Abstract

The majority of Eucalyptus species are native to Australia, but worldwide there are over 3 million ha of exotic plantations, especially in the tropics and subtropics. Of the numerous known leaf diseases, three species of Phaeophleospora can cause severe defoliation of young Eucalyptus; Phaeophleospora destructans, Phaeophleospora eucalypti and Phaeophleospora epicoccoides. Phaeophleospora destructans has a major impact on seedling survival in Asia and has not, as yet, been found in Australia where it is considered a serious threat to the biosecurity of native eucalypts. It can be difficult to distinguish Phaeophleospora species based on symptoms and micromorphology and an unequivocal diagnostic tool for quarantine purposes would be useful. In this study, a multiple gene genealogy of these Phaeophleospora species and designed specific primers has been constructed to detect their presence from leaf samples. The phylogenetic position of these Phaeophleospora species within Mycosphaerella was established. They are closely related to each other and to other important Eucalyptus pathogens, Mycosphaerella nubilosa, Mycosphaerella cryptica and Colletogloeopsis zuluensis. The specific primers developed can now be used for diagnostic and screening purposes within Australia.

Introduction

Eucalyptus species are highly favoured for the establishment of plantations. This is due to their rapid growth, ease of cultivation and their adaptation to a wide variety of different growing conditions (Turnbull, 2000). The timber of these trees is an important source of fibre for the international paper and pulp industry (Turnbull, 2000). In Australia, plantation forestry is rapidly increasing in size (National Forestry Inventory, 2004) and a number of fungal foliar pathogens have been reported to impact negatively on yields of these plantations. Among the most important of these pathogens are Mycosphaerella spp. (Carnegie et al., 1997; Park et al., 2000; Barber et al., 2003; Maxwell et al., 2003) and their incidence and severity is increasing as the areas under cultivation expand (Park et al., 2000; Maxwell et al., 2003).

Phaeophleospora Rangel is an anamorph genus assigned to some species of Mycosphaerella (Crous, 1998; Crous et al., 2001, 2004; Maxwell et al., 2003). Six species are known to cause disease on leaves of Eucalyptus species These are Phaeophleospora epicoccoides (Cooke & Massee) Crous, Ferreira & Sutton, Phaeophleospora destructans (MJ Wingf & Crous) Crous, Ferreira & Sutton, Phaeophleospora eucalypti (Cooke & Massee) Crous, Ferreira & Sutton, Phaeophleospora lilianie (Walker, Sutton & Pascoe) Crous, Ferreira & Sutton, Phaeophleospora delegatensis Park & Keane (Crous, 1998) and the recently described Phaeophleospora toledana Crous & G. Bills (Crous et al., 2004). Of these species, P. epicoccoides, P. destructans and P. eucalypti are considered important pathogens (Park et al., 2000). Phaeophleospora lilianie has been found only on yellow bloodwood (Eucalyptus eximia) in New South Wales and little is known regarding its importance (Chippendale, 1988). Phaeophleospora delegatensis is the anamorph of Mycosphaerella delegantesis (Park & Keane, 1984) isolated from the leaves of Eucalyptus delegantensis and Eucalyptus obliqua in Australia. It occasionally causes premature defoliation if the infection levels are severe. Both P. liliane and P. delegatensis have poor survival in culture and they have thus have never been successfully stored. Phaeophleospora toledana is the anamorph of Mycosphaerella toledana (Crous et al., 2004) named for its location of origin and it is not considered as a serious leaf pathogen.

Phaeophleospora destructans is an aggressive and often devastating pathogen that causes distortion of infected leaves and blight of young leaves, buds and shoots (Wingfield et al., 1996). This pathogen was first discovered in Indonesia in 1996 and has subsequently spread to Thailand, China, Vietnam and Timor (Old et al., 2003a, b; Barber 2004; Burgess et al., 2006). While most Phaeophleospora species infecting Eucalyptus leaves are known from Australia, P. destructans, the most pathogenic of these fungi has not been found in this country. Thus, the potential impact of P. destructans on native eucalypt forests is unknown, but of concern.

Phaeophleospora epicoccoides is the anamorph of Mycosphaerella suttoniae (Crous et al., 1997) and it occurs worldwide infecting almost all eucalypt species (Sankaran et al., 1995). This species is well known on native Eucalyptus species in Australia and it has most likely been spread to other countries with germ-plasm used to establish plantations. Phaeophleospora epicoccoides is a relatively weak pathogen typically infecting older leaves and stressed trees (Knipscheer et al., 1990). Phaeophleospora eucalypti, a native pathogen in Australia, has in the past resulted in complete defoliation of juvenile leaves of Eucalyptus nitens in New Zealand, the only country where it is known to have been introduced (Dick, 1982; Hood et al., 2002a, b). The worst affected E. nitens stands in New Zealand are currently being converted back to farmland (Hood et al., 2002b).

The appearance and severity of lesions on Eucalytpus leaves are generally used to recognize the species of Phaeophleospora responsible for disease. However, depending on host and climate, the symptoms associated with infection by P. epicoccoides, P. eucalypti and P. destructans can be almost identical (Fig. 1) and incorrect diagnosis is a common problem. In addition, identification of P. eucalypti and P. destructans based on conidial morphology can be difficult because spore size varies depending on host species. A simple and accurate molecular diagnostic technique to distinguish between these important species would compliment traditional morphological diagnosis.

1

Comparison of symptoms produced on juvenile Eucalyptus grandis leaves infected with (a) Phaeophleospora destructans, (b) Phaeophleospora eucalypti and (c) Phaeophleospora epicoccoides showing the similarity of symptoms associated with these fungi.

1

Comparison of symptoms produced on juvenile Eucalyptus grandis leaves infected with (a) Phaeophleospora destructans, (b) Phaeophleospora eucalypti and (c) Phaeophleospora epicoccoides showing the similarity of symptoms associated with these fungi.

The aim of this study was to construct multiple gene genealogies for P. epicoccoides, P. destructans and P. eucalypti, the most common and destructive species occurring on Eucalyptus. Thus, partial sequences for six protein coding genes were generated to elucidate the phylogenetic relationships between these Phaeophleospora species. Following the construction of the phylogenies, species specific primers were then designed for diagnostic purposes.

Materials and methods

Fungal isolates

Phaeophleospora species were isolated under a dissecting microscope by collecting conidia exuding from single pycnidia, on the tip of a sterile needle. The spores were placed on malt extract (20 g L−1) agar (MEA), in a single spot and allowed to hydrate for 5 min. Conidia were then drawn across the agar surface with a sterile needle and single spores were picked off the agar and transferred to new MEA plates. Spores were left to germinate, which usually occurred within 24 h. Cultures were maintained at 20°C on MEA. Isolates made for this study were compared with those of other closely related species (Table 1). All isolates are maintained in the collection (CMW) of the Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, South Africa or the Murdoch University culture collection (MUCC), Perth, Western Australia.

1

Species and isolates considered in the phylogenetic study

       GenBank accession nos 
Culture no. Teleomorph Anamorph Host Location Collector ITS β-tubulin EF-1α CHS 
STE-U 1454 CMW 5351  Phaeophleospora eugeniae Eugenia uniflora Brazil MJ Wingfield AF309613DQ632710    
STE-U1366 CMW 5219  P. destructans Eucalyptus grandis Sumatra, Indonesia MJ Wingfield AF309614DQ632699    
CMW 7127  P. destructans Eucalyptus sp Sumatra, Indonesia MJ Wingfield DQ632698    
CMW 19906  P. destructans E. grandis Sumatra, Indonesia PA Barber DQ632700    
CMW 22553  P. destructans E. grandis Sumatra, Indonesia PA Barber DQ632667 DQ632625 DQ632732 DQ632646 
CMW 17918  P. destructans E. grandis Sumatra, Indonesia PA Barber DQ632666 DQ632624 DQ632731 DQ632645 
CMW 19832  P. destructans E. grandis Sumatra, Indonesia PA Barber DQ632665 DQ632623 DQ632730 DQ632644 
CMW 17919  P. destructans E. urophylla Guangzhou, China TI Burgess DQ632701 DQ632622 DQ632729 DQ632643 
MUCC 433  P. eucalypti E. nitens Victoria, Australia PA Barber DQ632661 DQ632631 DQ632726 DQ632650 
CMW 17915  P. eucalypti E. nitens Victoria, Australia PA Barber DQ632664 DQ632626 DQ632727 DQ632653 
MUCC 432  P. eucalypti E. grandis x E. tereticornis New South Wales AJ Carnegie DQ632660 DQ632627 DQ632724 DQ632648 
MUCC 434  P. eucalypti E. grandis x E. tereticornis New South Wales AJ Carnegie DQ632662 DQ632632 DQ632728 DQ632651 
CMW 17917  P. eucalypti E. grandis x E. tereticornis New South Wales AJ Carnegie DQ632711 DQ632630 DQ632725 DQ632649 
MUCC 435  P. eucalypti E. grandis x E. camaldulensis Queensland AJ Carnegie DQ632663 DQ632629 DQ632723 DQ632652 
CMW 17916  P. eucalypti E. grandis x E. camaldulensis Queensland AJ Carnegie DQ632659 DQ632628 DQ632722 DQ632647 
CMW 11687  P. eucalypti E. nitens New Zealand M Dick DQ240001 DS890168 DQ235115 DQ890167 
NZFS85C/23  P. eucalypti E. nitens New Zealand M Dick AY626988    
NZFS85C/1  P. eucalypti E. nitens New Zealand M Dick AY626987    
MUCC 422 M. suttoniae P. epicoccoides E. grandis x E. camaldulensis Queensland G Hardy DQ632656    
MUCC 424 M. suttoniae P. epicoccoides E. grandis x E. camaldulensis Queensland G Hardy DQ632703 DQ632617 DQ632712 DQ632633 
MUCC 428 M. suttoniae P. epicoccoides E. grandis x E. camaldulensis Queensland TI Burgess DQ632707 DQ632618 DQ632717 DQ632638 
MUCC 430 M. suttoniae P. epicoccoides E. grandis Queensland G Whyte DQ632708    
MURU 327 M. suttoniae P. epicoccoides E. globulus Western Australia S Jackson DQ632702 DQ632619 DQ632716 DQ632639 
MUCC 426 M. suttoniae P. epicoccoides E. globulus Western Australia S Jackson DQ632704 DQ632620 DQ632715 DQ632637 
CMW 22482 M. suttoniae P. epicoccoides E. grandis Sumatra, Indonesia PA Barber DQ632658 DQ632621 DQ632719 DQ632636 
MUCC 425 M. suttoniae P. epicoccoides E. grandis New South Wales TI Burgess DQ632655 DQ632613 DQ632713 DQ632634 
MUCC 429 M. suttoniae P. epicoccoides E. grandis New South Wales TI Burgess DQ530226    
MUCC 431 M. suttoniae P. epicoccoides E. grandis New South Wales TI Burgess DQ530227    
CMW 22484 M. suttoniae P. epicoccoides E. urophylla China TI Burgess DQ632705 DQ632616 DQ632714 DQ632635 
CMW 22486 M. suttoniae P. epicoccoides E. urophylla China TI Burgess DQ632706 DQ632615 DQ632720 DQ632642 
CMW 17920 M. suttoniae P. epicoccoides E. urophylla China TI Burgess DQ632654 DQ632612 DQ632721 DQ632641 
CMW 22483 M. suttoniae P. epicoccoides E. grandis Indonesia PA Barber DQ632709    
CMW 5348 STE-U 1346 M. suttoniae P. epicoccoides Eucalyptus sp. Indonesia MJ Wingfield AF309621 DQ240117 DQ240170 DQ890166 
SA12 M. suttoniae P. epicoccoides E. fragrata South Africa MN Cortinas DQ632657 DQ632614 DQ632718 DQ632640 
STE-U 10840CPC 10840 M. toledana P. toledana E. globulus Spain PW Crous AY725580    
CBS 113313 CMW 14457 M. toledana P. toledana E. globulus Spain PW Crous AY725581 DQ658235 DQ235120 DQ658226 
AMR 051 M. nubilosa  E. globulus Western Australia A Maxwell AY509777    
AMR 057 M. nubilosa  E. globulus Western Australia A Maxwell AY509778    
CMW 11560 M. nubilosa  E. globulus Tasmania A Milgate DQ658232 DQ658236 DQ240176 DQ658230 
CMW 6211 M. nubilosa  E. nitens South Africa G Hunter AF449094    
CMW 9003 M. nubilosa  E. nitens South Africa G Hunter AF449099    
AMR 118 M. cryptica Colletogloeopsis nubilosum E. globulus Western Australia A Maxwell AY509753    
AMR 115 M. cryptica C. nubilosum E. globulus Western Australia A Maxwell AY509754    
CMW 3279 M. cryptica C. nubilosum E. globulus Australia AJ Carnegie AY309623 DQ658234 DQ235119 DQ658225 
CMW 4915  C. zuluensis E. grandis South Africa MJ Wingfield AY244421    
CBS 117262 CMW 7449  C. zuluensis E. grandis South Africa L Van Zyl DQ240021 DQ240102 DQ240155 DQ658224 
CBS 113399 CMW 13328  C. zuluensis E. grandis South Africa L Van Zyl DQ240018 DQ658233 DQ240172 DQ658223 
CBS 110499 CMW 13704 M. ambiphylla Phaeophleospora sp. E. globulus Western Australia A Maxwell AY150675 DQ240116 DQ240169 DQ658229 
STE-U 784 M. molleriana C. molleriana Eucalyptus sp. USA  AF309619    
CMW 4940 CPC1214 M. molleriana C. molleriana Eucalyptus sp. Portugal MJ Wingfield DQ239969 DQ240115 DQ240168 DQ658228 
A/1/8 M. vespa Coniothyrium ovatum Eucalyptus sp. Tasmania A Milgate AY045499    
CMW 11588 M. vespa Co. ovatum E. globulus Tasmania A Milgate DQ239968 DQ240114 DQ240167 DQ658227 
CMW 6210 M. vespa Co. ovatum E. globulus New South Wales MJ Wingfield AF449095    
CBS 110906  Coniothyrium sp. E. cladocalyx South Africa PW Crous AY725513    
CBS 111149  Coniothyrium sp. E. cladocalyx South Africa PW Crous AY725514    
CBS 113621  Coniothyrium sp. E. cladocalyx South Africa PW Crous AY725515    
CBS 116427  Coniothyrium sp. Eucalyptus sp. South Africa PW Crous AY725516    
CPC 18  Coniothyrium sp. E. cladocalyx South Africa PW Crous AY725517    
CBS 116428  Coniothyrium sp. Eucalyptus sp. South Africa PW Crous AY725518    
CBS 113265CMW 13333 M. punctiformis Ramularia endophylla Quercus robor Netherlands  AY490763    
CMW 9091 M. marksii Pseudocercospora epispermogonia Eucalyptus sp. South Africa G Hunter AF468871    
STE-U 796 CBS 680.95 M. africana  Eucalyptus sp. South Africa PW Crous AF173314    
STE-U 1084 M. keniensis  Eucalyptus sp. Kenya MJ Wingfield AF173300    
CBS 110500AMR 221 M. aurantia  E. globulus Western Australia A Maxwell AF509743    
CBS 110969 STE-U1106 M. colombiensis Ps. colombiensis Eucalyptus sp. Colombia MJ Wingfield AF309612    
CBS 110503 AMR 251 M. parva  E. globulus Western Australia A Maxwell AF509782    
NZs M. suberosa    A Milgate AY045503    
CBS 110949 M. ohnowa  E. grandis South Africa MJ Wingfield AY725575    
STE-U 1225 M. ellipsoidea Uwebraunia ellipsoidea Eucalyptus sp. South Africa MJ Wingfield AF173303    
CMW 9098 M. ellipsoidea U. ellipsoidea Eucalyptus sp. South Africa MJ Wingfield AF468874    
CMW 7774 Botryosphaeria obtusa  Ribes sp. New York, USA B Slippers AY236953    
CMW 7773 B. ribis  Ribes sp. New York, USA B Slippers AY236936 AY808170 AY236878 DQ658231 
       GenBank accession nos 
Culture no. Teleomorph Anamorph Host Location Collector ITS β-tubulin EF-1α CHS 
STE-U 1454 CMW 5351  Phaeophleospora eugeniae Eugenia uniflora Brazil MJ Wingfield AF309613DQ632710    
STE-U1366 CMW 5219  P. destructans Eucalyptus grandis Sumatra, Indonesia MJ Wingfield AF309614DQ632699    
CMW 7127  P. destructans Eucalyptus sp Sumatra, Indonesia MJ Wingfield DQ632698    
CMW 19906  P. destructans E. grandis Sumatra, Indonesia PA Barber DQ632700    
CMW 22553  P. destructans E. grandis Sumatra, Indonesia PA Barber DQ632667 DQ632625 DQ632732 DQ632646 
CMW 17918  P. destructans E. grandis Sumatra, Indonesia PA Barber DQ632666 DQ632624 DQ632731 DQ632645 
CMW 19832  P. destructans E. grandis Sumatra, Indonesia PA Barber DQ632665 DQ632623 DQ632730 DQ632644 
CMW 17919  P. destructans E. urophylla Guangzhou, China TI Burgess DQ632701 DQ632622 DQ632729 DQ632643 
MUCC 433  P. eucalypti E. nitens Victoria, Australia PA Barber DQ632661 DQ632631 DQ632726 DQ632650 
CMW 17915  P. eucalypti E. nitens Victoria, Australia PA Barber DQ632664 DQ632626 DQ632727 DQ632653 
MUCC 432  P. eucalypti E. grandis x E. tereticornis New South Wales AJ Carnegie DQ632660 DQ632627 DQ632724 DQ632648 
MUCC 434  P. eucalypti E. grandis x E. tereticornis New South Wales AJ Carnegie DQ632662 DQ632632 DQ632728 DQ632651 
CMW 17917  P. eucalypti E. grandis x E. tereticornis New South Wales AJ Carnegie DQ632711 DQ632630 DQ632725 DQ632649 
MUCC 435  P. eucalypti E. grandis x E. camaldulensis Queensland AJ Carnegie DQ632663 DQ632629 DQ632723 DQ632652 
CMW 17916  P. eucalypti E. grandis x E. camaldulensis Queensland AJ Carnegie DQ632659 DQ632628 DQ632722 DQ632647 
CMW 11687  P. eucalypti E. nitens New Zealand M Dick DQ240001 DS890168 DQ235115 DQ890167 
NZFS85C/23  P. eucalypti E. nitens New Zealand M Dick AY626988    
NZFS85C/1  P. eucalypti E. nitens New Zealand M Dick AY626987    
MUCC 422 M. suttoniae P. epicoccoides E. grandis x E. camaldulensis Queensland G Hardy DQ632656    
MUCC 424 M. suttoniae P. epicoccoides E. grandis x E. camaldulensis Queensland G Hardy DQ632703 DQ632617 DQ632712 DQ632633 
MUCC 428 M. suttoniae P. epicoccoides E. grandis x E. camaldulensis Queensland TI Burgess DQ632707 DQ632618 DQ632717 DQ632638 
MUCC 430 M. suttoniae P. epicoccoides E. grandis Queensland G Whyte DQ632708    
MURU 327 M. suttoniae P. epicoccoides E. globulus Western Australia S Jackson DQ632702 DQ632619 DQ632716 DQ632639 
MUCC 426 M. suttoniae P. epicoccoides E. globulus Western Australia S Jackson DQ632704 DQ632620 DQ632715 DQ632637 
CMW 22482 M. suttoniae P. epicoccoides E. grandis Sumatra, Indonesia PA Barber DQ632658 DQ632621 DQ632719 DQ632636 
MUCC 425 M. suttoniae P. epicoccoides E. grandis New South Wales TI Burgess DQ632655 DQ632613 DQ632713 DQ632634 
MUCC 429 M. suttoniae P. epicoccoides E. grandis New South Wales TI Burgess DQ530226    
MUCC 431 M. suttoniae P. epicoccoides E. grandis New South Wales TI Burgess DQ530227    
CMW 22484 M. suttoniae P. epicoccoides E. urophylla China TI Burgess DQ632705 DQ632616 DQ632714 DQ632635 
CMW 22486 M. suttoniae P. epicoccoides E. urophylla China TI Burgess DQ632706 DQ632615 DQ632720 DQ632642 
CMW 17920 M. suttoniae P. epicoccoides E. urophylla China TI Burgess DQ632654 DQ632612 DQ632721 DQ632641 
CMW 22483 M. suttoniae P. epicoccoides E. grandis Indonesia PA Barber DQ632709    
CMW 5348 STE-U 1346 M. suttoniae P. epicoccoides Eucalyptus sp. Indonesia MJ Wingfield AF309621 DQ240117 DQ240170 DQ890166 
SA12 M. suttoniae P. epicoccoides E. fragrata South Africa MN Cortinas DQ632657 DQ632614 DQ632718 DQ632640 
STE-U 10840CPC 10840 M. toledana P. toledana E. globulus Spain PW Crous AY725580    
CBS 113313 CMW 14457 M. toledana P. toledana E. globulus Spain PW Crous AY725581 DQ658235 DQ235120 DQ658226 
AMR 051 M. nubilosa  E. globulus Western Australia A Maxwell AY509777    
AMR 057 M. nubilosa  E. globulus Western Australia A Maxwell AY509778    
CMW 11560 M. nubilosa  E. globulus Tasmania A Milgate DQ658232 DQ658236 DQ240176 DQ658230 
CMW 6211 M. nubilosa  E. nitens South Africa G Hunter AF449094    
CMW 9003 M. nubilosa  E. nitens South Africa G Hunter AF449099    
AMR 118 M. cryptica Colletogloeopsis nubilosum E. globulus Western Australia A Maxwell AY509753    
AMR 115 M. cryptica C. nubilosum E. globulus Western Australia A Maxwell AY509754    
CMW 3279 M. cryptica C. nubilosum E. globulus Australia AJ Carnegie AY309623 DQ658234 DQ235119 DQ658225 
CMW 4915  C. zuluensis E. grandis South Africa MJ Wingfield AY244421    
CBS 117262 CMW 7449  C. zuluensis E. grandis South Africa L Van Zyl DQ240021 DQ240102 DQ240155 DQ658224 
CBS 113399 CMW 13328  C. zuluensis E. grandis South Africa L Van Zyl DQ240018 DQ658233 DQ240172 DQ658223 
CBS 110499 CMW 13704 M. ambiphylla Phaeophleospora sp. E. globulus Western Australia A Maxwell AY150675 DQ240116 DQ240169 DQ658229 
STE-U 784 M. molleriana C. molleriana Eucalyptus sp. USA  AF309619    
CMW 4940 CPC1214 M. molleriana C. molleriana Eucalyptus sp. Portugal MJ Wingfield DQ239969 DQ240115 DQ240168 DQ658228 
A/1/8 M. vespa Coniothyrium ovatum Eucalyptus sp. Tasmania A Milgate AY045499    
CMW 11588 M. vespa Co. ovatum E. globulus Tasmania A Milgate DQ239968 DQ240114 DQ240167 DQ658227 
CMW 6210 M. vespa Co. ovatum E. globulus New South Wales MJ Wingfield AF449095    
CBS 110906  Coniothyrium sp. E. cladocalyx South Africa PW Crous AY725513    
CBS 111149  Coniothyrium sp. E. cladocalyx South Africa PW Crous AY725514    
CBS 113621  Coniothyrium sp. E. cladocalyx South Africa PW Crous AY725515    
CBS 116427  Coniothyrium sp. Eucalyptus sp. South Africa PW Crous AY725516    
CPC 18  Coniothyrium sp. E. cladocalyx South Africa PW Crous AY725517    
CBS 116428  Coniothyrium sp. Eucalyptus sp. South Africa PW Crous AY725518    
CBS 113265CMW 13333 M. punctiformis Ramularia endophylla Quercus robor Netherlands  AY490763    
CMW 9091 M. marksii Pseudocercospora epispermogonia Eucalyptus sp. South Africa G Hunter AF468871    
STE-U 796 CBS 680.95 M. africana  Eucalyptus sp. South Africa PW Crous AF173314    
STE-U 1084 M. keniensis  Eucalyptus sp. Kenya MJ Wingfield AF173300    
CBS 110500AMR 221 M. aurantia  E. globulus Western Australia A Maxwell AF509743    
CBS 110969 STE-U1106 M. colombiensis Ps. colombiensis Eucalyptus sp. Colombia MJ Wingfield AF309612    
CBS 110503 AMR 251 M. parva  E. globulus Western Australia A Maxwell AF509782    
NZs M. suberosa    A Milgate AY045503    
CBS 110949 M. ohnowa  E. grandis South Africa MJ Wingfield AY725575    
STE-U 1225 M. ellipsoidea Uwebraunia ellipsoidea Eucalyptus sp. South Africa MJ Wingfield AF173303    
CMW 9098 M. ellipsoidea U. ellipsoidea Eucalyptus sp. South Africa MJ Wingfield AF468874    
CMW 7774 Botryosphaeria obtusa  Ribes sp. New York, USA B Slippers AY236953    
CMW 7773 B. ribis  Ribes sp. New York, USA B Slippers AY236936 AY808170 AY236878 DQ658231 

Designation of isolates and culture collections: CBS, Centraalbureau voor Schimmelcultures, Utrecht, Netherlands; CMW, Tree Pathology Co-operative Program, Forestry and Agricultural Biotechnology Institute, University of Pretoria, South Africa; STE-U, Stellenboch University, South Africa; MUCC, Murdoch University, Perth, Western Australia.

Sequences in bold were obtained during this study.

DNA extraction

Isolates were grown on 2% MEA at 20°C for 4 weeks and the mycelium was harvested, frozen in liquid nitrogen, ground to a fine powder and genomic DNA extracted using a hexadecyl trimethyl ammonium bromide (CTAB) protocol from Graham (1994) modified by the addition of 100 µg mL−1 Proteinase K and 100 µg mL−1 RNAse A to the extraction buffer.

PCR amplification

This study included partial amplification of the18S gene, the complete internal transcribed spacer (ITS) region 1, the 5.8S rRNA gene and the complete ITS region 2 and the 5′ end of the 26S (large subunit) rRNA gene, part of the β-tubulin gene region, part of elongation factor 1α gene (EF-1α), part of Chitin synthase 1 gene (CHS), part of the RNA polymerase II subunit (RPB2) and part of ATPase gene (ATP-6). Primers used for amplification of these regions are listed in (Table 2). The PCR reaction mixture (25 µL), PCR conditions and visualization of products were as described previously (Cortinas et al., 2006) except that 1 U of Taq polymerase (Biotech International, Needville, TX) was used in each reaction. For failed amplifications, the Mg concentration was increased to 4 mM, and primer concentration to 0.9 pmol and the following PCR conditions were used; 7 min at 94°C, followed by 35 cycles of 1 min at 94°C, 1 min at 45°C, 2 min at 72°C and final elongation step of 10 min at 72°C. RPB2 degenerate primers were tested at a range of temperatures, but failed to amplify the DNA of some representative isolates. Therefore, two successful amplicons were sequenced and primers redesigned and named RPB2-myco-6F and RPB2-myco-7R (Table 2). The PCR products were purified with Ultrabind®DNA purification kit (MO BIO Laboratories, Solana Beach, CA) following the manufacturer instructions. Amplicons were sequenced as described previously (Burgess et al., 2005)

2

Primer sets and annealing temperature used to amplify Phaeophleospora spp

Region Oligos Oligo Sequence (5′–3′) Amplicon size (bp) AT (°C) Reference 
ITS ITS-1F ITS-4 CTTGGTCATTTAGAGGAAGTAA TCCTCCGCTTATTGATATGC 600 50 Gardes & Bruns (1993) 
ITS ITS-3 ITS-4 GTATCGATGAAGAACGCAGC TCCTCCGCTTATTGATATGC 250 55 White et al. (1990) 
β-tubulin Bt2a Bt2a GGTAACCAAATCGGTGCTGCTTTC ACCCTCAGTGTAGTGACCCTTGGC 680 45–55 Glass & Donaldson (1995) 
EF-1α EF1-728F EF1-986R CATCGAGAAGTTCGAGAAGG TACTTGAAGGAACCCTTACC 350 45–55 Carbone & Kohn (1999) 
CHS CHS-79F CHS-354R TGTGGGCAAGGATGCTTGGAAGAAG TGGAAGAACCATCTGTGAGAGTTG 300 55 Carbone & Kohn (1999) 
RPB2 RPB2-6F RPB2-7R CAAGGTCTTCACAGATGC CCCATRGCTTGYTTRCCCAT 1400 45–55 Liu et al. (1999) 
RPB2myco RPB2myco-6F RPB2myco-7R CAAGGTCTTCACAGATGC CAGGATGAATCTCGCAATG 650 50–55 This study 
ATP6 ATP6-1 ATP6-2 ATTAATTSWCCWTTAGAWCAATT TAATTCTANWGCATCTTTAATRTA 600 45 Kretzer & Bruns (1999) 
β-tubulin (P.destructansPdBt-F PdBt-R GTAACCAAATCGGTGCTGCT CAAAGTGGCTGCTCCGGGCG 198 62 This study 
EF-1α (P.destructansPd-EF-F Pd-EF-R CGAGAAGTTCGAGAAGGTCAG GCGAGGGCTCTGTCGAAG 204 62 This study 
β-tubulin (P. eucalyptiPey-Bt-F Pey-Bt-R GTAACCAAATCGGTGCTGCT GAGTACAAGTGGCTGCTTAG 203 62 This study 
EF-1α (P. eucalyptiPey-EF-F Pey-EF-R CGAGAAGTTCGAGAAGGTCAG CTCTATCTGAAAGTCTTGGC 229 62 This study 
β-tubulin (P.epicoccoidesPep-Bt-F Pep-Bt-R CGACGGCTCAGGCGTGTATG GCGTTAGTGGTGTTGCTTGA 218 62 This study 
EF-1α (P.epicoccoidesPep-EF-F Pep-EF-R CCTACACACCCGCTGGTTAC CGGCGATCCTCCATAATCT 173 62 This study 
Region Oligos Oligo Sequence (5′–3′) Amplicon size (bp) AT (°C) Reference 
ITS ITS-1F ITS-4 CTTGGTCATTTAGAGGAAGTAA TCCTCCGCTTATTGATATGC 600 50 Gardes & Bruns (1993) 
ITS ITS-3 ITS-4 GTATCGATGAAGAACGCAGC TCCTCCGCTTATTGATATGC 250 55 White et al. (1990) 
β-tubulin Bt2a Bt2a GGTAACCAAATCGGTGCTGCTTTC ACCCTCAGTGTAGTGACCCTTGGC 680 45–55 Glass & Donaldson (1995) 
EF-1α EF1-728F EF1-986R CATCGAGAAGTTCGAGAAGG TACTTGAAGGAACCCTTACC 350 45–55 Carbone & Kohn (1999) 
CHS CHS-79F CHS-354R TGTGGGCAAGGATGCTTGGAAGAAG TGGAAGAACCATCTGTGAGAGTTG 300 55 Carbone & Kohn (1999) 
RPB2 RPB2-6F RPB2-7R CAAGGTCTTCACAGATGC CCCATRGCTTGYTTRCCCAT 1400 45–55 Liu et al. (1999) 
RPB2myco RPB2myco-6F RPB2myco-7R CAAGGTCTTCACAGATGC CAGGATGAATCTCGCAATG 650 50–55 This study 
ATP6 ATP6-1 ATP6-2 ATTAATTSWCCWTTAGAWCAATT TAATTCTANWGCATCTTTAATRTA 600 45 Kretzer & Bruns (1999) 
β-tubulin (P.destructansPdBt-F PdBt-R GTAACCAAATCGGTGCTGCT CAAAGTGGCTGCTCCGGGCG 198 62 This study 
EF-1α (P.destructansPd-EF-F Pd-EF-R CGAGAAGTTCGAGAAGGTCAG GCGAGGGCTCTGTCGAAG 204 62 This study 
β-tubulin (P. eucalyptiPey-Bt-F Pey-Bt-R GTAACCAAATCGGTGCTGCT GAGTACAAGTGGCTGCTTAG 203 62 This study 
EF-1α (P. eucalyptiPey-EF-F Pey-EF-R CGAGAAGTTCGAGAAGGTCAG CTCTATCTGAAAGTCTTGGC 229 62 This study 
β-tubulin (P.epicoccoidesPep-Bt-F Pep-Bt-R CGACGGCTCAGGCGTGTATG GCGTTAGTGGTGTTGCTTGA 218 62 This study 
EF-1α (P.epicoccoidesPep-EF-F Pep-EF-R CCTACACACCCGCTGGTTAC CGGCGATCCTCCATAATCT 173 62 This study 

Base codes: R (AG), Y (CT), K (GT), W (AT).

Phylogenetic analyses

In order to compare Phaeophleospora isolates used in this study with other closely related species, additional sequences were obtained from GenBank (Table 1). Sequence data were assembled using sequence navigator version 1.01 (Perkin Elmer) and aligned in clustalx (Thompson et al., 1997) Manual adjustments were made visually by inserting gaps where necessary. All sequences obtained in this study have been deposited in GenBank and accession numbers are shown in Table 1.

The initial analysis was performed on an ITS dataset alone and subsequent analyses were performed on a combined dataset of ITS, β-tubulin, CHS and EF-1α sequence, after a partition homogeneity test (PHT) had been performed in phylogenetic analysis using parsimony (paup) version 4.0b10 (Swofford, 2003) to determine whether sequence data from the four separate gene regions were statistically congruent (Farris et al., 1995; Huelsenbeck et al., 1996). The most parsimonious trees were obtained using heuristic searches with random stepwise addition in 100 replicates, with the tree bisection-reconnection branch-swapping option on and the steepest-descent option, off. Maxtrees were unlimited, branches of zero length were collapsed and all multiple, equally parsimonious trees were saved. Estimated levels of homoplasy and phylogenetic signal (retention and consistency indices) were determined (Hillis & Huelsenbeck, 1992). Characters were unweighted and unordered, branch and branch node supports were determined using 1000 bootstrap replicates (Felsenstein, 1985), characters were sampled with equal probability. Trees were rooted to Botryosphaeria ribis and Botryosphaeria obtusa, which were treated as the outgroup taxa.

Baysian analysis was conducted on the same aligned combined dataset. First mrmodeltest v2.2 (Nylander, 2004) was used to determine the best nucleotide substitution model. Phylogenetic analyses were performed with mrbayes v3.1 (Ronquist & Heuelsenbeck, 2003) applying a general time reversible (GTR) substitution model with gamma (G) and proportion of invariable site (I) parameters to accommodate variable rates across sites. The Markov Chain Monte Carlo (MCMC) analysis of four chains started from random tree topology and lasted 10 000 000 generations. Trees were saved each 10 000 generations, resulting in 10 000 saved trees. Burn-in was set at 500 000 generations after which the likelihood values were stationary, leaving 9950 trees from which the consensus trees and posterior probabilities were calculated. paup 4.0b10 was used to reconstruct the consensus tree and maximum posterior probability assigned to branches after a 50% majority rule consensus tree was constructed from the 9950 sampled trees.

Specific primer design and validation

To design species-specific primers, the gene regions with the greatest sequence difference between P. epicoccoides, P. eucalypti and P. destructans were targeted. Only two gene regions, β-tubulin and EF-1α, were sufficiently variable between P. eucalypti and P. destructans to allow for primer design.

Repeatability of the specific primers was tested using at least 10 isolates of each Phaeophleospora species (P. destructans, CMW17918, 17919, 19832, 19844, 19886, 19906, 19909, 19910, 19936, 22553; P. eucalypti, CMW17912, 17915, 19916, MUCC432, 433, 434, 435, 436, 437, 438; P. epicoccoides, CMW5348, 22482, 22984, 22485, 22486, MUCC327, 424, 425, 426, 427). The isolates were amplified using specific β-tubulin and EF-1α primers (Table 2) and the same PCR conditions as (Cortinas et al., 2006). Thereafter, primers were tested for their specificity, primarily to closely related species, but also to four less related Mycosphaerella spp. (Table 3).

3

Specific primers test results

  P. destructans P. eucalypti P. epicoccoides 
Test species Code β-tubulin 198 bp EF1-α 204 bp β-tubulin 203 bp EF1-α 229 bp β-tubulin 218 bp EF1-α 173 bp 
P. destructans CMW17919 − − − 
P. eucalypti CMW17916 − − − − 
P. epicoccoides CMW5348 − − − − 
M. cryptica CMW3279 − − − − − − 
M. vespa CMW11588 − − − − − − 
M. toledana CMW14457 − − − − − 
C. zuluensis CMW7449 − +(500 bp) − − − − 
M. nubilosa CMW11560 − − − − − − 
M. molleriana CMW4940 − − − − − 
M. ambiphylla CMW13704 − − − − − 
P. eugeniae CMW5351 − +(400 bp)  − − 
M. aurantia MUCC258 − − − − − − 
M. marksii MUCC214 − Multiple bands − − − − 
M. grandis MUCC216 − − − − − 
M. lateralis MUCC436 − − − − − 
  P. destructans P. eucalypti P. epicoccoides 
Test species Code β-tubulin 198 bp EF1-α 204 bp β-tubulin 203 bp EF1-α 229 bp β-tubulin 218 bp EF1-α 173 bp 
P. destructans CMW17919 − − − 
P. eucalypti CMW17916 − − − − 
P. epicoccoides CMW5348 − − − − 
M. cryptica CMW3279 − − − − − − 
M. vespa CMW11588 − − − − − − 
M. toledana CMW14457 − − − − − 
C. zuluensis CMW7449 − +(500 bp) − − − − 
M. nubilosa CMW11560 − − − − − − 
M. molleriana CMW4940 − − − − − 
M. ambiphylla CMW13704 − − − − − 
P. eugeniae CMW5351 − +(400 bp)  − − 
M. aurantia MUCC258 − − − − − − 
M. marksii MUCC214 − Multiple bands − − − − 
M. grandis MUCC216 − − − − − 
M. lateralis MUCC436 − − − − − 

Shaded cells indicate where the primers amplified nonspecific DNA.

The ability of the primers to amplify DNA directly from fruiting bodies from infected leaves was determined. The samples were frozen in liquid nitrogen, ground and DNA extracted with CTAB as described previously (Wittzell, 1999). DNA was then subjected to nested PCR, first using general β-tubulin and EF-1α primers and then the initial PCR product was diluted 1 : 5 and nested PCR conducted using the specific primers.

Results

DNA sequence comparisons

Initially, 57 isolates representing 24 Mycosphaerella species and their anamorphs, including five species of Phaeophleospora found on Eucalyptus species and Phaeophleospora eugeniae the type species of the genus, were compared based on ITS sequence data (Table 1). The aligned data set consisted of 709 characters of which 127 bp were due to a large indel in two isolates of P. epicoccoides (MUCC327 and MUCC424) and this indel was excluded from the analyses. Of the remaining characters, 261 were parsimony informative. These data contained significant phylogenetic signal (P<0.01; gl=−0.41) to allow for meaningful analysis. Initial heuristic searches of unweighted characters in paup resulted in three most parsimonious trees of 910 steps (CI=0.56, RI=0.85). The Phaeophleospora species from Eucalyptus; P. destructans, P. eucalypti, P. epicoccoides, P. toledana and Mycosphaerella ambiphylla (which has a Phaeophleospora anamorph) grouped together in a strongly supported clade. This clade also included Mycosphaerella nubilosa, Mycosphaerella cryptica, Mycosphaerella vespa, Mycosphaerella molleriana, Colleteogloeopsis zuluensis and various undescribed ‘Coniothyrium’ spp. (Fig. 2). The ex-type culture of P. destructans (STEU1336=CMW5219) was resequenced in this study and was distant from the isolate of P. destructans on GenBank (AF309614) (Crous et al., 2001). It was also distant from P. eugeniae, which is the type species of the genus, but close to P. eucalypti (Fig. 2, TreeBASE SN2884). The ex-type culture of P. eugeniae (STEU1454=CMW5351) was also resequenced and, while the new sequence was similar to that on GenBank (AF309613), it differed in the first 50 bp of the ITS1 region. Based on results obtained for analysis of ITS sequence data, only species from the ‘nubilosa clade’ were retained for further study.

2

One of three most parsimonious phylogenetic trees of 977 steps obtained from analysis of ITS sequence data. Branch support (bootstrap values) is given above the branches. The sequences of the ex-type cultures of Phaeophleospora eugineae and Phaeophleospora destructans from Crous et al. (2001) are in a shaded box and those from the present study are in bold type. The tree is rooted to Botryosphaeria ribis and Botryosphaeria obtusa.

2

One of three most parsimonious phylogenetic trees of 977 steps obtained from analysis of ITS sequence data. Branch support (bootstrap values) is given above the branches. The sequences of the ex-type cultures of Phaeophleospora eugineae and Phaeophleospora destructans from Crous et al. (2001) are in a shaded box and those from the present study are in bold type. The tree is rooted to Botryosphaeria ribis and Botryosphaeria obtusa.

The multiple gene genealogies compared 31 isolates, including five Phaeophleospora species from Eucalyptus. The data set for the ATP6 region could not be completed because of difficulties encountered in amplifying DNA for all isolates. The RPB2 region proved not to be informative and these two regions were excluded from the combined analysis. The aligned data set for the combined ITS, β-tubulin, CHS and EF-1α sequences consisted of 1259 characters of which 352 were parsimony informative and were included in analysis. The PHT showed significant difference (P=0.001) between the data from the different gene regions (sum of lengths of original partition was 902, range for 1000 randomizations was 902–921). When the data sets were compared in pairs, the incongruence in the complete combined data set was actually due to incongruence between CHS and both the ITS and EF-1α datasets. On closer examination of the individual tree topography, the incongruence was due to the relationship of M. cryptica and C. zuluensis and not to the positions of the Phaeophleospora species (data not shown, sequence alignments are available from TreeBASE SN2884). Despite the fact that the PHT showed significant difference between data sets, they were nonetheless combined as suggested previously (Hognabba & Wedin, 2003).

The combined data set contained significant phylogenetic signal (P<0.01, gl=−0.29). Heuristic search of unweighted characters in paup resulted in 18 most parsimonious trees of 937 steps (CI=0.68, RI=0.90). In the resultant tree (Fig. 3, TreeBASE SN2884), M. vespa, M. molleriana and M. ambiphylla grouped together, while P. destructans and P. eucalypti were separated with 100% bootstrap support. The four isolates of P. destructans were identical and no polymorphisms were observed in any of the gene regions. There were eight fixed polymorphic sites in the ITS region, nine in the β-tubulin region and 24 in the EF-1α region separating P. destructans and P. eucalypti. The variable sites in the β-tubulin and EF-1α regions were used to design specific primers (Table 2). A table of polymorphic sites is available at http://path.murdoch.edu.au/downloads/Andjicetal_Additionals.pdf

3

Consensus phylogram of 9950 trees resulting from Baysian analysis of the combined ITS-2, β-tubulin, EF-1α and CHS sequence data of Phaeophleospora isolates. Posterior probabilities of the node are indicated above the branches and bootstrap values from the parsimony analysis are indicated below branches in italics. Not all nodes with high posterior probabilities also have bootstrap support. The tree is rooted to Botryosphaeria ribis.

3

Consensus phylogram of 9950 trees resulting from Baysian analysis of the combined ITS-2, β-tubulin, EF-1α and CHS sequence data of Phaeophleospora isolates. Posterior probabilities of the node are indicated above the branches and bootstrap values from the parsimony analysis are indicated below branches in italics. Not all nodes with high posterior probabilities also have bootstrap support. The tree is rooted to Botryosphaeria ribis.

Phaeophleospora eucalypti isolates were further separated in three subgroups, corresponding to isolates from (a) Queensland, (b) New South Wales and (c) Southern New South Wales, Victoria and New Zealand (Fig. 3). There were 18 polymorphic positions across the four gene regions among isolates of P. eucalypti with 2–3 distinct profiles corresponding to geographic regions. Phaeophleospora epicoccoides was the basal species of the group and has three strongly supported subgroups (Fig. 3). Although there were 26 polymorphic sites across the four gene regions, there was no geographic association linked to these polymorphisms. A table showing polymorphic sites between isolates of P. eucalypti and P. epicoccoides is available at http://path.murdoch.edu.au/downloads/Andjicetal_Additionals.pdf

Validation of species-specific primers

Gel photos showing reproducibility of the specific primers for P. destructans, P. eucalypti and P. epicoccoides are given at http://path.murdoch.edu.au/downloads/Andjicetal_Additionals.pdf

Phaeophleospora destructans

DNA for 10 isolates of P. destructans was amplified using the primers specific for β-tubulin and EF1-α. These primers were then tested on 10 closely related Mycosphaerella spp. and five less related species and none gave amplification products for the β-tubulin primers specific to P. destructans. The EF1-α primer specific to P. destructans also amplified DNA of C. zuluensis, P. eugeniae, Mycosphaerella marksii, but the amplicons either contained multiple bands or were larger than the amplicon for P. destructans (Table 3). Both specific primer sets detected P. destructans directly from spores scraped from the surface of leaves. The β-tubulin primers specific for P. destructans also detected the presence of P. eucalypti, but the amplicon was larger than that obtained for P. destructans and it contained a double band.

Phaeophleospora eucalypti

DNA for all 10 isolates of P. eucalypti was amplified using specific primers for β-tubulin and EF1-α. None of Mycosphaerella spp. tested in this study gave amplification products for the EF1-α primers designed to be specific to P. eucalypti (Table 3). The β-tubulin primers designed for P. eucalypti were not specific and amplified seven other species, amplifying bands of the same size as those for P. eucalypti (Table 3). Only the EF1-α primers detected P. eucalypti from spores scraped from leaves.

Phaeophleospora epicoccoides

All ten isolates of P. epicoccoides gave amplification products using the β-tubulin and EF1-α primers developed for this species. None of the Mycosphaerella spp. tested gave amplification products using these primers (Table 3). In planta, the EF1-α primer set detected the presence of P. eucalypti as well as P. epicoccoides and the β-tubulin primer set detected presence of P. epicoccoides and P. destructans on leaf material.

Discussion

The current phylogenetic study has unequivocally shown P. destructans to be closely related to P. eucalypti and specific primers have been developed to easily distinguish between these two species. Phaeophleospora destructans is unknown in Australia and is considered a major biosecurity threat. However, based on symptoms it is hard to distinguish between P. eucalypti, which is well-known in Australia, and P. destructans. Thus the specific primers will be very useful for detection and surveillance activities.

In a former study, Phaeophleospora species emerged in two separate clades (Crous et al., 2001). One of these clades included P. eucalypti and P. epicoccoides and the other accommodated P. eugeniae and P. destructans (Crous et al., 2001). All the isolates of P. destructans that have been examined, including the ex-type culture (STE-U1366=CMW5219), had identical ITS sequence data, which was different to the single sequence previously lodged in GenBank (isolate STE-U 1366, AF309613). Consequently, all Phaeophleospora species from Eucalyptus species cluster together and they are closely related to the important Eucalyptus pathogens, C. zuluensis, M. cryptica and M. nubilosa. In contrast, these fungi are distantly related to P. eugeniae. A taxonomic re-evaluation of species of Phaeophleospora and Colletogloeopsis associated with Eucalyptus species is currently underway (unpublished data).

The sequence data obtained in this study for four isolates of P. destructans, three from Indonesia and one from China, were identical for all six gene regions examined. This finding is unusual as some variability is usually observed in sequence data between isolates of the same species, especially when more than one region of origin is considered. The limited variability among isolates of P. destructans supports the hypothesis of selection pressure resulting in the adaptation of a limited number of genotypes to a new host (Eucalyptus in Sumatra, Indonesia) followed by dispersal of these genotypes throughout Asia. In the present study, no informative characters in the RPB2 and CHS regions were found that could separate P. destructans from P. eucalypti. There were, however, a few stable differences between the two species in the sequences for the ITS2 and β-tubulin regions. The most variable gene region was EF1-α where a 22 bp indel separated these species. For ITS2, β-tubulin and CHS gene regions there were more polymorphic sites among isolates of P. eucalypti than between P. destructans and P. eucalypti. This suggests that while P. destructans emerged as a major Eucalyptus pathogen in Asia, it may have very recently evolved from P. eucalypti, to which it is very closely related. Where this adaptation could have occurred, however, remains a mystery as P. eucalypti has not been detected in Asia.

The sequence data for different P. eucalypti isolates was variable and analysis resulted in the isolates residing in different subgroups based on their origin. As isolates from New Zealand grouped with isolates from Victoria and southern New South Wales, P. eucalypti might have been moved to New Zealand from this region. Phylogeographic studies are required to test this hypothesis appropriately (Carbone & Kohn, 2001; Kasuga et al., 2003).

Many polymorphic sites were observed amongst the sequence data sets for isolates of P. epicoccoides, but the groupings did not reflect any obvious pattern relating to origin or other characteristics of the isolates. Unlike P. eucalypti, this species is widely distributed throughout most Eucalyptus growing regions of the world. The lack of phylogenetic grouping amongst isolates with variable sequence data, probably reflects anthropogenic movement of germplasm and multiple introductions of the fungus into new areas. Phaeophleospora epicoccoides is known to be a morphologically variable species and it may represent a species complex rather than a single taxon (Crous & Wingfield, 1997). Population genetic studies and large numbers of isolates from different locations, especially in Australia are required to resolve this question.

Efforts to develop species specific primers for P. destructans, P. eucalypti and P. epicoccoides reflected the close relatedness between these species and the variably within the species. Nonetheless a suite of species specific primers have been developed that allow for simple distinction between these species. Primers based on the EF1-α region distinguished between all three species and primers for the β-tubulin regions provided reliable detection of P. destructans and P. epicoccoides. Specific primers based on EF1-α sequences were able to detect P. eucalypti and P. destructans directly from plant samples. The β-tubulin primers developed to detect P. epicoccoides also showed a faint positive band for P. destructans, while EF1-α primers developed to detect P. epicoccoides showed a faint band for P. eucalypti from leaf material. While this result may be considered confusing, it is believed that this reflects duel infection as P. epicoccoides is very often present on the same lesion together with P. eucalypti and P. destructans (Burgess et al., 2006).

Phaeophleospora destructans is a devastating pathogen of Eucalyptus as yet undetected in Australia. Since the fungus has been detected in East Timor, which is very close to the Australian border, it is a potential threat to the biosecurity and biodiversity of Australia's vast native Eucalyptus forests. Its early detection in Australia is important and the Australian Quarantine and Inspection Service (AQIS) regularly inspects Eucalyptus species in Australia and neighbouring countries for pathogens including P. destructans. Because the symptoms caused by P. destructans can be almost identical to those associated with P. eucalypti and P. eppicocoides, unequivocal identification procedures are important. The DNA sequence data for many gene regions and the specific markers produced in this study should assist in this process.

Acknowledgements

This work was funded in part by the Australian Research Council DP0343600, ‘Population genetics of fungal pathogens that threaten the biosecurity of Australia's eucalypts’. Vera Andjic is a recipient of a Murdoch University Doctoral Research Scholarship. This work also acknowledges funding from various grants to the University of Pretoria linked to tree protection research and a collaborative research agreement linking the University of Pretoria and Murdoch University. Dr Angus Carnegie is thanked for providing samples of various Phaeophloespora species used in this study.

References

Barber
P.A.
(
2004
)
Forest pathology: the threat of disease to plantation forests in Indonesia
.
Plant Pathol J
 
3
:
97
104
.
Barber
P.A.
Smith
I.W.
Keane
P.J.
(
2003
)
Foliar diseases of Eucalyptus spp. grown for ornamental cut foliage
.
Australasian Plant Pathol
 
32
:
109
111
.
Burgess
T.I.
Barber
P.A.
Hardy
GESJ
(
2005
)
Botryosphaeria spp. associated with eucalypts in Western Australia including description of Fusicoccum macroclavatum sp. nov
.
Australasian Plant Pathol
 
34
:
557
567
.
Burgess
T.I.
Andjic
V.
Hardy
GESJ
Dell
B.
Xu
D.
(
2006
)
First report of Phaeophleospora destructans in China
.
J Tropical Forest Sci
 
18
:
144
146
.
Carbone
I.
Kohn
L.M.
(
1999
)
A method for designing primer sets for speciation studies in filamentous ascomycetes
.
Mycologia
 
91
:
553
556
.
Carbone
I.
Kohn
L.M.
(
2001
)
A microbial population–species interface: nested cladistic and coalescent inference with multilocus data
.
Mol Ecol
 
10
:
947
965
.
Carnegie
A.J.
Keane
P.J.
Podger
F.D.
(
1997
)
The impact of three species of Mycosphaerella newly recorded on Eucalyptus in Western Australia
.
Australasian Plant Pathol
 
26
:
71
77
.
Chippendale
G.M.
(
1988
)
Eucalyptus, Angophora (Myrtaceae). Flora of Australia
 
19
.
Australian Government Publishing Service
,
Canberra
,
XVI
.
542
pp.
Cortinas
M-N.
Burgess
T.I.
Dell
B.
Xu
D.
Wingfield
M.J.
Wingfield
B.D.
(
2006
)
First record of Colletogloeopsis zuluensis comb. nov., causing a stem canker of Eucalyptus spp. in China
.
Mycol Res
 
110
:
229
236
.
Crous
P.W.
(
1998
)
Mycosphaerella spp. and their Anamorphs Associated with Leaf Spot Diseases of Eucalyptus
 ,
APS Press
,
St Paul, Minnesota
.
Crous
P.W.
Wingfield
M.J.
(
1997
)
New species of Mycosphaerella occurring on Eucalyptus leaves in Indonesia and Africa
.
Can J Bot
 
75
:
781
790
.
Crous
P.W.
Ferreira
F.A.
Sutton
B.C.
(
1997
)
A comparison of the fungal genera Phaeophleospora and Kirramyces (Coelomycetes)
.
S Afr J Bot
 
63
:
111
115
.
Crous
P.W.
Hong
L.
Wingfield
B.D.
Wingfield
M.J.
(
2001
)
ITS rDNA phylogeny of selected Mycosphaerella species and their anamorphs occurring on Myrtaceae
.
Mycol Res
 
105
:
425
431
.
Crous
P.W.
Groenewald
J.Z.
Mansilla
J.P.
Hunter
G.C.
Wingfield
M.J.
(
2004
)
Phylogenetic reassessment of Mycosphaerella spp. and their anamorphs occurring on Eucalyptus
.
Stud Mycol
 
50
:
195
214
.
Dick
M.
(
1982
)
Leaf-inhabiting fungi of eucalypts in New Zealand
.
N Z J For Sci
 
12
:
525
537
.
Farris
J.S.
Kallersjo
M.
Kluge
A.G.
Bult
C.
(
1995
)
Testing significance of incongruence
.
Cladistics
 
10
:
315
319
.
Felsenstein
J.
(
1985
)
Confidence intervals on phylogenetics: an approach using bootstrap
.
Evolution
 
39
:
783
791
.
Gardes
M.
Bruns
T.
(
1993
)
ITS primers with enhanced specificity for basidiomycetes — application to the identification of mycorrhizae and rusts
.
Mol Ecol
 
2
:
113
118
.
Glass
N.L.
Donaldson
G.C.
(
1995
)
Development of primer sets designated for use with the PCR to amplify conserved regions from filamentous Ascomycetes
.
Appl Environ Microbiol
 
61
:
1323
1330
.
Graham
G.C.
Meyers
P.
Henry
R.J.
(
1994
)
A simplified method for preparation of fungal DNA for PCR and RAPID analysis
.
Biotechniques
 
16
:
48
50
.
Hillis
D.M.
Huelsenbeck
J.P.
(
1992
)
Signal, noise and reliability in molecular phylogenetic analysis
.
J Heredity
 
83
:
189
195
.
Hognabba
F.
Wedin
M.
(
2003
)
Molecular phylogeny of the Sphaerophorus globosus species complex
.
Cladistics
 
19
:
224
232
.
Hood
I.A.
Chapman
S.J.
Gardiner
J.F.
Molony
K.
(
2002a
)
Seasonal development of septoria leaf blight in young Eucalyptus nitens plantations in New Zealand
.
Australian For
 
65
:
153
164
.
Hood
I.A.
Gardner
J.F.
Kimberley
M.O.
(
2002b
)
Variation among eucalypt species in early susceptibility to the leaf spot fungi Phaeophleospora eucalypti and Mycosphaerella spp
.
N Z J For Sci
 
32
:
235
255
.
Huelsenbeck
J.P.
Bull
J.J.
Cunningham
C.V.
(
1996
)
Combining data in phylogenetic analysis
.
Trends Ecol Evol
 
11
:
152
158
.
Kasuga
T.
White
T.J.
Koenig
G.L.
et al
. (
2003
)
Phylogeography of the fungal pathogen Histoplasma capsulatum
.
Mol Ecol
 
12
:
3383
3402
.
Knipscheer
N.S.
Wingfield
M.J.
Swart
W.J.
(
1990
)
Phaeoseptoria leaf spot of Eucalyptus in South Africa
.
S Afr For J
 
154
:
56
59
.
Kretzer
A.
Bruns
T.D.
(
1999
)
Use of ATP6 in fungal phylogenetics: an example from the Boletales
.
Mol Phylogenetics Evol
 
13
:
483
492
.
Liu
Y.J.
Whelen
S.
Hall
B.D.
(
1999
)
Phylogenetic relationships among ascomycetes: evidence from an RNA polymerase II subunit
.
Mol Biol Evol
 
16
:
1799
1808
.
Maxwell
A.
Dell
B.
Neumeister-Kemp
H.
Hardy
GES
(
2003
)
Mycosphaerella species associated with Eucalyptus in southwestern Australia — new species, new records and a key
.
Mycol Res
 
107
:
351
359
.
National Forestry Inventory
(
2004
)
National Plantation Inventory Update — March 2004
 ,
Bureau of Rural Sciences
,
Canberra
.
Nylander
JAA
(
2004
)
MrModeltest v2. Program distributed by the author
 .
Evolutionary Biology Centre, Uppsala University
.
Old
K.M.
Pongpanich
K.
Thu
P.Q.
Wingfield
M.J.
Yuan
Z.Q.
(
2003a
)
Phaeophleospora destructans causing leaf blight epidemics in South East Asia
 .
ICPP
,
Christchurch, New Zealand
,
2–7
February
, Vol.
2
offered papers
,
165
pp.
Old
K.M.
Wingfield
M.J.
Yuan
Z.Q.
(
2003b
)
A Manual of Diseases of Eucalypts in South-East Asia
 ,
Center for International Forestry Research
,
Bogor, Indonesia
,
104
pp.
Park
R.F.
Keane
P.J.
(
1984
)
Further Mycosphaerella species causing leaf diseases of Eucalyptus
.
Trans Br Mycol Soc
 
89
:
93
105
.
Park
R.F.
Keane
P.J.
Wingfield
M.J.
Crous
P.W.
(
2000
)
Fungal diseases of eucalypt foliage
.
Diseases and Pathogens of Eucalypts
  (
Keane
P.J.
Kile
G.A.
Podger
F.D.
Brown
B.N.
, eds), pp.
153
240
.
CSIRO Publishing
,
Melbourne
.
Ronquist
F.
Heuelsenbeck
J.P.
(
2003
)
MrBayes: bayesian phylogenetic inference under mixed models
.
Bioinformatics
 
19
:
1572
1574
.
Sankaran
K.V.
Sutton
B.C.
Minter
D.W.
(
1995
)
A Checklist of Fungi Recorded on Eucalypts. Mycological Papers No. 170
 ,
CAB International
,
Oxon, UK
,
375
pp.
Swofford
D.L.
(
2003
)
Phylogenetic analysis using parsimony (*and other methods). Version 4. Version 4
 .
Sinauer Associates
,
Sunderland, Massachusetts
.
Thompson
J.D.
Gibson
T.J.
Plewniak
F.
Jeanmougin
F.
Higgins
D.G.
(
1997
)
The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools
.
Nucleic Acids Res
 
24
:
4876
4882
.
Turnbull
J.W.
(
2000
)
Economic and social importance of eucalypts
.
Diseases and Pathogens of Eucalypts
  (
Keane
P.J.
Kile
G.A.
Podger
F.D.
Brown
B.N.
, eds), pp.
1
10
.
CSIRO Publishing
,
Melbourne
.
White
T.J.
Bruns
T.
Lee
S.
Taylor
J.
(
1990
)
Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics
.
PCR Protocols: A Guide to Methods and Applications
  (
Innes
M.A.
Gelfand
D.H.
Sninsky
J.J.
White
T.J.
, eds), pp.
315
322
.
Academic Press
,
San Diego
.
Wingfield
M.J.
Crous
P.W.
Boden
D.
(
1996
)
Kirramyces destructans sp. nov., a serious leaf pathogen of Eucalyptus in Indonesia
.
S Afr J Bot
 
62
:
325
327
.
Wittzell
H.
(
1999
)
Chloroplast DNA variation and reticulate evolution in sexual and apomictic sections of dandelions
.
Mol Ecol
 
8
:
2023
2035
.

Author notes

Editor: Michael Bidochka