Abstract

The gene encoding virulence associated protein A (VapA) is clustered with three vapA homologues (vapICD) within the pathogenicity island of the virulence plasmid of Rhodococcus equi. Northern blot analysis showed a vapA transcript of c. 700 nucleotides (nt) suggesting that vapA is a monocistronic transcript. However, using the more sensitive RT-PCR, it was shown that vapA is cotranscribed with the downstream vapICD genes forming a 2.3-kb operon. This initial transcript is subsequently processed to give rise to a 700 nt vapA transcript with a half-life of 7.5 min. In contrast, the vapI, vapC and vapD transcripts have an average half-life of 1.8 min, identical to that of the five cistronic virR operon located upstream of the vapA operon. It is speculated that the need for differential gene expression arises from the different localisation of the Vap proteins. VapA is tethered to the surface of the cell wall, whereas VapC and VapD are secreted, diffusable proteins. The intercistronic region between vapC and vapD harbours two short ORFs (OrfA, OrfB). These ORFs are translationally coupled to vapC and vapD in which the start codon overlaps the stop codon of the preceding gene.

Introduction

The actinomycete Rhodococcus equi is responsible for pyogranulomatous pneumonia in foals, commonly known as rattles (Muscatello et al., 2007). Although foals are the primary host of R. equi, it sporadically infects other animals and immunocompromised humans (Meijer & Prescott, 2004). Rhodococcus equi primarily gains access to its host via inhalation of contaminated dust particles followed by infection of alveolar macrophages (Meijer & Prescott, 2004). Survival and proliferation of R. equi within macrophages is dependent on its ability to prevent maturation and acidification of the phagolysosome, eventually resulting in the necrotic death of the macrophage (Zink et al., 1987; Hondalus & Mosser, 1994; Lührmann et al., 2004; Fernandez-Mora et al., 2005; Toyooka et al., 2005).

Rhodococcus equi harbours a virulence plasmid containing a 27.5-kb pathogenicity island (Takai et al., 2000). A number of the pathogenicity island genes have to date only been identified in R. equi, most notably a family of seven virulence associated protein (vap) genes (Takai et al., 2000; Polidori & Haas, 2006). In addition, the pathogenicity island contains two pseudo-vap genes (Takai et al., 2000; Russell et al., 2004). Foals infected with R. equi invariably have high antibody titres against VapA: a small cell surface associated lipoprotein that is essential, but not sufficient, for virulence and proliferation in macrophages (Takai et al., 1991; Giguère et al., 1999; Jain et al., 2003).

The regulation of VapA expression is dependent on a number of environmental parameters, including temperature, pH and oxidative stress (Takai et al., 1992, 1996; Benoit et al., 2002; Ren & Prescott, 2003). The vapA gene is transcribed from a single promoter, 226-bp upstream of the vapA initiation codon (Russell et al., 2004). The activity of the vapA promoter is dependent on the LysR type transcriptional regulator VirR, which is encoded within a five cistronic operon located upstream of vapA (Russell et al., 2004; Byrne et al., 2007). In addition to VirR, this operon encodes a response regulator that is required for virulence and likely controls transcription of vapA (Ren & Prescott, 2004; Russell et al., 2004).

Three vapA homologues (vapI, vapC, vapD) are located downstream of vapA. (Takai et al., 2000; Byrne et al., 2001). The function of these Vap proteins remains elusive. However, all vapA positive R. equi strains tested to date are also positive for vapC and vapD, suggesting that these play a role in virulence (Byrne et al., 2001). Recent data appear to show that vapA is transcribed as a monocistronic mRNA, despite the fact that it is clustered with three homologues that are transcribed in the same direction (Benoit et al., 2002; Russell et al., 2004). Considering the pivotal role VapA plays in infection, the aim of the current study was to analyse the transcriptional organisation of the vapA cluster in greater detail. The results show that vapA is cotranscribed together with the downstream vapICD genes. However, the vapA transcript is significantly more stable than the downstream vapICD transcript, resulting in accumulation of vapA mRNA.

Materials and methods

Bacterial strains and growth conditions

Rhodococcus equi ATCC33701 and its virulence plasmid cured derivative were grown in Luria–Bertani (LB) broth (Sambrook & Russell, 2001). Growth of R. equi at 37 °C and pH 6.5 (inducing conditions) was used to induce virulence plasmid gene expression, whereas these genes were transcribed at low levels following growth at 30 °C and pH 8.0 (noninducing conditions). For solid media, agar was added to 1.5% (w/v).

DNA manipulations

Chromosomal DNA was isolated as described (Nagy et al., 1995). Plasmid DNA was isolated via the alkaline lysis method of Birnboim and Doly (Birnboim & Doly, 1979) or using the Wizard Plus SV miniprep as described by the manufacturer (Promega). DNA fragments were isolated from agarose gels using the Genelute DNA purification kit as described by the manufacturer (Sigma-Aldrich). PCR was carried out using Taq DNA polymerase (Promega) as described by the manufacturer. Other DNA manipulations were done in accordance with standard protocols (Sambrook & Russell, 2001).

RNA isolation and reverse transcriptase real-time PCR

RNA was isolated from R. equi as described previously (Russell et al., 2004). Reverse transcriptase reactions using random primers (Promega) were performed with 1 U Improm II Reverse Transcriptase following the manufacturer's recommendations with 100 ng of total RNA as template in a final volume of 20 μL. The product was subsequently used in a normal PCR reaction, using 2 μL of the reaction mixture as a template for PCR amplification with Taq DNA polymerase (Promega) as described by the manufacturer. For quantitative PCR, the product was amplified using the QuantiTect SYBR green real-time kit following manufacturer's instructions (Qiagen). Reaction mixtures were subjected to 40 cycles of 95 °C for 15 s, 60 °C for 30 s and 72 °C for 30 s in a LightCycler (Roche) with temperature transition rates of 20 °C s−1. Melting curve analysis was performed at 50–95 °C (temperature transition, 0.2 °C s−1) with stepwise fluorescence detection following amplification. Cycle threshold CT values were obtained and used to calculate the number of RNA copies μg−1 of total RNA using a standard curve of known amounts of DNA target with r2 coefficients larger than 0.997 in the range of 5 × 103–5 × 108 molecules per reaction. gyrB mRNA was used as a housekeeping gene to compare the amount of RNA in each reaction. The data reported in this paper represent the results of three independent experiments in which each sample was analyzed in duplicate. The sequences of oligonucleotides used for real-time PCR are listed in Table 1.

1

Oligonucleotides used in this study

Oligonucleotides Sequence (5′–3′) Purpose References 
16SrRNAF200 ACGAAGCGAGAGTGACGGTA Quantification of 16S rRNA gene Miranda-Casoluengo (2005) 
16SrRNAR200 ACTCAAGTCTGCCCGTATCG Quantification of 16S rRNA gene Miranda-Casoluengo (2005) 
012F CAGTACGACGTTCACGGAGA Quantification of vapA This study 
012R CACGGCGTTGTACTGGAAC Quantification of vapA This study 
013F GTAGCTCTCCCTGCGGGAAT Quantification of vapI This study 
013R GCTCGAAAGCAAAACCGTGT Quantification of vapI This study 
014F GTGGCGAGTGTCCTATGCTT Quantification of vapC This study 
014R CAACGCACTGACAACTACCC Quantification of vapC This study 
015NF CTTTGGGCGTTTATTCACTTT Quantification of vapD This study 
015NR TCGACGGTTACAATGAAATAT Quantification of vapD This study 
Vap1 GCGCATATGACCGTTCTTGATTCCGGT vapA probe Russell (2004) 
Vap2 CGCCTCGAGGGCGTTGTGCCAGCTACC vapA probe Russell (2004) 
Oligonucleotides Sequence (5′–3′) Purpose References 
16SrRNAF200 ACGAAGCGAGAGTGACGGTA Quantification of 16S rRNA gene Miranda-Casoluengo (2005) 
16SrRNAR200 ACTCAAGTCTGCCCGTATCG Quantification of 16S rRNA gene Miranda-Casoluengo (2005) 
012F CAGTACGACGTTCACGGAGA Quantification of vapA This study 
012R CACGGCGTTGTACTGGAAC Quantification of vapA This study 
013F GTAGCTCTCCCTGCGGGAAT Quantification of vapI This study 
013R GCTCGAAAGCAAAACCGTGT Quantification of vapI This study 
014F GTGGCGAGTGTCCTATGCTT Quantification of vapC This study 
014R CAACGCACTGACAACTACCC Quantification of vapC This study 
015NF CTTTGGGCGTTTATTCACTTT Quantification of vapD This study 
015NR TCGACGGTTACAATGAAATAT Quantification of vapD This study 
Vap1 GCGCATATGACCGTTCTTGATTCCGGT vapA probe Russell (2004) 
Vap2 CGCCTCGAGGGCGTTGTGCCAGCTACC vapA probe Russell (2004) 

mRNA half-life determination

RNA was isolated from R. equi in the mid-logarithmic phase of growth (OD600 nm=0.5) at selected intervals following inhibition of transcription by the addition of 200 μg mL−1 rifampicin (Sigma). The number of mRNA copies was determined using reverse transcriptase real-time PCR, followed by linear regression to determine the half-life. The 16S rRNA gene was used for internal normalization in this study.

Northern hybridization

Following electrophoresis in a denaturing formaldehyde gel (Sambrook & Russell, 2001), RNA was transferred to a positively charged membrane according to the manufacturer's instructions (Roche). The vapA probe used in Northern analysis was synthesized using the oligonucleotides Vap1 and Vap2 (Table 1) and Taq DNA polymerase (Promega) in the presence of 0.2 mM of dATP, dCTP and dGTP; 0.13 mM dTTP and 0.07 mM digoxigenin 11-dUTP. The reaction mixture was incubated at 94 °C for 2 min and was subsequently subjected to 30 cycles of 94 °C for 30 s, 50 °C for 45 s, 74 °C for 1 min, followed by an incubation at 74 °C for 7 min. Prehybridization, hybridization and chemiluminescent detection of the labeled probe using Digoxigenin Easy Hyb and CDP-Star (Roche) were done according to the manufacturer's recommendations.

RNA structure prediction

RNA structures were predicted using the Vienna RNA secondary structure server (http://www.tbi.univie.ac.at/~ivo/RNA/) as described (Hofacker, 2003).

Results

VapA is coordinately transcribed with vapICD

The virulence plasmid (accession number AP001204) harbours four homologous vap genes (vapAICD) located between 12546 and 15329 nucleotides (nt) (Takai et al., 2000). Growth at low pH and high growth temperature increases the activity of the vapA promoter in a VirR dependent manner (Russell et al., 2004). To determine the effect of temperature and pH on the transcription of the genes downstream of vapA, R. equi was grown under inducing (pH 5.5, 37 °C) and noninducing (pH 8.0, 30 °C) conditions; mRNA levels for each gene in the vapA cluster was subsequently determined by reverse transcriptase real-time PCR. A fivefold increase of transcript levels was observed for vapA, vapI and vapC, whereas vapD transcription was upregulated threefold when comparing noninducing to inducing growth conditions. (Fig. 1).

1

Regulation of vapA operon gene transcription by temperature and pH. mRNA was isolated from Rhodococcus equi grown at noninducing (30°C, pH 8.0) or inducing (37°C, pH 6.5) growth conditions, followed by absolute quantification of the mRNA molecules using reverse transcription real-time PCR. Transcription levels are indicated for each gene of the vapA operon following growth at noninducing (grey bars) and inducing (black bars) conditions.

1

Regulation of vapA operon gene transcription by temperature and pH. mRNA was isolated from Rhodococcus equi grown at noninducing (30°C, pH 8.0) or inducing (37°C, pH 6.5) growth conditions, followed by absolute quantification of the mRNA molecules using reverse transcription real-time PCR. Transcription levels are indicated for each gene of the vapA operon following growth at noninducing (grey bars) and inducing (black bars) conditions.

vapA is cotranscribed with vapICD

The vapA gene is clustered with three homologous genes located that display the same regulatory pattern (Fig. 2a). It is therefore likely that this vapAICD gene cluster is transcribed as an operon. Initially a Northern blot was carried out using the vapA gene as a homologous probe. The results show that vapA transcription gave rise to a single 700-nt transcript (Fig. 2b). This is sufficiently large to accommodate vapA but not the downstream homologues, indicating that vapA is transcribed as a monocistronic transcript as was concluded previously (Benoit et al., 2002; Russell et al., 2004). However, this does not rule out that vapAICD is transcribed as single message which is subsequently processed. Therefore, RT-PCR was employed, which has a lower detection threshold than Northern blotting. Following reverse transcription of mRNA, the resulting cDNA was subsequently amplified by PCR using primers located within the 5′-end of vapA and the 3′-end of vapD. This yielded a 2269-bp product; an amplicon was not observed when the reverse transcription step was omitted. The data thus showed that vapA is cotranscribed with the downstream vapICD genes (Fig. 2c).

2

Transcriptional organization of the vapA operon located on the virulence plasmid of Rhodococcus equi ATCC33701 (accession number AP001204). (a) Map of the vapA operon indicating the position of the vapAICD genes and OrfA and OrfB. The grey box downstream of vapI indicates the 3′ end of the ancestral vapI gene, which is similar to vapE. The hairpin indicates the position of the RNA structure within the vapA-vapI intergenic region. The arrow above the map indicates the position of oligonucleotides 012F and 015NR used in the RT-PCR experiment. (b) Northern blot of mRNA isolated from R. equi grown on LB medium at 37°C and pH 5.5. The blot was probed with an internal fragment of the vapA gene. The numbers refer to the size of the molecular weight standards in nucleotides × 1000. The arrow indicates the 700 nt RNA molecule hybridizing to the vapA probe. (c) RT-PCR analysis of the transcriptional organization of vapA cluster. The oligonucleotide pair (012F, 015NR) was used in three amplification reactions using genomic DNA, RNA or cDNA as template. Lane 1, R. equi ATCC 33701 genomic DNA; lane 2, RNA without reverse transcriptase reaction; lane 3, cDNA obtained from reverse transcription of RNA; lane 4, 100-bp molecular weight marker, lane 5, Phage λ DNA digested with HindIII. The arrow indicates the 2.3-kb amplicon using either genomic DNA or cDNA as template.

2

Transcriptional organization of the vapA operon located on the virulence plasmid of Rhodococcus equi ATCC33701 (accession number AP001204). (a) Map of the vapA operon indicating the position of the vapAICD genes and OrfA and OrfB. The grey box downstream of vapI indicates the 3′ end of the ancestral vapI gene, which is similar to vapE. The hairpin indicates the position of the RNA structure within the vapA-vapI intergenic region. The arrow above the map indicates the position of oligonucleotides 012F and 015NR used in the RT-PCR experiment. (b) Northern blot of mRNA isolated from R. equi grown on LB medium at 37°C and pH 5.5. The blot was probed with an internal fragment of the vapA gene. The numbers refer to the size of the molecular weight standards in nucleotides × 1000. The arrow indicates the 700 nt RNA molecule hybridizing to the vapA probe. (c) RT-PCR analysis of the transcriptional organization of vapA cluster. The oligonucleotide pair (012F, 015NR) was used in three amplification reactions using genomic DNA, RNA or cDNA as template. Lane 1, R. equi ATCC 33701 genomic DNA; lane 2, RNA without reverse transcriptase reaction; lane 3, cDNA obtained from reverse transcription of RNA; lane 4, 100-bp molecular weight marker, lane 5, Phage λ DNA digested with HindIII. The arrow indicates the 2.3-kb amplicon using either genomic DNA or cDNA as template.

Analysis of the vapAICD operon

The intergenic regions between the vapAICD genes is relatively large (vapA-vapI, 240 bp; vapI-vapC, 371 bp; and vapC-vapD, 340 bp Fig. 2a) and were therefore analyzed to identify a possible function. vapI, originally annotated as orf13, encodes a naturally occurring C-terminal truncated Vap protein, in which the carboxy terminal part is missing as a result of a frame shift mutation and introduction of a stop codon in the original intact Vap coding sequence (Polidori & Haas, 2006). The relatively large spacing between vapI and vapC (371-bp) encodes the C-terminus of the full-length parent vapI gene, which is 92% identical to VapE. The intergenic region between the precursor gene of vapI and vapC is only 16 bp, showing that these two genes were closely linked before the advent of the frameshift mutation.

The large intergenic region in between vapC and vapD harbours two short ORFs encoding peptides of 12 (OrfA, start at 14491 nt) and 47 (OrfB, start at 14526 nt) amino acids. Interestingly, vapC, OrfA and OrfB are translationally coupled, in which the start codons of orfA and orfB overlap the stop codon of the preceding gene (Fig. 2b).

The vapAvapI intergenic region does not contain any obvious ORFs that might be functional. However, it does contain a 14-bp inverted repeat capable of forming a stable hair-pin structure that is part of a larger stable RNA structure (Fig. 3, free energy of −51.62 kcal mol−1) located between 13117–13214 nt. A stretch of thymidines, characteristic for a rho-independent terminator structure, is absent, suggesting that the hairpin is not involved in transcription termination.

3

Predicted RNA structure with free energy of −51.62 kcal mol−1) located in the intercistronic region between vapA and vapI (nucleotides 13117–13214). The 5′ and 3′ ends of the structure are indicated.

3

Predicted RNA structure with free energy of −51.62 kcal mol−1) located in the intercistronic region between vapA and vapI (nucleotides 13117–13214). The 5′ and 3′ ends of the structure are indicated.

The vapA transcript is more stable than that of vapICD

The vapA gene is flanked by a 5′ untranslated region (UTR) of 226 bp (Russell et al., 2004) and a downstream intercistronic region that can be folded into a stable mRNA structure. Both structures may be involved in stabilizing the vapA transcript (Grunberg-Manago, 1999). To analyze the stability of the transcripts arising from the vapAICD cluster, the mRNA half-lives of each gene were determined following inhibition of transcription by addition of rifampicin (Table 2). The half-lives of the vap transcripts fell into three categories: vapI and vapC transcripts were the most unstable, followed by vapD and vapA. The half-lives of the latter were fivefold longer than those of the vapI and vapC transcripts. Growth temperature or pH did not affect the stability of the vapA transcript.

2

Transcript half-lives of genes within the vapA operon

Gene Half-life (min) 
vapA (37°C, pH 5.5) 7.4 
vapA (30°C, pH 8.0) 7.0 
vapI (37°C, pH 5.5) 1.4 
vapC (37°C, pH 5.5) 1.6 
vapD (37°C, pH 5.5) 2.4 
Gene Half-life (min) 
vapA (37°C, pH 5.5) 7.4 
vapA (30°C, pH 8.0) 7.0 
vapI (37°C, pH 5.5) 1.4 
vapC (37°C, pH 5.5) 1.6 
vapD (37°C, pH 5.5) 2.4 

Discussion

The vapA gene of R. equi is a major immunogenic protein, and essential for virulence of R. equi in foals (Meijer & Prescott, 2004). The current model of vapA transcriptional regulation is that transcription occurs from a single promoter 226 bp (reported 69 bp in R. equi 85F) upstream of the vapA initiation codon (Benoit et al., 2002; Russell et al., 2004), in response to temperature, pH, oxidative stress and the concentrations of iron, magnesium and calcium ions (Meijer & Prescott, 2004). In both the R. equi strains ATCC33701 and 85F, vapA mRNA was previously detected as a c. 700-bp transcript, suggesting that it is monocistronic (Benoit et al., 2002; Russell et al., 2004). Using a more sensitive technique, it was shown that vapA is cotranscribed with the downstream located vapA homologues vapICD, and is thus part of a 2.3-kb polycistronic operon. A 2.3-kb transcript harbouring vapA could not be observed using Northern blotting, suggesting that the vast majority of the vapAICD transcripts are processed, leading to the formation of the 700-bp vapA transcript.

The suggestion that the initial 2.3-kb transcript is processed is further supported by the differences in half-lives of the individual vap transcripts within the vapAICD operon. The vapICD transcripts display an average half-life (1.8±0.5 min) that is identical to that of the five-cistronic virR operon of R. equi (1.8±0.5 min), which also harbours the vapA homologue vapH (Byrne et al., 2007). In contrast, the half-life of the vapA transcript is fourfold longer than the average half-life of the other pathogenicity island transcripts characterized to date (present study and Byrne et al., 2007). Although not proven, it seems highly likely that the 226-bp 5′-UTR of vapA and its downstream vapAI intergenic RNA structure are responsible for increasing the stability of the vapA transcript relative to that of vapICD, as this has been shown for a large number of other bacterial systems (Grunberg-Manago, 1999). Interestingly, the 5′-UTR of the unstable virR transcript is only 53 bp (Byrne et al., 2007). An important reason for differential mRNA stability within a polycistronic transcript is to attain differential gene expression. For example, differential mRNA stability of the six cistronic puf operon of Rhodobacter capsulatus allows for different stochiometries of reaction centre complexes and lighharvesting pigments (Heck et al., 2000). In most cases of differential stability of a polycistronic transcript, functionally related but different, nonhomologous proteins are expressed at different levels. In contrast, the vapAICD operon encodes four homologous proteins. A probable explanation for the need for different expression levels of apparently four similar proteins may lie in their cellular localization. VapA is a lipid-modified, surface anchored protein (Takai et al., 1992; Tan et al., 1995), whereas VapC and VapD (but not VapA) are encountered within the culture supernatant (Byrne et al., 2001). Whatever the function of these virulence proteins, the cell appears to require more surface anchored VapA than diffusible VapC and VapD.

The vapCD intergenic region contains two small ORFs, that do not share sequence similarity with other proteins, which is true for most proteins encoded within the pathogenicity island, including the Vap proteins. Genes encoding very small proteins have a variety of functions including signaling in, for example, quorum sensing (Lazazzera et al., 1997), antimicrobial compounds such as lantibiotics (Sahl & Bierbaum, 1998) or transport of solutes. One of the smallest functional genes identified to date is kdpF encoding a peptide of 29 amino acids involved in K+ transport (Gaßel et al., 1999). Because of their small size and often poor similarities to other proteins it is hard to predict whether small ORFs are functional. Considering the translational coupling of OrfA and OrfB to vapC, it appears likely that these small ORFs identified here are functional. However, as is the case with the Vap proteins, their function remains elusive.

Acknowledgements

This work was supported by Science Foundation Ireland under Grant No. 02/IN.1/B203.

References

Benoit
S
Benachour
A
Taouji
S
Auffray
Y
Hartke
A
(
2002
)
H2O2, which causes macrophage-related stress, triggers induction of expression of virulence-associated plasmid determinants in Rhodococcus equi
.
Infect Immun
 
70
:
3768
3776
.
Birnboim
HC
Doly
J
(
1979
)
A rapid alkaline extraction procedure for screening of recombinant plasmid DNA
.
Nucleic Acids Res
 
7
:
1513
1523
.
Byrne
BA
Prescott
JF
Palmer
GH
Takai
S
Nicholson
VM
Alperin
DC
Hines
SA
(
2001
)
Virulence plasmid of Rhodococcus equi contains inducible gene family encoding secreted proteins
.
Infect Immun
 
69
:
650
656
.
Byrne
GA
Russell
DA
Chen
X
Meijer
WG
(
2007
)
Transcriptional regulation of the virR operon of the intracellular pathogen Rhodococcus equi
.
J Bacteriol
 
189
:
5082
5089
.
Fernandez-Mora
E
Polidori
M
Lührmann
A
Schaible
UE
Haas
A
(
2005
)
Maturation of Rhodococcus equi-containing vacuoles is arrested after completion of the early endosome stage
.
Traffic
 
6
:
635
653
.
Gaßel
M
Mollenkamp
T
Puppe
W
Altendorf
K
(
1999
)
The KdpF subunit is part of the K+-translocating Kdp complex of Escherichia coli and is responsible for stabilization of the complex in vitro
.
J Biol Chem
 
274
:
37901
37907
.
Giguère
S
Hondalus
MK
Yager
JA
Darrah
P
Mosser
DM
Prescott
JF
(
1999
)
Role of the 85-kilobase plasmid and plasmid-encoded virulence-associated protein A in intracellular survival and virulence of Rhodococcus equi
.
Infect Immun
 
67
:
3548
3557
.
Grunberg-Manago
M
(
1999
)
Messenger RNA stability and its role in control of gene expression in bacteria and phages
.
Annu Rev Genet
 
33
:
193
227
.
Heck
C
Balzer
A
Fuhrmann
O
Klug
G
(
2000
)
Initial events in the degradation of the polycistronic puf mRNA in Rhodobacter capsulatus and consequences for further processing steps
.
Mol Microbiol
 
35
:
90
100
.
Hofacker
IL
(
2003
)
Vienna RNA secondary structure server
.
Nucleic Acids Res
 
31
:
3429
3431
.
Hondalus
MK
Mosser
DM
(
1994
)
Survival and replication of Rhodococcus equi in macrophages
.
Infect Immun
 
62
:
4167
4175
.
Jain
S
Bloom
BR
Hondalus
MK
(
2003
)
Deletion of vapA encoding virulence associated protein A attenuates the intracellular actinomycete Rhodococcus equi
.
Mol Microbiol
 
50
:
115
128
.
Lazazzera
BA
Solomon
JM
Grossman
AD
(
1997
)
An exported peptide functions intracellularly to contribute to cell density signaling in B. subtilis
.
Cell
 
89
:
917
925
.
Lührmann
A
Mauder
N
Sydor
T
Fernandez-Mora
E
Schulze-Luehrmann
J
Takai
S
Haas
A
(
2004
)
Necrotic death of Rhodococcus equi-infected macrophages is regulated by virulence-associated plasmids
.
Infect Immun
 
72
:
853
862
.
Meijer
WG
Prescott
JF
(
2004
)
Rhodococcus equi
.
Vet Res
 
35
:
383
396
.
Miranda-Casoluengo
R
Duffy
PS
O'Connell
EP
Graham
BJ
Mangan
MW
Prescott
JF
Meijer
WG
(
2005
)
The iron-regulated iupABC operon is required for saprophytic growth of the intracellular pathogen Rhodococcus equi at low iron concentrations
.
J Bacteriol
 
187
:
3438
3444
.
Muscatello
G
Leadon
DP
Klay
M
Ocampo-Sosa
A
Lewis
DA
Fogarty
U
Buckley
T
Gilkerson
JR
Meijer
WG
Vazquez-Boland
JA
(
2007
)
Rhodococcus equi infection in foals
:
the science of ‘rattles’
 . Equine Vet J
39
:
470
478
.
Nagy
I
Schoofs
G
Compernolle
F
Proost
P
Vanderleyden
J
De Mot
R
(
1995
)
Degradation of the thiocarbamate herbicide EPTC (S-ethyl dipropylcarbamothioate) and biosafening by Rhodococcus sp. strain NI86/21 involve an inducible cytochrome P-450 system and aldehyde dehydrogenase
.
J Bacteriol
 
177
:
676
687
.
Polidori
M
Haas
A
(
2006
)
VapI, a new member of the Rhodococcus equi Vap family
.
Antonie van Leeuwenhoek
 
90
:
299
304
.
Ren
J
Prescott
JF
(
2003
)
Analysis of virulence plasmid gene expression of intra-macrophage and in vitro grown Rhodococcus equi ATCC 33701
.
Vet Microbiol
 
94
:
167
182
.
Ren
J
Prescott
JF
(
2004
)
The effect of mutation on Rhodococcus equi virulence plasmid gene expression and mouse virulence
.
Vet Microbiol
 
103
:
219
230
.
Russell
DA
Byrne
GA
O'Connell
EP
Boland
CA
Meijer
WG
(
2004
)
The LysR-Type transcriptional regulator VirR is required for expression of the virulence gene vapA of Rhodococcus equi ATCC 33701
.
J Bacteriol
 
186
:
5576
5584
.
Sahl
HG
Bierbaum
G
(
1998
)
Lantibiotics
:
biosynthesis and biological activities of uniquely modified peptides from gram-positive bacteria
 . Annu Rev Microbiol
52
:
41
79
.
Sambrook
J
Russell
DW
(
2001
)
Molecular Cloning: A Laboratory Manual
 .
Cold Spring Harbor Laboratory Press
, Cold Spring Harbor, NY.
Takai
S
Sekizaki
T
Ozawa
T
Sugawara
T
Watanabe
Y
Tsubaki
S
(
1991
)
Association between a large plasmid and 15- to 17-kilodalton antigens in virulent Rhodococcus equi
.
Infect Immun
 
59
:
4056
4060
.
Takai
S
Iie
M
Watanabe
Y
Tsubaki
S
Sekizaki
T
(
1992
)
Virulence-associated 15- to 17-kilodalton antigens in Rhodococcus equi
:
temperature-dependent expression and location of the antigens
 . Infect Immun
60
:
2995
2997
.
Takai
S
Fukunaga
N
Kamisawa
K
Imai
Y
Sasaki
Y
Tsubaki
S
(
1996
)
Expression of virulence-associated antigens of Rhodococcus equi is regulated by temperature and pH
.
Microbiol Immunol
 
40
:
591
594
.
Takai
S
Hines
SA
Sekizaki
T
et al. (
2000
)
DNA sequence and comparison of virulence plasmids from Rhodococcus equi ATCC 33701 and 103
.
Infect Immun
 
68
:
6840
6847
.
Tan
C
Prescott
JF
Patterson
MC
Nicholson
VM
(
1995
)
Molecular characterization of a lipid-modified virulence-associated protein of Rhodococcus equi and its potential in protective immunity
.
Can J Vet Res
 
59
:
51
59
.
Toyooka
K
Takai
S
Kirikae
T
(
2005
)
Rhodococcus equi can survive a phagolysosomal environment in macrophages by suppressing acidification of the phagolysosome
.
J Med Microbiol
 
54
:
1007
1015
.
Zink
MC
Yager
JA
Prescott
JF
Fernando
MA
(
1987
)
Electron microscopic investigation of intracellular events after ingestion of Rhodococcus equi by foal alveolar macrophages
.
Vet Microbiol
 
14
:
295
305
.
Editor: Mark Enright

Author notes

Present addresses: Gavin A. Byrne, Trinity Biotech Plc, One Southern Cross, IDA Business Park, Bray, Co Wicklow, Ireland. Clara A. Boland, Forensic Science Laboratory, Department of Justice Equality and Law Reform, Garda Headquarters, Phoenix Park, Dublin 8, Ireland. Enda P. O'Connell, National Centre for Biomedical Engineering Science, National University of Ireland Galway, Ireland.