusters I–V, Fig. 1). Cluster I consists of four NM variants, irrespective of their phase state, together with the RAK8 isolate. These were labeled MLVA type E (Fig. 1). Cluster II with MLVA type I consists of the Dugway isolate only. This isolate has one similarity with cluster I on the Cox 3 locus and one with cluster IV on the Cox 7 locus. Clusters III an IV consist of two S, MLVA type G, and two Priscilla, MLVA type F, respectively. Cluster V is more complex and harbors five different MLVA types (A, B, C, D and H). It mainly consists of acute Q fever- and tick-derived isolates. Based on MLVA typing, these isolates are closely related and differ one from another at most in two loci only.

Results of the UPGMA clustering of the MLVA data showed the genetic relationships among the MLVA profiles and grouping of the C. burnetii isolates and their variants into the different clusters. Clustering of the MLVA data using the minimal spanning tree graphing method gave a simpler representation of the genetic relations of the C. burnetii isolates in cluster V (Fig. 2). The lines represent relations among the MLVA types in the minimal spanning tree. The short solid lines represent a relation of six identical loci of the seven and the longer solid line of five identical loci of the seven. The dotted lines represent a very loose relationship (two or one of seven loci are identical). MLVA type A consists of four isolates, 1/IIA, Florian, Henzerling and L, and is central in the gene cluster. It is most likely a candidate for the origin of other types surrounding it. MLVA type B consists of the isolates DER, IXO and LUGA and has only one difference when compared with MLVA type A. This difference is at the Cox 3 locus where MLVA type B has 18 instead of 13 repeats (Fig. 1). MLVA type C contains the isolate 48 and it differs only at the Cox 3 locus from MLVA type A. MLVA type D consists of the isolates 27 and L35 and these isolates differ in a single locus (Cox 7) from MLVA type A. MLVA type H contains an unknown isolate from Rijswijk with two differences at the Cox 3 and Cox 6 loci.

2

Multiple locus variable number tandem repeats analysis (MLVA) genotypes of the Coxiella burnetii isolates and their variants using the minimal spanning tree graphing method. The gray circles represent one or two isolates/variants while the black ones represent three or more isolates/variants. The characters refer to the MLVA type. For abbreviations, see text.

2

Multiple locus variable number tandem repeats analysis (MLVA) genotypes of the Coxiella burnetii isolates and their variants using the minimal spanning tree graphing method. The gray circles represent one or two isolates/variants while the black ones represent three or more isolates/variants. The characters refer to the MLVA type. For abbreviations, see text.

Discussion

This study shows that MLVA typing can be a reliable method for the characterization of Coxiella burnetii isolates and their passage history/laboratory variants. The VNTR markers used revealed many polymorphisms resulting in nine MLVA types in 21 C. burnetii samples. The markers are stable with time and independent of the phase state of the bacterium. It is assumed that this simple molecular tool will help unravel several interesting aspects of C. burnetii as for its molecular phylogeny and epidemiology when being applied to a larger number of isolates. The method is robust, simple, cheap, highly discriminatory, reproducible and portable. It can be used to create the isolate profiles that are easily electronically exchangeable. MLVA has been successfully used to type several different bacterial species and proven to be a good method with a high resolution (van Belkum , 1997; Keim , 1999; Coletta-Filho , 2001; Farlow , 2001, 2002; Klevytska , 2001; Liu , 2003; Pourcel , 2003).

Using seven VNTR loci, 21 C. burnetii isolates and variants were investigated for length polymorphisms. The variations in a number of repeats, a number of variants of the repeats and in a number of the different MLVA types per number of isolates found in this work were similar to other studies (Schouls , 2004; Top , 2004). This implies that the chosen MLVA system has a high discriminatory capacity and is suitable for the molecular genotyping of C. burnetii.

Stability of the MLVA profiles is a prerequisite for a reliable molecular typing system. There are several indications of the stability of markers chosen in this study. Thus, four NM variants being in the different phase state (NM-I and NM-II) and maintained at the different laboratories (Bratislava, Giessen and Marseille) had the identical MLVA profile (type E) indicating stability of the chosen genetic markers. Similarly, the isolates S and Priscilla stored at the different laboratories were identical. In addition, the fact that the isolate RAK8 had an MLVA type similar to that of the NM variants is indicative of the stability of genetic markers. Finally, MLVA type D contained two isolates, 27 and L35, which were not related by the host or the date of isolation. Our finding that the isolate originally obtained as NM-I RSA from Rijswijk clustered into a different cluster than the NM isolate and its variants was surprising. After questioning the provider, it became evident that the isolate was of unknown origin. Thus, this finding has also proved the potential of the molecular typing method presented here in terms of its stability and usefulness.

The UPGMA clustering and the minimal spanning tree graphing method revealed the genetic relationships among the tested isolates and their variants. Both methods gave identical results. Roughly, five major clusters were apparent. The separation among the clusters was arbitrarily set at four identical loci per MLVA type. Cluster I, where the NM variants and the RAK8 isolate are present, differs clearly from other clusters. This might indicate their genetic isolation from other isolates/variants of the MLVA types G and F, and the tick-derived isolates. The large difference between the genocluster I tick group and other isolates that are derived from ticks and acute Q fever cases is worthy of further study. Nevertheless, it should be kept in mind that the preponderance of the genocluster I isolates is due to four of five isolates in this group being NM-I or passage history variants.

Our study also shows that there is a difference between the isolates Priscilla and S and those of acute disease and tick-derived isolates. This finding correlates with other data (Hendrix , 1991; Nguyen & Hirai, 1999), where the difference among isolates from acute and chronic Q fever cases and tick-derived cases has been reported. Unfortunately, only two chronic Q fever-derived variants were available to our study, so we were unable to follow this topic in more detail. When the minimal spanning tree method was used, Priscilla and S were presented far from each other. However, both isolates were identical at two loci (Cox 1 and Cox 3) that are similar to their match with the MLVA types A and H, indicating that their location in the minimal spanning tree graph as for the related MLVA types is not ambiguous.

Cluster V consists of a genetically related group with the isolates from acute Q fever cases and ticks. This clustering has also been found by others (Hendrix , 1991; Nguyen & Hirai, 1999) where the isolates from acute Q fever cases, cattle and arthropods clustered together. The minimal spanning tree graph gives a suggestion for the mutual relationships among the isolates. It shows that MLVA type A is central to the MLVA group. This implies that MLVA type A could be an evolutionary origin for other types surrounding it. This is, however, only a suggestion as only 16 isolates and five passage history/laboratory variants were available for this study. In future, the noncultured isolates from the field should be investigated in order to avoid a possible selection during the cultivation process, an observation that has been published recently for C. burnetii (Andoh , 2004).

Most recently, Glazunova (2005) have published a genotyping method for C. burnetti where multispacer sequence typing (MST) was used. A comparison of the MLVA UPGMA cluster analysis with MST shows that the results obtained by both methods are similar. However, when the MLVA method was applied, the NM isolate together with the Dugway and RAK8 isolates was clearly distant from other isolates. This suggests that the MLVA typing method might have a better discriminating capacity than the MST method. Further, it appears that the MLVA method has additional advantages over MST, although both methods gave similar results. The MLVA typing is less laborious and sequencing is not necessary, making the MLVA typing method robust, simple and even more portable than the MST method. This allows an easy and rapid exchange of data without errors that might occur when strains or isolates are sequenced. Moreover, the method is intended for direct use with the field material without the necessity of prior cultivation as it includes the amplification step and sensitive detection on GeneScan.

A limited number of C. burnetii isolates and their variants were available to this study, and more isolates will have to be tested in future to prove the potential of the method presented. Likewise, more isolates from acute and chronic Q fever cases should be examined in order to evaluate the method as a reliable tool for differential diagnosis of C. burnetii infections in humans.

Acknowledgements

This work was supported in part by the Science and Technology Assistance Agency, Slovak Republic, under contract No. APVT-51-032804. The skillful technical assistance of Margita Benkovicova and Ludmila Hasikova is acknowledged.

References

Andoh
M
Nagaoka
H
Yamaguchi
T
Fukushi
H
Hirai
K
(
2004
)
Comparison of Japanese isolates of Coxiella burnetii by PCR-RFLP and sequence analysis
.
Microbiol Immunol
 
48
:
971
975
.
Baca
OG
Paretsky
D
(
1983
)
Q fever and Coxiella burnetii: a model for host–parasite interactions
.
Microbiol Rev
 
46
:
127
149
.
van Belkum
A
Scherer
S
van Leeuwen
W
Willemse
D
van Alphen
L
Verbrugh
H
(
1997
)
Variable number of tandem repeats in clinical strains of Haemophilus influenzae
.
Infect Immun
 
65
:
5017
5027
.
Benson
G
(
1999
)
Tandem repeats finder: a program to analyze DNA sequences
.
Nucleic Acids Res
 
27
:
573
580
.
Coletta-Filho
HD
Takita
MA
de Souza
AA
Aguilar-Vildoso
CI
Machado
MA
(
2001
)
Differentiation of strains of Xylella fastidiosa by a variable number of tandem repeat analysis
.
Appl Environ Microbiol
 
67
:
4091
4095
.
Farlow
J
Smith
KL
Wong
J
Abrams
M
Lytle
M
Keim
P
(
2001
)
Francisella tularensis strain typing using multiple-locus, variable-number tandem repeat analysis
.
J Clin Microbiol
 
39
:
3186
3192
.
Farlow
J
Postic
D
Smith
KL
Jay
Z
Baranton
G
Keim
P
(
2002
)
Strain typing of Borrelia burgdorferi, Borrelia afzelii, and Borrelia garinii by using multiple-locus variable-number tandem repeat analysis
.
J Clin Microbiol
 
40
:
4612
4618
.
Glazunova
O
Roux
V
Freylikman
O
Sekeyova
Z
Fournous
G
Tyczka
J
Tokarevich
N
Kovacova
E
Marrie
TJ
Raoult
D
(
2005
)
Coxiella burnetii genotyping
.
Emerg Infect Dis
 
11
:
1211
1217
.
Heinzen
R
Stieger
GL
Whiting
LL
Schmitt
SA
Malavia
LP
Frazer
ME
(
1990
)
Use of pulsed field gel electrophoresis to differentiate Coxiella burnetii strains
.
Ann N Y Acad Sci
 
590
:
504
513
.
Hendrix
LR
Samuel
JE
Mallavia
LP
(
1991
)
Differentiation of Coxiella burnetii isolates by analysis of restriction-endonuclease-digested DNA separated by SDS-PAGE
.
J Gen Microbiol
 
137
:
269
276
.
Hilbink
F
Penrose
M
Kovácová
E
Kazár
J
(
1993
)
Q fever is absent from New Zealand
.
Int J Epidemiol
 
22
:
945
949
.
Jager
C
Willems
H
Thiele
D
Baljer
G
(
1998
)
Molecular characterization of Coxiella burnetii isolates
.
Epidemiol Infect
 
120
:
157
164
.
Keim
P
Klevytska
AM
Price
LB
Schupp
M
Zinser
G
Smith
KL
Hugh-Jones
ME
Okinaka
R
Hill
KK
Jackson
PJ
(
1999
)
Molecular diversity in Bacillus anthracis
.
J Appl Microbiol
 
87
:
215
217
.
Klevytska
AM
Price
LB
Schupp
JM
Worsham
PL
Wong
J
Keim
P
(
2001
)
Identification and characterization of variable-number tandem repeats in the Yersinia pestis genome
.
J Clin Microbiol
 
39
:
3179
3185
.
Lederberg
J
(
2000
)
Biological warfare and bioterrorism
.
Principles and Practice of Infectious Diseases
  (
Mandell
GL
Bennet
JE
Dolin
R
, eds), pp.
3235
3238
.
Churchill Livingstone
,
Philadelphia, PE
.
Liu
Y
Lee
MA
Ooi
EE
Mavis
Y
Tan
AL
Quek
HH
(
2003
)
Molecular typing of Salmonella enterica serovar typhi isolates from various countries in Asia by a multiplex PCR assay on variable-number tandem repeats
.
J Clin Microbiol
 
41
:
4388
4394
.
Madariaga
MG
Rezai
K
Trenholme
GM
Weinstein
RA
(
2003
)
Q fever: a biological weapon in your backyard
.
Lancet Infect Dis
 
3
:
709
721
.
Nguyen
SA
Hirai
K
(
1999
)
Differentiation of Coxiella burnetii isolates by sequence determination and PCR-restriction fragment length polymorphism analysis of isocitrate dehydrogenase gene
.
FEMS Microbiol Lett
 
180
:
249
254
.
Pourcel
C
Vidgo
Y
Ramisse
F
Vergnaud
G
Tram
C
(
2003
)
Characterization of a tandem repeat polymorphism in Legionella pneumophila and its use for genotyping
.
J Clin Microbiol
 
41
:
1819
1826
.
Pourcel
C
André-Mazeaud
F
Neubauer
H
Ramisse
F
Vergnaud
G
(
2004
)
Tandem repeats analysis for the high resolution phylogenic analysis of Yersinia pestis
.
BMC Microbiol
 
4
:
22
.
Sawyer
LA
Fishbein
DB
McDade
JE
(
1987
)
Q fever: current concepts
.
Rev Infect Dis
 
9
:
935
946
.
Schouls
LM
van der Heide
HG
Vauterin
L
Vauterin
P
Mooi
FR
(
2004
)
Multiple-locus variable-number tandem repeat analysis of Dutch Bordetella pertussis strains reveals rapid genetic changes with clonal expansion during the late 1990s
.
J Bacteriol
 
186
:
5496
5505
.
Sekeyova
Z
Roux
V
Raoult
D
(
1999
)
Intraspecies diversity of Coxiella burnetii as revealed by com1 and mucZ sequence comparison
.
FEMS Microbiol Lett
 
180
:
61
67
.
Seshadri
R
Paulsen
IT
Eisen
JA
, et al. (
2003
)
Complete genome sequence of the Q-fever pathogen Coxiella burnetii
.
Proc Natl Acad Sci USA
 
100
:
5455
5460
.
Stein
A
Raoult
D
(
1993
)
Lack of pathotype specific gene in human Coxiella burnetii isolates
.
Microb Pathog
 
15
:
177
185
.
Stein
A
Raoult
D
(
1995
)
Q fever endocarditis
.
Eur Heart J
 
16
:
(Suppl B)
:
19
23
.
Top
J
Schouls
LM
Bonten
MJM
Willems
RJL
(
2004
)
Multiple-locus, variable-number tandem repeat analysis, a novel typing scheme to study the genetic relatedness and epidemiology of Enterococcus faecium isolates
.
J Clin Microbiol
 
42
:
4503
4511
.
Zhang
GQ
To
H
Yamaguchi
T
Fukushi
H
Hirai
K
(
1997
)
Differentiation of Coxiella burnetii by sequence analysis of the gene (com1) encoding a 27-kDa outer membrane protein
.
Microbiol Immunol
 
41
:
871
877
.