Abstract

This study aims to compare the resistance phenotypes conferred by various genes encoding enzymes that phosphorylate erythromycin. The mph genes were cloned into Escherichia coli AG100A susceptible to macrolides and ketolides following disruption of the AcrAB pump. An 882 bp sequence containing a premature stop codon, homologous to the three other previously described mph genes and present widely among Enterobacteriaceae, was found to confer resistance to erythromycin by phosphorylation. The mph(C) gene, as reported for mph(B), also conferred resistance to spiramycin. The mph(A) gene was unique in conferring resistance to azithromycin. The four investigated genes conferred resistance to telithromycin.

Introduction

Macrolides are extensively used for the treatment of various infections of the upper and lower respiratory tracts and of skin and soft tissues, either as a first-line therapy or as an alternative to the penicillins for allergic patients. Since its discovery in the 1950s, erythromycin has been used as a therapeutic agent as well as a starting point for hemi-synthesis of derivatives with improved physiochemical and antimicrobial properties. The ketolides are the latest derivatives developed to overcome acquired macrolide resistance that is widely distributed among Gram-positive pathogens (Douthwaite, 2001).

Modification of the ribosomal target encoded by the erm genes and drug-specific active efflux encoded by the mef or msr genes are the more prevalent mechanisms of macrolide resistance in streptococci and staphylococci (Roberts et al., 1999; Matsuoka & Sasaki, 2004; Davis et al., 2005; Sangvik et al., 2005; Lüthje & Schwarz, 2006). Resistance by inactivation is rare in comparison with target modification and efflux. The mph and ere genes for macrolide phosphotransferases (Noguchi et al., 1995, 1996; Nakamura et al., 2000) and esterases (Biskri & Mazel, 2003), respectively, have mainly been found in Gram-negative bacilli (Alonso et al., 2000; Ojo et al., 2004; Poole et al., 2006). So far, only the mph(C) gene has been detected outside the Beta- and Gammaproteobacteria (Matsuoka et al., 1998; Lüthje & Schwarz, 2006). Unlike the ere genes that confer resistance only to 14- and 15-membered ring macrolides (Biskri & Mazel, 2003), the mph(B) and mph(C) genes are also able to confer resistance to the 16-membered ring macrolides (Kono et al., 1992; Matsuoka et al., 2003; Matsuoka & Sasaki, 2004). The macrolide 2′-phosphotransferases are assigned to two functional classes: Mph(2′)I encoded by mph(A) inactivates the 14-membered macrolides, e.g. erythromycin, more efficiently than the 16-membered macrolides, e.g. spiramycin, while Mph(2′)II encoded by mph(B) does not exhibit substrate preference. Their polypeptide sequences share 37% identical amino acids (O'Hara et al., 1989; Kono et al., 1992). Recently, it has been demonstrated in Staphylococcus aureus that Mph(C), which is highly similar to Mph(B), inactivates telithromycin (a ketolide) and azithromycin (a 15-membered macrolide) (Matsuoka et al., 2003). Nothing is known about the levels of resistance conferred by mph(A), mph(B) and mph(C) to the various macrolides and ketolides when studied against a set of isogenic strains.

During characterization of the resistance genes carried by plasmid pIP1204 of Klebsiella pneumoniae BM4536 (T. Lambert, M. Galimand, S. Sabtcheva, and P. Courvalin, Abstr. 44th Intersci. Conf. Antimicrob. Agents Chemother., abstr. C1-1946, 2004), a genetic structure was detected in Tn1548 (Galimand et al., 2005) identical to that in the previously sequenced pCTX-M3 plasmid (GenBank accession number AF550415) from Citrobacter freundii. This structure consisted of 897 bp (from a canonical RBS sequence AAGGA at 76975–76979 nt) annotated in the database as mph1 (ATG at 76988–76990 nt) and mph2 (ATG at 77243–77245 nt), given the high similarity scores with the N- and C-terminal portions of the Mph-deduced sequences, respectively. In order to determine whether such a structure of two mph parts can confer some resistance properties, various constructs were cloned into Escherichia coli AG100A, which is susceptible to macrolides and ketolides following disruption of the AcrAB pump (Okusu et al., 1996) and the phenotypes obtained were compared with those due to mph(A), mph(B) and mph(C) in the same strain.

Materials and methods

Bacteria and growth conditions

The strains and plasmids are listed in Table 1. Escherichia coli and S. aureus were grown in Luria–Bertani (LB) and brain–heart infusion (BHI) media (Becton-Dickinson, Le Pont-de-Claix, France), respectively. All cultures were incubated at 37°C. When required, antibiotics (Sigma-Aldrich, Saint-Quentin-Fallavier, France) were added to the media as follows: ampicillin at 100 µg mL−1 (selection of pUC19 and pRB474 derivatives in E. coli), chloramphenicol at 10 µg mL−1 (for pRB474 derivatives in S. aureus) or at 20 µg mL−1 (for pACYC184 derivatives in E. coli). Electrotransformation was performed as described (Chesneau et al., 2005).

1

Bacterial strains and plasmids

Strain or plasmid Relevant characteristics Source or reference 
E. coli 
TOP10 Host for cloning Invitrogen 
XL1-Blue Host for mutagenesis Stratagene 
AG100A EmS, KmR, LcR, SmR Okusu et al. (1996) 
DB10 EmS, LcI, NalR, SmR Datta et al. (1974) 
S. aureus 
RN4220 RN450 derivative, restriction deficient Kreiswirth et al. (1983) 
Plasmid 
pUC19 ColEI replicon, polylinker, ApR New England Biolabs 
pACYC184 p15A replicon, CmR, TcR New England Biolabs 
pIP1840 pRB474 derivative, shuttle expression vector Chesneau et al. (2005) 
pTZ3519 pUC119Ωmph(A) Noguchi et al. (1995) 
pTZ3716 pUC119Ωmph(B) Noguchi et al. (1996) 
pAT461 pIP1840Ωmph(C) This work 
pAT462 pACYC184Ωmph(1+2)opal This work 
pAT463 pACYC184Ωmph(1+2)ochre This work 
pAT464 pUC19Ωmph1 This work 
pAT465 pACYC184Ωmph2 This work 
pAT466 pACYC184Ωmph2RBS This work 
Strain or plasmid Relevant characteristics Source or reference 
E. coli 
TOP10 Host for cloning Invitrogen 
XL1-Blue Host for mutagenesis Stratagene 
AG100A EmS, KmR, LcR, SmR Okusu et al. (1996) 
DB10 EmS, LcI, NalR, SmR Datta et al. (1974) 
S. aureus 
RN4220 RN450 derivative, restriction deficient Kreiswirth et al. (1983) 
Plasmid 
pUC19 ColEI replicon, polylinker, ApR New England Biolabs 
pACYC184 p15A replicon, CmR, TcR New England Biolabs 
pIP1840 pRB474 derivative, shuttle expression vector Chesneau et al. (2005) 
pTZ3519 pUC119Ωmph(A) Noguchi et al. (1995) 
pTZ3716 pUC119Ωmph(B) Noguchi et al. (1996) 
pAT461 pIP1840Ωmph(C) This work 
pAT462 pACYC184Ωmph(1+2)opal This work 
pAT463 pACYC184Ωmph(1+2)ochre This work 
pAT464 pUC19Ωmph1 This work 
pAT465 pACYC184Ωmph2 This work 
pAT466 pACYC184Ωmph2RBS This work 

Ap, ampicillin; Cm, chloramphenicol; Em, erythromycin; Km, kanamycin; Lc, lincomycin; Nal, nalidixic acid; Sm, streptomycin; Tc, tetracycline; I, intermediate; R, resistant; S, susceptible.

Construction of recombinant plasmids

Basic DNA manipulations, such as restriction, ligation and agarose gel electrophoresis were carried out according to standard protocols (Sambrook & Russell, 2001). Plasmid and fragment DNA was purified using commercial kits according to the manufacturer's instructions (Qiagen, Courtaboeuf, France). PCR was performed in a 2400 GeneAmp cycler (Perkin-Elmer Applied Biosystems, Cergy-Pontoise, France) using the primers, templates and assay conditions summarized in Table 2. Site-directed mutagenesis was carried out with the Quick-Change system (Stratagene, La Jolla, CA). All the plasmid constructs were generated using E. coli TOP10 as the intermediate host. The amplified fragments (Table 2) were verified by sequencing with a CEQ 2000 model automate (Beckman Instruments, Inc., Palo Alto, CA) and digested with the appropriate restriction enzymes (Roche Diagnostics GmbH, Mannheim, Germany). Ligation was carried out using the Rapid DNA Ligation kit (Roche).

2

Oligodeoxyribonucleotides and plasmids used for PCR

Primer pair Nucleotide sequence from 5′ to 3′ Template (P) Purpose 
mph1F
mph2R 
cgcggatccgcgaaaggaaattaaaaatgacaattc
acatgcatgcatgttatataactcccaactgagct 
pIP1204 (P1) Cloning of mph(1+2) 
mph1F
mph1R 
cgcggatccgcgaaaggaaattaaaaatgacaattc
acatgcatagatgaaattcaccaatc 
pIP1204 (P1) Cloning of mph1 
mph2F
mph2R 
cgcggatccgcgaaaggaatttcatctacagaattagtggct
acatgcatgcatgttatataactcccaactgagct 
pIP1204 (P1) Cloning of mph2 
RBS1
RBS2 
ccgcgaaaggaatttcatggagggaattagtggcttatccc
gggataagccactaattccctccatgaaattcctttcgcgg 
pAT465 (P2) Introduction of a RBS sequence 
mphF
mphR 
ccgaattcatgactcgacataatg
aagaattctactctttcataccta 
pMS97 (P1) Cloning of the mph(C) gene 
OchF
OchR 
ggttcctgattggtaaatttcatctacag
ctgtagatgaaatttaccaatcaggaacc 
pAT462 (P3) Replacement of opal by ochre 
Primer pair Nucleotide sequence from 5′ to 3′ Template (P) Purpose 
mph1F
mph2R 
cgcggatccgcgaaaggaaattaaaaatgacaattc
acatgcatgcatgttatataactcccaactgagct 
pIP1204 (P1) Cloning of mph(1+2) 
mph1F
mph1R 
cgcggatccgcgaaaggaaattaaaaatgacaattc
acatgcatagatgaaattcaccaatc 
pIP1204 (P1) Cloning of mph1 
mph2F
mph2R 
cgcggatccgcgaaaggaatttcatctacagaattagtggct
acatgcatgcatgttatataactcccaactgagct 
pIP1204 (P1) Cloning of mph2 
RBS1
RBS2 
ccgcgaaaggaatttcatggagggaattagtggcttatccc
gggataagccactaattccctccatgaaattcctttcgcgg 
pAT465 (P2) Introduction of a RBS sequence 
mphF
mphR 
ccgaattcatgactcgacataatg
aagaattctactctttcataccta 
pMS97 (P1) Cloning of the mph(C) gene 
OchF
OchR 
ggttcctgattggtaaatttcatctacag
ctgtagatgaaatttaccaatcaggaacc 
pAT462 (P3) Replacement of opal by ochre 

The sequences underlined correspond to the restriction sites used for cloning and the nucleotides in bold to the mutagenized bases.

Programs of the thermocycler: P1, 1 × (5 min at 94°C–2 min at 48°C) 30 × (50 s at 72°C–40 s at 94°C–40 s at 48°C) 1 × (7 min at 72°C); P2, 1 × (30 s at 95°C) 18 × (30 s at 95°C–1 min at 50°C–10 min at 72°C); P3, 1 × (30 s at 95°C) 12 × (30 s at 95°C–1 min at 55°C–10 min at 72°C).

Susceptibility testing

The minimum inhibition concentration (MIC) of macrolides and ketolides were determined in three independent experiments on Mueller–Hinton agar (BioRad, Marnes-la-Coquette, France) by the E-test method (AB Biodisk, Solna, Sweden) for erythromycin and azithromycin or by serial twofold dilution for spiramycin (Grünenthal GmbH, Aachen, Germany) and telithromycin (Aventis, Romainville, France) according to the recommendations of the CA-SFM (1996). Discs purchased from BioRad were used for routine susceptibility assays.

Enzymatic phosphorylation

Escherichia coli cells from one liter of LB cultures were harvested by centrifugation and treated as described (O'Hara et al., 1988). Briefly, the washed cells were disrupted by sonication, and membranes were pelleted at 30 000 g. The reaction mixture was as follows: 5 mg of erythromycin (Abbot-Laboratories, Rungis, France), 8 mL of the S-30 cell fraction and 2 mL of 80 mM ATP in TMK buffer (0.06 M calcium chloride, 0.01 M magnesium acetate, 0.006 M β-mercaptoethanol and 0.1 M Tris-HCl, pH 7.8). The mixture was incubated overnight at 37°C. The reaction was stopped by boiling, and the denatured proteins were pelleted by centrifugation at 100 000 g for 30 min. The supernatant was treated twice with chloroform, to remove any remaining intact antibiotic, and three times with butanol. The upper phases were pooled, dried and resuspended in 500 µL of distilled water. Ten microliters of the butanol extracts were analysed by thin-layer chromatography.

Results and discussion

A c. 900 bp fragment containing mph1 and mph2 was amplified from pIP1204 DNA with primers mph1F and mph2R (Fig. 1), cut by BamHI and SphI and cloned in pACYC184 previously digested with the same enzymes. When introduced into E. coli AG100A or DB10, the pAT462[mph(1+2)opal] resulting plasmid (Table 1) conferred resistance to erythromycin (MIC=64 µg mL−1). The presence of a suppressor tRNA in different strains being unlikely, the 900 bp fragment was split into two parts, mph1 and mph2, based on the annotation in the database, using primers mph1F and mph1R, and mph2F and mph2R, respectively (Fig. 1). The mph1 fragment was cloned in pUC19, generating pAT464[mph1], and mph2 in pACYC184, generating pAT465[mph2] (Table 1). Neither of these recombinant plasmids conferred resistance to erythromycin in E. coli. As there was no translational start site within mph2, the 5′ portion of the 640 bp insert in pAT465[mph2] was modified by site-directed mutagenesis to generate a GTG start codon six nucleotides downstream from the GGAGG canonical RBS sequence. The pAT466[mph2RBS] resulting plasmid (Table 1) was introduced into E. coli AG100A/pAT464[mph1] to test for trans-complementation. The transformed strain remained susceptible to erythromycin (MIC=4 µg mL−1). An opal codon read-through, as observed for other genes (Mottagui-Tabar, 1998), might therefore occur within plasmid pAT462[mph(1+2)opal]. So far, this has not yet been described for a resistance gene. Synthesis of a functional enzyme was confirmed by phosphorylation of erythromycin evidenced by thin-layer chromatography using crude S30 extracts of AG100A harbouring pTZ3716[mph(B)] (Fig. 2).

1

Analysis of the translational read-through between mph1 and mph2. Annotation and numbering refer to AF550415. The putative RBS sequence of mph1 is underlined. The stop codons are indicated in italics. Relevant deduced amino acids are indicated above the sequence. The primers used for cloning are indicated by convergent arrows. Added restriction sites are symbolized by B for BamHI and S for SphI. The mutagenized bases are in bold face letters: TGA was replaced by TAA and CTACA by GGAGG, giving rise to plasmids pAT463 and pAT466, respectively.

1

Analysis of the translational read-through between mph1 and mph2. Annotation and numbering refer to AF550415. The putative RBS sequence of mph1 is underlined. The stop codons are indicated in italics. Relevant deduced amino acids are indicated above the sequence. The primers used for cloning are indicated by convergent arrows. Added restriction sites are symbolized by B for BamHI and S for SphI. The mutagenized bases are in bold face letters: TGA was replaced by TAA and CTACA by GGAGG, giving rise to plasmids pAT463 and pAT466, respectively.

2

Thin-layer chromatography (silica gel with CH3COOC2H5–CH3-COOH–H2O [60 : 20 : 20] as a solvent mixture) of 20 µg of erythromycin (lane 1) and 10 µL aliquots of butanol extracts of Escherichia coli AG100A harbouring pACYC184 (lane 2), pAT462[mph(1+2)opal] (lane 3) or pTZ3716[mph(B)] (lane 4). ERY, erythromycin; MF, front of solvent migration; SL, spot-line.

2

Thin-layer chromatography (silica gel with CH3COOC2H5–CH3-COOH–H2O [60 : 20 : 20] as a solvent mixture) of 20 µg of erythromycin (lane 1) and 10 µL aliquots of butanol extracts of Escherichia coli AG100A harbouring pACYC184 (lane 2), pAT462[mph(1+2)opal] (lane 3) or pTZ3716[mph(B)] (lane 4). ERY, erythromycin; MF, front of solvent migration; SL, spot-line.

The efficiency of a stop codon, in particular UGA, in promoting translation termination is very sensitive to the context on both sides of the codon (Mottagui-Tabar, 1998). It has been demonstrated that a negatively charged amino acid residue at the penultimate position of the nascent polypeptide, together with an adenine just after an opal codon, can result in up to 25% read-through by the UGG reader tRNATrp. An aspartate residue at position 77 of Mph(1+2), combined with the presence of an adenine at the 3′ end of the opal codon, fulfilled all the requirements for inefficient recognition of the termination signal within the mph(1+2) structure (Fig. 1). Site-directed mutagenesis of pAT462[mph(1+2)opal] using primers OchF and OchR allowed the replacement of the TGA opal by a TAA ochre codon generating plasmid pAT463[mph(1+2)ochre]. This led to a fourfold decrease in erythromycin MIC against AG100A/pAT463[mph(1+2)ochre] and to a 16-fold decrease against DB10/pAT463[mph(1+2)ochre] (MIC=4 µg mL−1). Thus, and as expected (Nilsson & Rydén-Aulin, 2003), the stop codon appeared to be more efficient when opal was replaced by ochre in mph(1+2).

The levels of resistance conferred by mph(A), mph(B), mph(C) and mph(1+2) in E. coli AG100A to various macrolides and ketolides were compared (Table 3). The mph(C) gene, which has been reported to be silent in S. aureus in the absence of msr(A) (Matsuoka et al., 2003), was cloned in the shuttle expression plasmid pIP1840 (Table 2). The pAT461[mph(C)] resulting plasmid (Table 1) conferred resistance to the 14- and 16-membered macrolides and to telithromycin in E. coli (Table 3) but no resistance was detected in S. aureus RN4220, as already observed (Matsuoka et al., 2003). The closely related mph(B) gene conferred the same resistance phenotype as mph(C) in E. coli (Table 3) but is expressed in S. aureus (Noguchi et al., 1998). The mph(1+2) read-through conferred resistance to the 14-membered macrolides and to telithromycin. The mph(A) gene conferred resistance to the 14-, 15- and 16-membered macrolides and to telithromycin. The sequences of the four deduced polypeptides exhibited from 45% to 59.8% similarity in pairwise comparisons. Mph(B) and Mph(C) were the most closely related (48.8% identity) and conferred similar resistance phenotypes (Table 3). Residues known to be important for phosphorylation of macrolides or aminoglycosides were found at the same relative positions in the multiple sequence alignment provided by clustal v (Fig. 3). Except for the second aspartate at position 209 of Mph(B), the other four catalytic aspartates were conserved among the proteins as well as the histidine at position 205 of Mph(B) that is crucial for the activity of the Mph(2′)II enzymes (Taniguchi et al., 1999, 2004). Despite this, it is rather difficult to correlate the sequence-structure traits of these enzymes with their drug specificities.

3

MIC of antibiotics against Escherichia coli AG100A harbouring various plasmids

 MIC (µg mL−1) of 
Plasmid Erythromycin Azithromycin Spiramycin Telithromycin 
pACYC184 
pTZ3519[mph(A)] 512 512 64 128 
pTZ3716[mph(B)] 32 512 64 
pAT461[mph(C)] 128 512 64 
pAT462[mph(1+2)opal64 16 
pAT463[mph(1+2)ochre16 
 MIC (µg mL−1) of 
Plasmid Erythromycin Azithromycin Spiramycin Telithromycin 
pACYC184 
pTZ3519[mph(A)] 512 512 64 128 
pTZ3716[mph(B)] 32 512 64 
pAT461[mph(C)] 128 512 64 
pAT462[mph(1+2)opal64 16 
pAT463[mph(1+2)ochre16 
3

Alignment of the deduced polypeptide sequences. Identical amino acids in at least three sequences are boxed. Residues known to be important for catalysis are indicated by asterisks. The tryptophan due to read-through between mph1 and mph2 is indicated in bold and underlined.

3

Alignment of the deduced polypeptide sequences. Identical amino acids in at least three sequences are boxed. Residues known to be important for catalysis are indicated by asterisks. The tryptophan due to read-through between mph1 and mph2 is indicated in bold and underlined.

In conclusion, all the mph genes, including mph(1+2), conferred resistance to telithromycin while the mph(A) gene appeared to be unique by conferring resistance to azithromycin. Why mph(B) but not mph(C) is functional in S. aureus remains unknown.

Acknowledgements

K.T. was the recipient of an ESCMID grant for training in foreign laboratories. The authors thank M. Matsuoka and K. O'Hara for the gift of plasmids, and D. Cane, E. Dassa, M. Galimand and T. Lambert for helpful discussions.

References

Alonso
A.
Sanchez
P.
Martinez
J.L.
(
2000
)
Stenotrophomonas maltophilia D457R contains a cluster of genes from gram-positive bacteria involved in antibiotic and heavy metal resistance
.
Antimicrob Agents Chemother
 
44
:
1778
1782
.
Biskri
L.
Mazel
D.
(
2003
)
Erythromycin esterase gene ere(A) is located in a functional gene cassette in an unusual class 2 integron
.
Antimicrob Agents Chemother
 
47
:
3326
3331
.
Chesneau
O.
Ligeret
H.
Hosan-Aghaie
N.
Morvan
A.
Dassa
E.
(
2005
)
Molecular analysis of resistance to streptogramin A compounds conferred by the Vga proteins of staphylococci
.
Antimicrob Agents Chemother
 
49
:
973
980
.
Comité de l'Antibiogramme de la Société Française de Microbiologie
(
1996
)
Report: technical recommendations for in vitro susceptibility testing
.
Clin Microbiol Infect
 
2
: (
Suppl 1
):
11
25
.
Davis
K.A.
Crawford
S.A.
Fiebelkorn
K.R.
Jorgensen
J.H.
(
2005
)
Induction of telithromycin resistance by erythromycin in isolates of macrolide-resistant Staphylococcus spp
.
Antimicrob Agents Chemother
 
49
:
3059
3061
.
Datta
N.
Hedges
R.W.
Becker
D.
Davies
J.
(
1974
)
Plasmid-determined fusidic acid resistance in Enterobacteriaceae
.
J Gen Microbiol
 
83
:
191
196
.
Douthwaite
S.
(
2001
)
Structure-activity relationships of ketolides vs. macrolides
.
Clin Microbiol Infect
 
7
: (
Suppl 3
):
11
17
.
Galimand
M.
Sabtcheva
S.
Courvalin
P.
Lambert
T.
(
2005
)
Worldwide disseminated arm(A) aminoglycoside resistance methylase gene is borne by composite transposon Tn1548
.
Antimicrob Agents Chemother
 
49
:
2949
2953
.
Kono
M.
O'Hara
K.
Ebisu
T.
(
1992
)
Purification and characterization of macrolide 2′-phosphotransferase type II from a strain of Escherichia coli highly resistant to macrolide antibiotics
.
FEMS Microbiol Lett
 
97
:
89
94
.
Kreiswirth
B.N.
Lofdahl
S.
Betley
M.J.
O'Reilly
M.
Schlievert
P.M.
Bergdoll
M.S.
Novick
R.P.
(
1983
)
The toxic shock exotoxin structural gene is not detectably transmitted by a prophage
.
Nature
 
346
:
362
365
.
Lüthje
P.
Schwarz
S.
(
2006
)
Antimicrobial resistance of coagulase-negative staphylococci from bovine subclinical mastitis with particular reference to macrolide-lincosamide resistance phenotypes and genotypes
.
J Antimicrob Chemother
 
57
:
966
969
.
Matsuoka
M.
Sasaki
T.
(
2004
)
Inactivation of macrolides by producers and pathogens
.
Curr Drug Targets Infect Disord
 
4
:
217
240
.
Matsuoka
M.
Endou
K.
Kobayashi
H.
Inoue
M.
Nakajima
Y.
(
1998
)
A plasmid that encodes three genes for resistance to macrolide antibiotics in Staphylococcus aureus
.
FEMS Microbiol Lett
 
167
:
221
227
.
Matsuoka
M.
Inoue
M.
Endo
Y.
Nakajima
Y.
(
2003
)
Characteristic expression of three genes, msr(A), mph(C) and erm(Y) that confer resistance to macrolide antibiotics on Staphylococcus aureus
.
FEMS Microbiol Lett
 
220
:
287
293
.
Mottagui-Tabar
S.
(
1998
)
Quantitative analysis of in vivo ribosomal events at UGA and UAG stop codons
.
Nucleic Acids Res
 
26
:
2789
2796
.
Nakamura
A.
Miyakozawa
I.
Nakazawa
K.
O'Hara
K.
Sawai
T.
(
2000
)
Detection and characterization of a macrolide 2′-phosphotransferase from a Pseudomonas aeruginosa clinical isolate
.
Antimicrob Agents Chemother
 
44
:
3241
3242
.
Nilsson
M.
Rydén-Aulin
M.
(
2003
)
Glutamine is incorporated at the nonsense codons UAG and UAA in a suppressor-free Escherichia coli strain
.
Biochim Biophys Acta
 
1627
:
1
6
.
Noguchi
N.
Emura
A.
Matsuyama
H.
O'Hara
K.
Sasatsu
M.
Kono
M.
(
1995
)
Nucleotide sequence and characterization of erythromycin resistance determinant that encodes macrolide 2′-phosphotransferase I in Escherichia coli
.
Antimicrob Agents Chemother
 
39
:
2359
2363
.
Noguchi
N.
Katayama
J.
O'Hara
K.
(
1996
)
Cloning and nucleotide sequence of the mphB gene for macrolide 2′-phosphotransferase II in Escherichia coli
.
FEMS Microbiol Lett
 
144
:
197
202
.
Noguchi
N.
Tamura
Y.
Katayama
J.
Narui
K.
(
1998
)
Expression of the mphB gene for macrolide 2′-phosphotransferase II from Escherichia coli in Staphylococcus aureus
.
FEMS Microbiol Lett
 
159
:
337
342
.
O'Hara
K.
Kanda
T.
Kono
M.
(
1988
)
Structure of a phosphorylated derivative of oleandomycin obtained by reaction of oleandomycin with an extract of an erythromycin-resistant strain of Escherichia coli
.
J Antibiotics
 
41
:
823
827
.
O'Hara
K.
Kanda
T.
Ohmiya
K.
Ebisu
T.
Kono
M.
(
1989
)
Purification and characterization of macrolide 2′-phosphotransferase from a strain of Escherichia coli that is highly resistant to erythromycin
.
Antimicrob Agents Chemother
 
33
:
1354
1357
.
Ojo
K.K.
Ulep
C.
Van Kirk
N.
Luis
H.
Bernardo
M.
Leitao
J.
Roberts
M.C.
(
2004
)
The mef(A) gene predominates among seven macrolide resistance genes identified in gram-negative strains representing 13 genera, isolated from healthy Portuguese children
.
Antimicrob Agents Chemother
 
48
:
3451
3456
.
Okusu
H.
Ma
D.
Nikaido
H.
(
1996
)
AcrAB efflux pump plays a major role in the antibiotic resistance phenotype of Escherichia coli multiple-antibiotic-resistance (Mar) mutants
.
J Bacteriol
 
178
:
306
308
.
Poole
T.L.
Callaway
T.R.
Bishoff
K.M.
Warnes
C.E.
Nisbet
D.J.
(
2006
)
Macrolide inactivation gene cluster mphA-mrx-mphR adjacent to a class 1 integron in Aeromonas hydrophila isolated from a diarrhoeic pig in Oklahoma
.
J Antimicrob Chemother
 
57
:
31
38
.
Roberts
M.C.
Sutcliffe
J.
Courvalin
P.
Jensen
L.B.
Rood
J.
Seppala
H.
(
1999
)
Nomenclature for macrolide and macrolide-lincosamide-streptogramin B resistance determinants
.
Antimicrob Agents Chemother
 
43
:
2823
2830
.
Sambrook
J.
Russell
D.W.
(
2001
)
Molecular Cloning: A Laboratory Manual
 ,
Cold Spring Harbor Laboratory Press
,
Cold Spring Harbor, NY
.
Sangvik
M.
Littauer
P.
Simonsen
G.S.
Sundsfjord
A.
Dahl
K.H.
(
2005
)
mef (A), mef(E) and a new mef allele in macrolide-resistant Streptococcus spp. isolates from Norway
.
J Antimicrob Chemother
 
56
:
841
846
.
Taniguchi
K.
Nakamura
A.
Tsurubuchi
K.
Ishii
A.
O'Hara
K.
Sawai
T.
(
1999
)
Identification of functional amino acids in the macrolide 2′-phosphotransferase II
.
Antimicrob Agents Chemother
 
43
:
2063
2065
.
Taniguchi
K.
Nakamura
A.
Tsurubuchi
K.
O'Hara
K.
Sawai
T.
(
2004
)
The role of histidine residues conserved in the putative ATP-binding region of macrolide 2′-phosphotransferase II
.
FEMS Microbiol Lett
 
232
:
123
126
.

Author notes

Editor: Stefan Schwarz