Abstract

We analyzed 28 epidemic Vibrio cholerae O1 strains isolated in the region of Thua Thien Hue (Vietnam) in 2003. Ubiquitous amoxicillin, prevalent aminoglycosides and sporadic erythromycin resistances were observed. All were devoid of plasmids, class 1 integrons and ICEs and showed the same BglI ribotype, irrespective of their site of isolation and resistance pattern. A strain isolated in 1990 in the same area was resistant to amoxicillin and aminoglycosides but characterized by a different ribotype. This strain contained ICEVchVie0, belonging to the SXT/R391 ICE family, devoid of any resistance cluster. The molecular analysis of three conserved and six variable regions outlined an original genetic profile. ICEs not coding for resistance to drugs seem to be more frequent than supposed, and this finding reinforces the idea that the SXT/R391 family of genetic elements is wide and composite. The clearance of ICEVchVie0 in the 2003 epidemic may be explained by the lack of any resistance determinant as a favorable selective marker.

Introduction

Outbreaks of cholera caused by multiresistant Vibrio cholerae strains have been reported in many developing countries (Coppo et al., 1995; Colombo et al., 1997; Ceccarelli et al., 2006) and are a major public health problem. The antibiotic therapeutic and prophylactic treatments of cholera have probably contributed to the appearance of drug-resistant strains in different geographic areas. This feature has often stabilized in endemic and epidemic strains. Cholera has been an important cause of diarrhea in Vietnam since 1850. Vibrio cholerae O1 biotype El Tor came to South Vietnam in 1964 from Indonesia and was detected mainly in the central coastal areas and in South Vietnam. Besides the specific natural and socio economic factors, the long lasting war contributed to the epidemic explosion of the disease (Dalsgaard et al., 1997, 1999). In recent years, prevention by vaccine campaigns (Vu et al., 2003) and environmental control as well as case treatment resulted in a significant control of cholera epidemics in Vietnam and a relative low drug resistance profile in V. cholerae, compared with other epidemics in other developing countries (Dalsgaard et al., 2001; Thungapathra et al., 2002).

In the first half of the 1990s new multiple resistant strains of V. cholerae O1 emerged: these strains were characterized by streptomycin and spectinomycin resistances located on class 1 integrons (Dalsgaard et al., 1999). Aminoglycoside resistant integrons have also been found in Shigella spp. strains isolated from patients with diarrhea in Vietnam (Iversen et al., 2003). The worldwide occurrence of class 1 integrons in many enteric bacteria, including V. cholerae, and their role in acquisition and diffusion of drug resistance, is well documented (Dalsgaard et al., 1999, 2000, 2001; Thungapathra et al., 2002).

Strains isolated in 2000 in Vietnam were, however, devoid of class 1 integrons but harbored the SXT element with several drug-resistant genes (Ehara et al., 2004).

SXT is an ICE (integrative-conjugative element) 99.5 kb in size, which contributes to horizontal transmission and rearrangement of drug resistance genes in V. cholerae. It was in fact called SXT, due to its ability to confer resistance to sulfamethoxazole and trimethoprim (Hochhut et al., 2000). This discovery profoundly changed the understanding of resistance circulation in V. cholerae epidemics. SXT was originally found in the chromosome of V. cholerae O139 in India, and shares a large conserved scaffold with the R391 integrating mobile element, previously discovered in Providencia rettgeri (Beaber et al., 2002; McGrath et al., 2006). Also, three Hotspots have been identified in the tra regions of this common scaffold as a target of different insertions; their molecular analysis is able to discriminate between SXT and R391 (Beaber et al., 2002).

The two ICEs and their relatives, containing highly related integrases, catalyze insertion of the element into the prfC gene of the host; these elements are now grouped in the SXT/R391 family (Burrus et al., 2006a).

Resistance genes to chloramphenicol (floR), streptomycin (strA and strB), sulfamethoxazole (sul2), trimethoprim (dfrA18 and dfrA1) and tetracycline (tetA and tetR) are found in different SXTs with different arrangements. In SXTMO10, found in V. cholerae O139, resistance genes are embedded in a transposon-like element that interrupts the SXT-encoded rumAB operon. In contrast, SXTET (ICEVchInd1), contained by V. cholerae O1, is closely related but not identical to SXTMO10; it shows a shorter resistance cluster in rumAB operon, lacking dfrA18 (Hochhut et al., 2001) but contains the dfrA1 resistance gene located close to the traF transfer gene. Recently, a new SXT/R391-like element isolated in Laos has been described. ICEVchLao1 (Iwanaga et al., 2004) is characterized by the tetA resistance gene and the absence of resistance to trimethoprim genes in the resistance cluster. A derivative of this element was isolated in Vietnam, characterized by minor differences including the presence of tetR gene (Ehara et al., 2004).

As mobile genetic elements play a crucial role in the genomic plasticity and fitness of V. cholerae, we investigated their presence in clinical V. cholerae O1 strains isolated in Vietnam to better understand the dynamic of their dissemination and eventually their correlation with resistance to drugs.

Materials and methods

Bacterial strains and resistance to drugs

In this investigation, we analyzed 28 strains of V. cholerae O1 isolated in the Vietnamese central-eastern region of Thua Thien Hue. Sixteen strains have been isolated in the Hue district, five from the Phu Vang district, four from the Huong Tra district and one, respectively, from the other districts as indicated in Table 1. All the strains were isolated in 2003. An additional strain, V. cholerae O1 90, isolated in 1990 in the Hue city, was also included in this study.

1

Vibrio cholerae O1 isolates under study, date of isolation, geographic provenience and resistance pattern

Isolate Date Town and district Resistance profile 
V. cholerae O1 90 1990 Hue, Hue SPT, STR 
V. cholerae O1 1 13/05/03 Phu vang, Phu vang SPT, STR 
V. cholerae O1 2 13/05/03 Phu vang, Phu vang SPT 
V. cholerae O1 3 24/05/03 Hue, Hue SPT, STR 
V. cholerae O1 4 02/06/03 Loc bon, Phu loc STR 
V. cholerae O1 6 05/06/03 La khe, Huong tra SPT, STR, TMP 
V. cholerae O1 8 07/06/03 Hue, Hue ERY, SPT, STR, SUL 
V. cholerae O1 9 07/06/03 Thuy an, Hue SPT, TMP 
V. cholerae O1 10 12/06/03 Hue, Hue SPT 
V. cholerae O1 11 15/06/03 Huong phong, Huong tra SPT, SUL 
V. cholerae O1 12 15/06/03 Hue, Hue ERY, SPT, SUL 
V. cholerae O1 13 16/06/03 Thuy bang, Huong thuy SPT 
V. cholerae O1 14 15/06/03 Hue, Hue SPT, STR 
V. cholerae O1 15 16/06/03 Xuan phu, Hue SPT, STR 
V. cholerae O1 16 17/06/03 Phong hai, Phong dien ERY, SPT, TMP 
V. cholerae O1 17 20/06/03 Thuy an, Hue SPT, STR 
V. cholerae O1 18 20/06/03 Thuan an, Phu vang ERY, SPT 
V. cholerae O1 19 21/06/03 Thuan an, Phu vang ERY, SPT, STR 
V. cholerae O1 20 21/06/03 Thuan an, Phu vang SPT, STR, SUL 
V. cholerae O1 21 24/06/03 Hue, Hue SPT, STR 
V. cholerae O1 22 26/06/03 Hue, Hue ERY, SPT 
V. cholerae O1 23 27/06/03 Hue, Hue ERY, STR 
V. cholerae O1 25 30/06/03 Huong vinh, Huong tra SPT 
V. cholerae O1 26 11/07/03 Hue, Hue SPT, STR 
V. cholerae O1 27 17/06/03 Huong Long, Hue ERY, SPT, STR 
V. cholerae O1 28 17/06/03 Hue, Hue ERY, SPT, STR 
V. cholerae O1 29 19/06/03 Hue, Hue ERY, SPT, STR 
V. cholerae O1 30 22/06/03 Huong an, Huong tra ERY, SPT, STR 
V. cholerae O1 31 11/07/03 Huong Long, Hue ERY, SPT, STR 
Isolate Date Town and district Resistance profile 
V. cholerae O1 90 1990 Hue, Hue SPT, STR 
V. cholerae O1 1 13/05/03 Phu vang, Phu vang SPT, STR 
V. cholerae O1 2 13/05/03 Phu vang, Phu vang SPT 
V. cholerae O1 3 24/05/03 Hue, Hue SPT, STR 
V. cholerae O1 4 02/06/03 Loc bon, Phu loc STR 
V. cholerae O1 6 05/06/03 La khe, Huong tra SPT, STR, TMP 
V. cholerae O1 8 07/06/03 Hue, Hue ERY, SPT, STR, SUL 
V. cholerae O1 9 07/06/03 Thuy an, Hue SPT, TMP 
V. cholerae O1 10 12/06/03 Hue, Hue SPT 
V. cholerae O1 11 15/06/03 Huong phong, Huong tra SPT, SUL 
V. cholerae O1 12 15/06/03 Hue, Hue ERY, SPT, SUL 
V. cholerae O1 13 16/06/03 Thuy bang, Huong thuy SPT 
V. cholerae O1 14 15/06/03 Hue, Hue SPT, STR 
V. cholerae O1 15 16/06/03 Xuan phu, Hue SPT, STR 
V. cholerae O1 16 17/06/03 Phong hai, Phong dien ERY, SPT, TMP 
V. cholerae O1 17 20/06/03 Thuy an, Hue SPT, STR 
V. cholerae O1 18 20/06/03 Thuan an, Phu vang ERY, SPT 
V. cholerae O1 19 21/06/03 Thuan an, Phu vang ERY, SPT, STR 
V. cholerae O1 20 21/06/03 Thuan an, Phu vang SPT, STR, SUL 
V. cholerae O1 21 24/06/03 Hue, Hue SPT, STR 
V. cholerae O1 22 26/06/03 Hue, Hue ERY, SPT 
V. cholerae O1 23 27/06/03 Hue, Hue ERY, STR 
V. cholerae O1 25 30/06/03 Huong vinh, Huong tra SPT 
V. cholerae O1 26 11/07/03 Hue, Hue SPT, STR 
V. cholerae O1 27 17/06/03 Huong Long, Hue ERY, SPT, STR 
V. cholerae O1 28 17/06/03 Hue, Hue ERY, SPT, STR 
V. cholerae O1 29 19/06/03 Hue, Hue ERY, SPT, STR 
V. cholerae O1 30 22/06/03 Huong an, Huong tra ERY, SPT, STR 
V. cholerae O1 31 11/07/03 Huong Long, Hue ERY, SPT, STR 

ERY, erythromycin; SPT, spectinomycin; STR, streptomycin; SUL, sulphametoxazole; TMP, trimethoprim. All the strains are resistant to amoxicillin.

The strains were preliminarily examined for drug resistance by Kirby Bauer diffusion disks (Oxoid) in solid media (Woods & Washington, 1995) and were processed for determination of minimum inhibitory concentration (MIC, by the breakpoint method) by automatic testing, using the BIO-MERIEUX VITEK junior in liquid phase using the V4605 card (Sciortino et al., 1996). The susceptibility to the following drugs was determined: amikacin, amoxicillin, ampicillin, aztreonam, cefotaxime, ceftazidime, ceftriaxone, cephalothin, ciprofloxacin, chloramphenicol, erythromycin, gentamicin, imipenem, kanamycin, nalidixic acid, netilmicin, piperacillin, rifampicin, spectinomycin, streptomycin, ticarcillin, tobramycin, tetracycline and trimethoprim/sulfamethoxazole.

Vibrio cholerae O1 N16961 (kindly provided by D. Mazel, Ins. Pasteur, Paris, France), V. cholerae 582 (Ceccarelli et al., 2006), V. cholerae O139 MO10 (kindly provided by M.K. Waldor, Tufts University School of Medicine, Boston), and Escherichia coli AB1157:R391 (kindly provided by J.T. Pembroke, University of Limerick, Limerick, Ireland) were appropriately used as negative and positive controls in PCR experiments for class 1 integron and SXT detection.

Molecular biology procedures

Ribotyping analysis was obtained by Southern blot hybridization of BglI-digested bacterial DNA probed by 16S and 23S ribosomal fluorescent DNA (Gene Images 3540 RPn3510, by Amersham), generated by reverse transcriptase polymerase chain reaction of ribosomal RNAs (Dalsgaard et al., 1999).

Plasmid presence in the isolates was analyzed by conjugation experiments, following drug resistance transfer, and by physically extracting plasmid DNA, as previously described (Coppo et al., 1995; Colombo et al., 1997; Ceccarelli et al., 2006).

PCR amplification with specific primer pairs, previously described, were used for the detection of class 1 integrons (in-F/in-B primer pair, which amplifies the region between 5′-CS and 3′-CS containing variable resistance cassettes and inDS-F/inDS-B primer pair, which amplifies class 1 integrase gene) and identification and characterization of SXT ICE: int (integrase gene), floR, strA, strB, sul2, dfrA18, dfrA1, tetA (SXT correlated resistance genes), rumAB operon and prfC/SXT right junction of the chromosomal integration region (P3/P1 primer pair) (Levesque et al., 1995; Hochhut & Waldor, 1999; Dalsgaard et al., 2001; Hochhut et al., 2001; Iwanaga et al., 2004). We also designed original primer pairs for PCR detection of the internal sequence of the SXT int gene. PCR analysis was performed on the common scaffold shared by SXT and R391, using primer pairs kindly provided by V. Burrus (Tufts University School of Medicine, Boston) able to amplify three conserved regions: traI (CR1), traC (CR2) and setR (CR3). In order to discriminate between the two ICEs, we designed original primer pairs to detect five variable regions, specific for SXT or R391 (Beaber et al., 2002; Burrus et al., 2006b): s026/s027 and R391 kan cluster (VR1), s045/traL/CDS38 (Hotspot 1), traA/traC (Hotspot 2), s075/traF/CDS78 (Hotspot 3) and traG/s079/mer operon (VR2). See Fig. 2(a) for region locations and Table 2 for primer details. The cycling conditions were as follows: initial denaturation at 94°C for 1 min was followed by 30 cycles of amplification with 98°C for 30 s, annealing at 55 or 62°C (according to primer pair melting temperature) for 30 s, extension at 72°C for 30 s, with a last cycle of 72°C for 10 min; traA/traC amplification required the use of La Taq™ polymerase, as described below.

2

(a) Schematic linear map (not to scale) of the SXT/R391 common scaffold. The genes reported in the boxes are specific insertions of either SXT or R391 into VR (variable regions), HS (Hotspots) and CR (conserved regions), investigated by PCR amplification. (b) Gene sequence of 3.8 Kb rumAB region (approximately to scale) belonging to ICEVchVie0.

2

(a) Schematic linear map (not to scale) of the SXT/R391 common scaffold. The genes reported in the boxes are specific insertions of either SXT or R391 into VR (variable regions), HS (Hotspots) and CR (conserved regions), investigated by PCR amplification. (b) Gene sequence of 3.8 Kb rumAB region (approximately to scale) belonging to ICEVchVie0.

2

Primers used in this study to amplify conserved and variable regions belonging to SXT and/or R391

Primer Sequence (5′ to 3′) Target gene or region Amplicon size (bp) Reference or accession number and chromosomal location 
RIGHTA GCACTTGCCTTCATCAAAGC rumAB Variable AB114188, bp 23369-23350 
LEFTF3 GGTGCCATCTCCTCCAAAGTGC   Hochhut et al. (2000) 
orf171 GCAAGTCCTGATCCGCTATC traI 697 V. Burrus 
traI-R CCAGGGCATCTCATATGCGT   V. Burrus 
traC-F TTGACGCTGTTTTCACCAACG traC 657 V. Burrus 
traC-B GGCACGACCTTTTTTCTCCC   V. Burrus 
setRpF ACGGCGGAGATGTTTTTGT setR 888 V. Burrus 
setRpR GTGCGCCAATGCTCAGTT   V. Burrus 
aphF GGCAATCAGGTGCGACAAT kan (R391) 484 AY090559, bp 12978-12997 
aphR GTGACGACTGAATCCGGTGA   AY090559, bp 13461-13441 
s026-F AAGCAATGGAACCGAATCGTT s026-s027 (SXT) 4410 AY055428, bp 26896-26914 
s027-R ACCATGCATCAGCGGTTAAAG kan cluster (R391) 653 AY055428, bp 27549-27528 
s045-F TCAAATAACCCATCGCCCAT s045-traL (SXT) 599 AY055428, bp 50852-50872 
traL-R TGGGTTAGGGATCGTCTTGG   AY055428, bp 51430-51450 
cds38-F GCTAAAGTGGGCAGCTGGTC cds38-traL (R391) 444 AY090559, bp 38266-38286 
traA-F GGTGGCGGTATGGGTCTCTA traA-traC (SXT) 4560 AY055428, bp 55163-55183 
 traA-traC (R391) 9510  
s075-F TCGCTTTGCTTGGGTTTGTT s075-traF (SXT) 988 AY055428, bp 87904-87924 
traF-R CCACGCTGATAGAATTGCCC   AY055428, bp 88892-88872 
cds78-F TGAAGGCAATCCGGATAACAG cds78-traF (R391) 946 AY090559, bp 73534-73555 
traG-F GGGACGCGTATTCAACTCTGA traG-s079 (SXT) 601 AY055428, bp 94436-94457 
s079-R CAAGTTAGCGGCTCTGCCAT   AY055428, bp 95036-95016 
merA-F AGCTTTTCCCTTACCTGACTATGGT mer operon (R391) 515 AY090559, bp 83571-83596 
Primer Sequence (5′ to 3′) Target gene or region Amplicon size (bp) Reference or accession number and chromosomal location 
RIGHTA GCACTTGCCTTCATCAAAGC rumAB Variable AB114188, bp 23369-23350 
LEFTF3 GGTGCCATCTCCTCCAAAGTGC   Hochhut et al. (2000) 
orf171 GCAAGTCCTGATCCGCTATC traI 697 V. Burrus 
traI-R CCAGGGCATCTCATATGCGT   V. Burrus 
traC-F TTGACGCTGTTTTCACCAACG traC 657 V. Burrus 
traC-B GGCACGACCTTTTTTCTCCC   V. Burrus 
setRpF ACGGCGGAGATGTTTTTGT setR 888 V. Burrus 
setRpR GTGCGCCAATGCTCAGTT   V. Burrus 
aphF GGCAATCAGGTGCGACAAT kan (R391) 484 AY090559, bp 12978-12997 
aphR GTGACGACTGAATCCGGTGA   AY090559, bp 13461-13441 
s026-F AAGCAATGGAACCGAATCGTT s026-s027 (SXT) 4410 AY055428, bp 26896-26914 
s027-R ACCATGCATCAGCGGTTAAAG kan cluster (R391) 653 AY055428, bp 27549-27528 
s045-F TCAAATAACCCATCGCCCAT s045-traL (SXT) 599 AY055428, bp 50852-50872 
traL-R TGGGTTAGGGATCGTCTTGG   AY055428, bp 51430-51450 
cds38-F GCTAAAGTGGGCAGCTGGTC cds38-traL (R391) 444 AY090559, bp 38266-38286 
traA-F GGTGGCGGTATGGGTCTCTA traA-traC (SXT) 4560 AY055428, bp 55163-55183 
 traA-traC (R391) 9510  
s075-F TCGCTTTGCTTGGGTTTGTT s075-traF (SXT) 988 AY055428, bp 87904-87924 
traF-R CCACGCTGATAGAATTGCCC   AY055428, bp 88892-88872 
cds78-F TGAAGGCAATCCGGATAACAG cds78-traF (R391) 946 AY090559, bp 73534-73555 
traG-F GGGACGCGTATTCAACTCTGA traG-s079 (SXT) 601 AY055428, bp 94436-94457 
s079-R CAAGTTAGCGGCTCTGCCAT   AY055428, bp 95036-95016 
merA-F AGCTTTTCCCTTACCTGACTATGGT mer operon (R391) 515 AY090559, bp 83571-83596 

Able to amplify two different regions as indicated in column 3.

To be paired either with s045-F or cds38-F.

To be paired with traC-B.

To be paired either with s075-F or cds78-F.

To be paired either with traG-F or merA-F.

We utilized the LEFTF3 primer (Hochhut et al., 2000) homologous to rumB, paired with an internal specific rumA primer RIGHTA to amplify the region that includes the integration site of the SXT resistance cluster (Table 2). The SXT/R391 rumAB region spans between 0.7 and 19 kb, in accordance with the inserted resistance genes in different ICE polymorphisms (Hochhut et al., 2001; Böltner et al., 2002). To amplify this region, a specific Taq polymerase capable of amplifying long templates (>3000 bp) was utilized. PCR amplification of large fragments was set in 50 µL of reaction buffer containing 2.5 U of La Taq™ polymerase (able to amplify up to 25 kb) as directed by the manufacturer (TaKaRa Bio Inc.). The cycling conditions were as follows: initial denaturation at 94°C for 1 min was followed by 30 cycles of amplification with 98°C for 10 s, annealing at 55–65°C (according to primer pair melting temperature) for 1 min, extension at 68°C for 15 min, with a last cycle of 72°C for 10 min. All amplifications were carried out in a M.J. Research, Inc. DNA Thermal Cycler. Optimal conditions were set in Eppendorf Mastergradient Thermal Cycler.

Amplicons to be sequenced were either directly purified from the PCR reaction by the Nucleospin Extract kit (Macherey-Nagel, Oensingen, Switzerland) or extracted from agarose gels by the Rapid Gel Extraction System (Marligen BioSciences, Liamsville, MD).

Nucleotide sequences were determined by IDI-IRCCS (Nucleic Acid Facility, Rome, Italy) using the Sanger method via an ABI Prism 377-96 genetic analyzer. dnaman software was used to design DNA primers and to analyze DNA sequences against GenBank.

Results

Vibrio cholerae O1 drug resistance and ribotype profiles

Combining the resistance testing methods applied, we found that all 28 V. cholerae O1 clinical strains isolated in 2003 were resistant to amoxicillin. Among these, five strains showed only one additional resistance (either to streptomycin or to spectinomycin) and 23 showed a multi-resistance profile (three or more resistances). Among the multiresistant strains, 16 were characterized both by streptomycin and spectinomycin resistances, and 12 by erythromycin (Table 1).

Vibrio cholerae O1 90, isolated in 1990, examined for comparison, showed resistance to amoxicillin, streptomycin and spectinomycin (Table 1). All the strains were susceptible to the other drugs tested.

All the isolates from the 2003 cholera epidemic, and isolate 90 (Table 1) were submitted to ribotyping analysis for tracking their epidemic relatedness. A common pattern of nine BglI restriction fragments was observed, except isolate 90, which showed the additional 6.4 kb fragment and lacked the 2.4 kb fragment. A comparison of the two different ribotypes is shown in Fig. 1.

1

Representative BglI ribotypes of Vibrio cholerae O1strains under study. Lanes: A, V. cholerae O1 18; B, V. cholerae O1 90; M, Lambda DNA digested with HindIII. Molecular weights are expressed in kb. On the left: 2.4 and 6.4 kb, respectively, the lacking and the additional restriction fragments (see arrows) to the V. cholerae O1 90 ribotype.

1

Representative BglI ribotypes of Vibrio cholerae O1strains under study. Lanes: A, V. cholerae O1 18; B, V. cholerae O1 90; M, Lambda DNA digested with HindIII. Molecular weights are expressed in kb. On the left: 2.4 and 6.4 kb, respectively, the lacking and the additional restriction fragments (see arrows) to the V. cholerae O1 90 ribotype.

Plasmid and integron detection

We investigated the presence of resistant, conjugative or cryptic plasmids in the isolates; however no evidence of their presence was found.

Also using repetitive PCR experiments, no class 1 integrons were identified, vs. the positive control. A ubiquitous 552 bp amplicon was detected that, after sequencing, resulted in a portion of the VC2452 gene, located on chromosome 1, coding for an RNA methyltransferase (GenBank accession no. AE004315). This was probably due to unspecific amplification.

ICE detection and characterization

Evidence for the presence of SXT/R391-like integrase was found by PCR amplification only in the strain isolated in 1990. We confirmed the amplicon identity by nested PCR with nintF and nintB-specific primers and by sequencing. The sequence showed 94% identity with SXTMO10 integrase (GenBank accession no. AY055428.1), 94% with conjugative transposon R997 integrase (GenBank accession no. AJ634266.1) and 93% with R391 integrase (GenBank accession no. AY090559.1).

To verify the real identity of the ICE in V. cholerae O1 90, suggested by the presence of the integrase gene, we analyzed the chromosomal integration site in the prfC gene (where SXT/R391-like elements integrate) and we obtained a positive amplification of the right junction of SXT/prfC.

SXT was reported to show a degree of polymorphism mainly affecting the resistance cluster; therefore we tested the presence of dfrA18, floR, strA, strB, sul2 and tetA located in the cluster inserted into the rumAB operon, characteristic of the SXTMO10 variant, and of dfrA1 generally located outside the gene cluster, specific for ICEVchInd1. Vibrio cholerae 90 was negative for all resistance genes. The same negative results were obtained from the other isolates, analyzed as control and no correlation between their phenotypic resistances and these resistance genes could be obtained. Examination of the rumAB arrangement in V. cholerae 90 ICE, where the resistance cluster usually inserts, revealed a 3.8 kb amplicon, suggesting the loss of the resistance cluster and its sequencing gave the following gene order, inserted into the rumB site: tnp, tnpA' and s021. The total sequence was released to GenBank with accession no. DQ499467. The detailed map of the insertion is described in Fig. 2(b).

Because of the differences observed in the resistance determinants and in spite of the int gene and attP site homologies, it was necessary to determine whether this element was in fact a true SXT or a related ICE (Burrus et al., 2006a). As already described (Beaber et al., 2002), SXT and R391 share a conserved genetic backbone and have insertions of additional DNA sequences that confer specific properties to the element. To ascertain whether the ICE we observed shared the conserved scaffold, we analyzed three different functional regions by PCR amplification [CS: traI, traC and setR, see Fig. 2(a)], obtaining a positive amplification for all of them. Subsequently, we looked for the insertions into five variable regions including three Hotspots, associated with SXT/R391-like elements (Burrus et al., 2002) [VRs and HSs; see Fig. 2(a)], able to discriminate between the two elements. A positive amplification was obtained for Hotspot 1 and 2, and VR2. The Hotspot 1 amplicon was sequenced and confirmed the integration of CDS37 and CDS38 genes, typical of the R391 element (GenBank accession no. AY090559.1). A large amplicon of 4560 bp with the traA-F/traC-B primer pairing in Hotspot 2, and an amplicon corresponding to the traG-s079 joining region of VR2 were obtained, both corresponding to SXT (GenBank accession no. AY055428.1). We obtained negative results for Hotspot 3 and VR1; these results may be due either to a poor local primer annealing or to a wider ICE's molecular rearrangement. Neither a dfrA1 gene insertion into Hotspot 3 (found in ICEVchInd1) nor a kanamycin resistance determinant or mer operon (usually found in R391) were detected. For details, see Fig. 2(a).

In accordance with the new nomenclature for SXT/R391 elements proposed by Burrus (Burrus et al., 2006a), we called this ICE ICEVchVie0 ‘0’ both because it is the oldest found in Vietnam and to indicate that no resistance cluster is inserted into the element.

Discussion

The analysis of drug resistance circulation in V. cholerae O1 epidemic strains, isolated in the Thua Thien Hue region in 2003, revealed no association with the resistant genes under study or with mobile genetic elements, which surprisingly were not found. All these strains showed the same ribotype, irrespective of their site of isolation and resistance pattern.

Amoxicillin resistance was the ubiquitous feature of all the strains under study, along with the general presence of aminoglycosides resistance and sporadic erythromycin resistance, among others. Amoxicillin is one of the most used antibiotics in Vietnam, so its resistance spread is easily explained. Aminoglycosides and erythromycin are natural compounds diffused in the environment, and their resistances are prevalent in V. cholerae clinical isolates worldwide (Dalsgaard et al., 2001; Thungapathra et al., 2002; Ceccarelli et al., 2006): our isolates confirm this general resistant profile. The 2003 Vietnamese isolates showed a limited resistance pattern when compared with multiple-resistant V. cholerae strains from other epidemics (Coppo et al., 1995; Dalsgaard et al., 2001; Thungapathra et al., 2002). It is not surprising that a low resistance profile was found in strains apparently devoid of mobile genetic elements, since these are the major means of drug resistance acquisition in V. cholerae.

Beside the analysis of 2003 cholera epidemic strains, we analyzed a strain isolated in 1990 in the same area. The resistance pattern was defined by amoxicillin and aminoglycosides resistances, not related to mobile genetic elements; however, isolate 90 showed the presence of an SXT-like element and a different ribotype, indicating a divergent clonal identity from 2003 isolates. Both 1990 and 2003 ribotypes were partially similar to ribotypes R1 and R2 (all displaying seven common BglI fragments), described by Dalsgaard et al., (1999), and related to 1990–1995 isolates in different provinces of Vietnam. Furthermore, V. cholerae O1 90 diverged from other isolates analyzed in the same region in 1990, resistant to chloramphenicol and characterized by an integron coding for aminoglycosides resistance (Dalsgaard et al., 1999). Ehara examined the evolution of aminoglycosides resistance circulation in V. cholerae O1 epidemic strains in Vietnam (no geographic location and ribotype reported): its expression was related to class 1 integrons in 1995, coded by SXT (ICEVchVie1) in 2000 and absent in 2002 (Ehara et al., 2004). Therefore, our finding concerning the re-emergence of aminoglycosides resistance in 2003 in some measure inverts the general trend of drug resistance loss registered in the last decade.

Unexpectedly, the isolate 90 contained the SXT-like element ICEVchVie0, and its identity was confirmed by the presence of three conserved functional regions coding for mating functions. However, none of the typical SXT resistance genes were revealed and this finding was consistent with the rumAB region arrangement, containing a gene relic matching with SXTS, devoid of the SXTMO10 resistance gene cluster (Hochhut et al., 2001).

The detection of Hotspot 1 organized as in R391, Hotspot 2 and VR2 structured as in SXT, and the concealment of Hotspot 3 and the other variable regions investigated outlined a specific molecular profile of ICEVchVie0. The resistant ICE, ICEVchLao1 (SXTLAOS) (Iwanaga et al., 2004) also showed the Hotspot 1 organized as in R391 and, although we have no adequate data to deduce a direct relation with ICEVchVie0, it is possible to suggest at least a common evolutionary origin. These findings reinforce the idea that ICEVchVie0 belongs to a wider composite SXT/R391 family of ICEs and it is not just an isolated element. Furthermore, the role of this family of mobile genetic elements in Vibrio genome plasticity should be reconsidered, particularly in relation to the emergence of new pathogens.

ICEs devoid of resistance genes had already been detected sporadically among strains isolated in Vietnam in 2000, in Laos in 1998–2000 and ubiquitously in Angola in 1991–1996 (Ehara et al., 2004; Iwanaga et al., 2004; Ceccarelli et al., 2006). These ICEs seem to be more widespread than supposed, and may constitute a wide cryptic class of mobile genetic elements (Burrus et al., 2006b). The subsequent disappearance of ICEVchVie0 in the 2003 may be explained by the loss of resistance advantages generally conferred by SXT to V. cholerae strains.

Acknowledgements

We are grateful to V. Burrus and J.T. Pembroke for valuable suggestions and comments and to G. Prosseda and S. Sanna for technical advices, and T. Noble for manuscript editing. This work was supported by MIUR and Sardinian Regional Government (LR 18/96). D. Ceccarelli was supported by ‘Cellular and Developmental Biology Doctorate’.

References

Beaber
J.W.
Burrus
V.
Hochhut
B.
Waldor
M.
(
2002
)
Comparison of SXT and R391, two conjugative integrating elements: definition of a genetic backbone for the mobilization of resistance determinants
.
Cell Mol Life Sci
 
59
:
2065
2070
.
Böltner
D.
MacMahon
C.
Pembroke
J.T.
Strike
P.
Osborn
A.M.
(
2002
)
R391: a conjugative integrating mosaic comprised of phage, plasmid, and transposon elements
.
J Bacteriol
 
184
:
5158
5169
.
Burrus
V.
Pavlovic
G.
Decaris
B.
Guedon
G.
(
2002
)
Conjugative transposons: the tip of the iceberg
.
Mol Microbiol
 
46
:
601
610
.
Burrus
V.
Marrero
J.
Waldor
M.K.
(
2006a
)
The current ICE age: biology and evolution of SXT-related integratine conjugative elements
.
Plasmid
 
55
:
173
183
.
Burrus
V.
Quezada-Calvillo
R.
Marrero
J.
Waldor
M.K.
(
2006b
)
SXT-related integrating conjugative element in New World Vibrio cholerae
.
Appl Environ Microbiol
 
72
:
3054
3057
.
Ceccarelli
D.
Salvia
A.M.
Sami
J.
Cappuccinelli
P.
Colombo
M.M.
(
2006
)
A new cluster of plasmid-located class 1 integrons in V. cholerae O1 and dfrA15 cassette integron in V. parahaemolyticus isolated in Angola
.
Antimicrob Agents Chemother
 
50
:
2493
2499
.
Colombo
M.M.
Mastrandrea
S.
Leite
F.
Santona
A.
Uzzau
S.
Rappelli
P.
Pisano
M.
Rubino
S.
Cappuccinelli
P.
(
1997
)
Tracking of clinical and environmental Vibrio cholerae O1 strains by combined analisys of the presence of toxin cassette, plasmid content and ERIC PCR
.
FEMS Immunol Med Microbiol
 
19
:
33
45
.
Coppo
A.
Colombo
M.M.
Pazzani
C.
Bruni
R.
Mohamud
K.A.
Omar
K.H.
Mastrandrea
S.
Salvia
A.M.
Rotigliano
G.
Maimone
F.
(
1995
)
Vibrio cholerae in the Horn of Africa: epidemiology, plasmids, tetracycline resistance gene amplification, and comparison between O1 and non-O1 strains
.
Am J Trop Med Hyg
 
53
:
351
359
.
Dalsgaard
A.
Tam
N.V.
Cam
P.D.
(
1997
)
Cholera in Vietnam
.
Southeast Asian J Trop Med Public Health
 
28
:
69
72
.
Dalsgaard
A.
Forslund
A.
Tam
N.
Vinh
D.X.
Cam
P.D.
(
1999
)
Cholera in Vietnam: changes in genotypes and emergence of class 1 integrons containing aminoglycoside resistance gene cassettes in Vibrio cholerae O1 strains isolated from 1979 to 1996
.
J Clin Microbiol
 
37
:
734
741
.
Dalsgaard
A.
Forslund
A.
Serichantalergs
O.
Sandvang
D.
(
2000
)
Distribution and content of class 1 integrons in different Vibrio cholerae O-serotypes strains isolated in Thailand
.
Antimicrob Agents Chemother
 
44
:
1315
1321
.
Dalsgaard
A.
Forslund
A.
Sandvang
D.
Arntzen
L.
Keddy
K.
(
2001
)
Vibrio cholerae O1 outbreak isolates in Mozambique and South Africa in 1998 are multiple-drug resistant, contain the STX element and the aadA2 gene located on Class 1 Integrons
.
J Antimicrob Chemother
 
48
:
827
838
.
Ehara
M.
Nguyen
B.M.
Nguyen
D.T.
Toma
C.
Higa
N.
Iwanaga
M.
(
2004
)
Drug susceptibility and its genetic basis in epidemic Vibrio cholerae O1 in Vietnam
.
Epidemiol Infect
 
132
:
595
600
.
Hochhut
B.
Waldor
M.K.
(
1999
)
Site-specific integration of the conjugal Vibrio cholerae SXT element into prfC
.
Mol Microbiol
 
32
:
99
110
.
Hochhut
B.
Marrero
J.
Waldor
M.K.
(
2000
)
Mobilization of plasmids and chromosomal DNA mediated by the SXT element, a Constin found in Vibrio cholerae O139
.
J Bacteriol
 
182
:
2034
2047
.
Hochhut
B.
Lotfi
Y.
Mazel
D.
Faruque
S.M.
Woodgate
R.
Waldor
M.K.
(
2001
)
Molecular analysis of antibiotic resistance gene clusters in Vibrio cholerae O139 and O1 SXT constins
.
Antimicrob Agents Chemother
 
45
:
2991
3000
.
Iversen
J.
Sandvang
D.
Srijan
A.
Cam
P.D.
Dalsgaard
A.
(
2003
)
Characterization of antimicrobial resistance, plasmids, and gene cassettes in Shigella spp. from patients in Vietnam
.
Microb Drug Resist
 
9
:
17
24
.
Iwanaga
M.
Toma
C.
Miyazato
T.
Insisiengmay
S.
Nakasone
N.
Ehara
M.
(
2004
)
Antibiotic resistance conferred by a class I integron and SXT constin in Vibrio cholerae O1 strains isolated in Laos
.
Antimicrob Agents Chemother
 
48
:
2364
2369
.
Levesque
C.
Piche
L.
Larose
C.
Roy
P.H.
(
1995
)
PCR mapping of integrons reveals several novel combinations of resistance genes
.
Antimicrob Agents Chemother
 
39
:
185
191
.
McGrath
B.M.
O'Halloran
J.A.
Piterina
A.V.
Pembroke
J.T.
(
2006
)
Molecular tools to detect the IncJ elements: a family of integrating, antibiotic resistant mobile genetic elements
.
J Microb Methods
 
66
:
32
42
.
Sciortino
C.V.
Johnson
J.A.
Hamad
A.
(
1996
)
Vitek system antimicrobial susceptibility testing of O1, O139, and non-O1 Vibrio cholerae
.
J Clin Microbiol
 
34
:
897
900
.
Thungapathra
M.
Amita
Sinha
K.K.
Chaudhuri
S.R.
Garg
P.
Ramamurthy
T.
Nair
G.B.
Ghosh
A.
(
2002
)
Occurrence of antibiotic Resistance gene cassettes aac(6′)-Ib, dfrA5, dfrA12, and ereA2 in class I integrons in non-O1, non-O139 Vibrio cholerae strains in India
.
Antimicrob Agents Chemother
 
46
:
2948
2955
.
Vu
D.T.
Hossain
M.M.
Nguyen
D.S.
et al
. (
2003
)
Coverage and costs of mass immunization of an oral cholera vaccine in Vietnam
.
J Health Popul Nutr
 
21
:
304
308
.
Woods
G.L.
Washington
J.A.
(
1995
)
Antibacterial susceptibility tests: dilution and disk diffusion methods
.
Manual of Clinical Microbiology
 ,
6
th ed (
Murray
P.R.
Baron
E.J.
Pfaller
M.A.
Tenover
F.C.
Yolken
R.H.
, eds), pp.
1327
1341
.
ASM PRESS
,
Washington, DC
.

Author notes

Editor: Peter Williams