-
PDF
- Split View
-
Views
-
Cite
Cite
Maria Smorawinska, Magdalena Szuplewska, Piotr Zaleski, Paweł Wawrzyniak, Anna Maj, Andrzej Plucienniczak, Dariusz Bartosik, Mobilizable narrow host range plasmids as natural suicide vectors enabling horizontal gene transfer among distantly related bacterial species, FEMS Microbiology Letters, Volume 326, Issue 1, January 2012, Pages 76–82, https://doi.org/10.1111/j.1574-6968.2011.02432.x
Close - Share Icon Share
Abstract
Klebsiella pneumoniae 287-w carries three small narrow host range (NHR) plasmids (pIGMS31, pIGMS32, and pIGRK), which could be maintained in several closely related species of Gammaproteobacteria, but not in Alphaproteobacteria. The plasmids contain different mobilization systems (MOB), whose activity in Escherichia coli was demonstrated in the presence of the helper transfer system originating from plasmid RK2. The MOBs of pIGMS31 and pIGMS32 are highly conserved in many bacterial plasmids (members of the MOB family), while the predicted MOB of pIGRK has a unique structure, encoding a protein similar to phage-related integrases. The MOBs of pIGMS31 and pIGMS32 enabled the transfer of heterologous replicons from E. coli into both gammaproteobacterial and alphaproteobacterial hosts, which suggests that these NHR plasmids contain broad host range MOB systems. Such plasmids therefore represent efficient carrier molecules, which may act as natural suicide vectors promoting the spread of diverse genetic information (including other types of mobile elements, e.g. resistance transposons) among evolutionarily distinct bacterial species. Thus, mobilizable NHR plasmids may play a much more important role in horizontal gene transfer than previously thought.
Introduction
Plasmids are major vehicles of horizontal gene transfer (HGT) among diverse bacterial populations. Besides replication, stabilization, and transfer functions, these replicons often carry an additional genetic load that may allow the recipient strain to adapt to changeable environmental conditions (Toussaint & Merlin, 2002). They are also convenient targets for the transposition of various transposable elements (TEs; including resistance or metabolic transposons), which can be ‘picked up’ from chromosomes and other co-residing replicons and disseminated by plasmids in HGT. It is thought that broad host range (BHR) promiscuous plasmids, which can be maintained in a wide range of bacterial hosts, play a predominant role in HGT (Christopher et al., 1989). However, the majority of the plasmids identified so far are narrow host range (NHR) replicons, whose role in HGT seems to be limited to closely related species.
Many plasmids are capable of conjugation, which is a very efficient and safe (restriction-free) way of delivering foreign DNA into recipient cells. This phenomenon is one of the major mechanisms of HGT (Llosa & de la Cruz, 2005). According to their transfer ability, conjugative plasmids may be grouped into two categories comprising self-transmissible or mobilizable replicons. The self-transmissible plasmids contain two DNA regions: (1) MOB, which carries genetic information essential for the processing of conjugative DNA, and (2) mating pair formation (MPF), encoding a membrane-associated complex, which is a type 4 secretion system that forms the mating channel (Smillie et al., 2010). Mobilizable plasmids carry only the MOB module, and their transfer requires an MPF provided by another genetic element co-residing in the cell, that is, a self-transmissible plasmid or integrative and conjugative element, ICE (Smillie et al., 2010). MOB systems are highly conserved and widespread among plasmids (including small cryptic types) commonly found in bacterial isolates (e.g. Bartosik et al., 2002).
In this study, we analyzed three small cryptic NHR plasmids (pIGMS31, pIGMS32, and pIGRK) of a pathogenic strain of Klebsiella pneumoniae. The analyses revealed that the plasmids contain different MOB modules, which function in a wide range of hosts. This strongly suggests that NHR mobilizable plasmids (similarly as BHR replicons) may play a very important role in the dissemination of genetic information in HGT.
Materials and methods
Bacterial strains, plasmids, and growth conditions
Klebsiella pneumoniae 287-w (isolated from the throat of an infant hospitalized in The Children's Memorial Health Institute in Warsaw) was the host strain of the plasmids pIGMS31, pIGMS32, and pIGRK. The following Escherichia coli strains were employed: (1) DH5α, in plasmid construction (Hanahan, 1983); (2) DH5αR (rifampicin resistant), as a recipient in bi-parental mating (Bartosik et al. 2002); (3) NM522, as a host for plasmids in in vitro transposition (Stratagene); (4) S17-1, as a donor in bi-parental mating (Simon et al., 1983); and (5) TG1, in plasmid construction. The following rifampicin- or streptomycin-resistant strains were used in the host range analysis: (1) Agrobacterium tumefaciens LBA1010 (Rifr; Koekman et al., 1982); (2) Brevundimonas sp. LM18R (Rifr); (3) Paracoccus aminovorans JCM 7685 (Rifr); and (4) Rhizobium etli CE3 (Strr; Noel et al., 1984) – all members of the Alphaproteobacteria; as well as (4) Serratia sp. OS9 (Gammaproteobacteria; Drewniak et al., 2008, 2010). Bacteria were grown in lysogeny broth (LB) medium (Sambrook & Russell, 2001) or TY medium (R. etli) (Beringer, 1974) at 37 °C (E. coli) or 30 °C (other strains). When necessary, the medium was supplemented with antibiotics at the following concentrations: ampicillin – 100 μg mL−1; kanamycin – 50 μg mL−1; rifampicin – 50 μg mL−1; streptomycin – 50 μg mL−1 (E. coli S17-1) or 100 μg mL−1 (R. etli CE3); and tetracycline – 20 μg mL−1. The plasmids used in this study are listed in Table 0001.
Plasmids and oligonucleotide primers used in this study
| Plasmid or primer | Description or sequence (5′-3′) | Source or reference |
| Plasmid | ||
| pDIY312T | Apr; Tcr; oriV ColE1; source of a DIY genetic cassette containing replication system of plasmid pAMI3 of P. aminophilus JCM 7686 – specific for Alphaproteobacteria | Dziewit et al. (2011) |
| pBGS18 | Kmr; oriV pMB1; cloning vector | Spratt et al. (1986) |
| pBGS18/3oriT | pBGS18 carrying a DNA fragment of pIGRK (positions 806–1261) containing putative oriT (amplified by PCR with primers INT5 and INT6) | This study |
| pIGMS31 | Natural plasmid of K. pneumoniae 287-w | This study |
| pIGMS31KAN | Kmr; pIGMS31 containing inserted transposon EZ::TN <KAN-2> | This study |
| pIGMS32 | Natural plasmid of K. pneumoniae 287-w | This study |
| pIGMS32KAN | Kmr; pIGMS32 containing inserted transposon EZ::TN <KAN-2> | This study |
| pIGRK | Natural plasmid of K. pneumoniae 287-w | This study |
| pIGRKKAN | Kmr; pIGRK containing inserted transposon EZ::TN <KAN-2> | This study |
| pIGRKKAN-NdeI | pIGRKKAN containing 4-bp not-in-frame mutation within NdeI site (ORF2) | This study |
| pMAO1 | Apr; Kmr; oriV RA3; MCS; lacZ’; cloning vector | This study |
| pMAO-MS | pMAO1 carrying MOBpIGMS31 (amplified by PCR with primers PMSG and PMS2D) | This study |
| pMAO-RK | pMAO1 carrying MOBpIGRK (amplified by PCR with primers RK2G and RK2D) | This study |
| pMS32-DIY | pIGMS32KAN carrying a DIY cassette derived from plasmid pDIY312T | This study |
| pRK415 | Tcr; oriV RK2; oriT RK2 | Keen et al. (1988) |
| pWSK29 | Apr; oriV pSC101; cloning vector | Wang & Kushner (1991) |
| pWSK-int | pWSK29 carrying MOBpIGRK | This study |
| Primer | ||
| INT5 | GAAATCTCGAAAGAATGGAAGGAAAAG | This study |
| INT6 | GAATTACCCATATTGATTTTTCCTCA | This study |
| PMSG | gaggagaattcAACCCAACGGGAAATTTTTCACTG | This study |
| PMS2D | aaaaatctagaGCTTCGCTTGGTCAACCCTTC | This study |
| RK2G | gaggagaattcGCGAAGGCCATAAAATTGCCA | This study |
| RK2D | aaaaatctagaACCATCCAGTTACCCGTTCC | This study |
| Plasmid or primer | Description or sequence (5′-3′) | Source or reference |
| Plasmid | ||
| pDIY312T | Apr; Tcr; oriV ColE1; source of a DIY genetic cassette containing replication system of plasmid pAMI3 of P. aminophilus JCM 7686 – specific for Alphaproteobacteria | Dziewit et al. (2011) |
| pBGS18 | Kmr; oriV pMB1; cloning vector | Spratt et al. (1986) |
| pBGS18/3oriT | pBGS18 carrying a DNA fragment of pIGRK (positions 806–1261) containing putative oriT (amplified by PCR with primers INT5 and INT6) | This study |
| pIGMS31 | Natural plasmid of K. pneumoniae 287-w | This study |
| pIGMS31KAN | Kmr; pIGMS31 containing inserted transposon EZ::TN <KAN-2> | This study |
| pIGMS32 | Natural plasmid of K. pneumoniae 287-w | This study |
| pIGMS32KAN | Kmr; pIGMS32 containing inserted transposon EZ::TN <KAN-2> | This study |
| pIGRK | Natural plasmid of K. pneumoniae 287-w | This study |
| pIGRKKAN | Kmr; pIGRK containing inserted transposon EZ::TN <KAN-2> | This study |
| pIGRKKAN-NdeI | pIGRKKAN containing 4-bp not-in-frame mutation within NdeI site (ORF2) | This study |
| pMAO1 | Apr; Kmr; oriV RA3; MCS; lacZ’; cloning vector | This study |
| pMAO-MS | pMAO1 carrying MOBpIGMS31 (amplified by PCR with primers PMSG and PMS2D) | This study |
| pMAO-RK | pMAO1 carrying MOBpIGRK (amplified by PCR with primers RK2G and RK2D) | This study |
| pMS32-DIY | pIGMS32KAN carrying a DIY cassette derived from plasmid pDIY312T | This study |
| pRK415 | Tcr; oriV RK2; oriT RK2 | Keen et al. (1988) |
| pWSK29 | Apr; oriV pSC101; cloning vector | Wang & Kushner (1991) |
| pWSK-int | pWSK29 carrying MOBpIGRK | This study |
| Primer | ||
| INT5 | GAAATCTCGAAAGAATGGAAGGAAAAG | This study |
| INT6 | GAATTACCCATATTGATTTTTCCTCA | This study |
| PMSG | gaggagaattcAACCCAACGGGAAATTTTTCACTG | This study |
| PMS2D | aaaaatctagaGCTTCGCTTGGTCAACCCTTC | This study |
| RK2G | gaggagaattcGCGAAGGCCATAAAATTGCCA | This study |
| RK2D | aaaaatctagaACCATCCAGTTACCCGTTCC | This study |
Nucleotides not complementary to the pIGMS31 and pIGRK sequence are shown in lowercase letters.
Plasmids and oligonucleotide primers used in this study
| Plasmid or primer | Description or sequence (5′-3′) | Source or reference |
| Plasmid | ||
| pDIY312T | Apr; Tcr; oriV ColE1; source of a DIY genetic cassette containing replication system of plasmid pAMI3 of P. aminophilus JCM 7686 – specific for Alphaproteobacteria | Dziewit et al. (2011) |
| pBGS18 | Kmr; oriV pMB1; cloning vector | Spratt et al. (1986) |
| pBGS18/3oriT | pBGS18 carrying a DNA fragment of pIGRK (positions 806–1261) containing putative oriT (amplified by PCR with primers INT5 and INT6) | This study |
| pIGMS31 | Natural plasmid of K. pneumoniae 287-w | This study |
| pIGMS31KAN | Kmr; pIGMS31 containing inserted transposon EZ::TN <KAN-2> | This study |
| pIGMS32 | Natural plasmid of K. pneumoniae 287-w | This study |
| pIGMS32KAN | Kmr; pIGMS32 containing inserted transposon EZ::TN <KAN-2> | This study |
| pIGRK | Natural plasmid of K. pneumoniae 287-w | This study |
| pIGRKKAN | Kmr; pIGRK containing inserted transposon EZ::TN <KAN-2> | This study |
| pIGRKKAN-NdeI | pIGRKKAN containing 4-bp not-in-frame mutation within NdeI site (ORF2) | This study |
| pMAO1 | Apr; Kmr; oriV RA3; MCS; lacZ’; cloning vector | This study |
| pMAO-MS | pMAO1 carrying MOBpIGMS31 (amplified by PCR with primers PMSG and PMS2D) | This study |
| pMAO-RK | pMAO1 carrying MOBpIGRK (amplified by PCR with primers RK2G and RK2D) | This study |
| pMS32-DIY | pIGMS32KAN carrying a DIY cassette derived from plasmid pDIY312T | This study |
| pRK415 | Tcr; oriV RK2; oriT RK2 | Keen et al. (1988) |
| pWSK29 | Apr; oriV pSC101; cloning vector | Wang & Kushner (1991) |
| pWSK-int | pWSK29 carrying MOBpIGRK | This study |
| Primer | ||
| INT5 | GAAATCTCGAAAGAATGGAAGGAAAAG | This study |
| INT6 | GAATTACCCATATTGATTTTTCCTCA | This study |
| PMSG | gaggagaattcAACCCAACGGGAAATTTTTCACTG | This study |
| PMS2D | aaaaatctagaGCTTCGCTTGGTCAACCCTTC | This study |
| RK2G | gaggagaattcGCGAAGGCCATAAAATTGCCA | This study |
| RK2D | aaaaatctagaACCATCCAGTTACCCGTTCC | This study |
| Plasmid or primer | Description or sequence (5′-3′) | Source or reference |
| Plasmid | ||
| pDIY312T | Apr; Tcr; oriV ColE1; source of a DIY genetic cassette containing replication system of plasmid pAMI3 of P. aminophilus JCM 7686 – specific for Alphaproteobacteria | Dziewit et al. (2011) |
| pBGS18 | Kmr; oriV pMB1; cloning vector | Spratt et al. (1986) |
| pBGS18/3oriT | pBGS18 carrying a DNA fragment of pIGRK (positions 806–1261) containing putative oriT (amplified by PCR with primers INT5 and INT6) | This study |
| pIGMS31 | Natural plasmid of K. pneumoniae 287-w | This study |
| pIGMS31KAN | Kmr; pIGMS31 containing inserted transposon EZ::TN <KAN-2> | This study |
| pIGMS32 | Natural plasmid of K. pneumoniae 287-w | This study |
| pIGMS32KAN | Kmr; pIGMS32 containing inserted transposon EZ::TN <KAN-2> | This study |
| pIGRK | Natural plasmid of K. pneumoniae 287-w | This study |
| pIGRKKAN | Kmr; pIGRK containing inserted transposon EZ::TN <KAN-2> | This study |
| pIGRKKAN-NdeI | pIGRKKAN containing 4-bp not-in-frame mutation within NdeI site (ORF2) | This study |
| pMAO1 | Apr; Kmr; oriV RA3; MCS; lacZ’; cloning vector | This study |
| pMAO-MS | pMAO1 carrying MOBpIGMS31 (amplified by PCR with primers PMSG and PMS2D) | This study |
| pMAO-RK | pMAO1 carrying MOBpIGRK (amplified by PCR with primers RK2G and RK2D) | This study |
| pMS32-DIY | pIGMS32KAN carrying a DIY cassette derived from plasmid pDIY312T | This study |
| pRK415 | Tcr; oriV RK2; oriT RK2 | Keen et al. (1988) |
| pWSK29 | Apr; oriV pSC101; cloning vector | Wang & Kushner (1991) |
| pWSK-int | pWSK29 carrying MOBpIGRK | This study |
| Primer | ||
| INT5 | GAAATCTCGAAAGAATGGAAGGAAAAG | This study |
| INT6 | GAATTACCCATATTGATTTTTCCTCA | This study |
| PMSG | gaggagaattcAACCCAACGGGAAATTTTTCACTG | This study |
| PMS2D | aaaaatctagaGCTTCGCTTGGTCAACCCTTC | This study |
| RK2G | gaggagaattcGCGAAGGCCATAAAATTGCCA | This study |
| RK2D | aaaaatctagaACCATCCAGTTACCCGTTCC | This study |
Nucleotides not complementary to the pIGMS31 and pIGRK sequence are shown in lowercase letters.
DNA manipulations and plasmid construction
For plasmid construction, common DNA manipulation methods and electrophoresis techniques were performed as described by Sambrook & Russell (2001).
In vitro transposition
DNA of pIGMS31, pIGMS32, and pIGRK, prepared using a silica–guanidinium thiocyanate DNA isolation method (Boom et al., 1999), was subjected to in vitro transposition with transposon EZ::TN <KAN-2>, bearing a kanamycin resistance cassette, according to the manufacturer's instructions (EZ::TN™ <KAN-2> Insertion kit; Epicentre Biotechnologies).
PCR amplification
Relevant DNA regions were amplified by PCR using appropriate template DNAs, specific oligonucleotide primers, dNTPs and Pfu polymerase (Qiagen, with supplied buffer) in a Mastercycler (Eppendorf). The primers used are listed in Table 0001. Amplified DNA fragments were separated by 0.8% agarose gel electrophoresis, purified using the Gel Out kit (A&A Biotechnology), and cloned into appropriate plasmid vectors.
DNA sequencing and bioinformatic sequence analyses
The nucleotide sequences of pIGMS31, pIGMS32, and pIGRK were determined in the DNA Sequencing and Oligonucleotide Synthesis Laboratory at the Institute of Biochemistry and Biophysics of the Polish Academy of Sciences, using a dye terminator sequencing kit and an automated sequencer (ABI 377 Perkin Elmer). The obtained nucleotide sequences were assembled using the program Sequencher 4.1.4 (Gene Codes Corporation, AnnArbor, MI) and were further analyzed using the VectorNTI 8 software package (Invitrogen, Frederick, MD) and Artemis (Rutherford et al., 2000). Similarity searches were performed using the blast programs (Altschul et al., 1997) available at the NCBI (http://blast.ncbi.nlm.nih.gov/Blast.cgi).
Bacterial mating procedure
The mating procedure (between E. coli strains) was performed in liquid medium using E. coli S17-1 carrying a mobilizable kanamycin-resistant plasmid (as the donor strain) and rifampicin-resistant E. coli DH5αR (as the recipient). The mating mixture was incubated for 2 h at 37 °C (without agitation). The cell suspension was then diluted, and 100 μL of appropriate dilutions was plated on selective media containing rifampicin and kanamycin to select for transconjugants. The inter-species matings were carried on solid media as previously described (Dziewit et al., 2007). Spontaneous resistance of the recipient strains to the antibiotics used in selection was not observed under these experimental conditions.
The plasmid content of transconjugants was verified by screening several colonies using a rapid alkaline extraction procedure and agarose gel electrophoresis. All matings were repeated at least three times.
Nucleotide sequence accession numbers
The nucleotide sequences of pIGMS31, pIGMS32, and pIGRK have been annotated and deposited in the GenBank database under accession numbers AY543072, DQ298019, and AY543071, respectively.
Results
DNA sequence analysis of plasmids of the K. pneumoniae strain 287-w
The initial screening of plasmids carried by K. pneumoniae strain 287-w, performed using a classical alkaline lysis procedure, revealed the presence of two replicons, designated pIGMS31 (c. 2.5 kb) and pIGMS32 (c. 9 kb). Restriction analysis of isolated plasmid DNA suggested the presence of an additional replicon (designated pIGRK) of a similar size to pIGMS31. To separate these plasmids and to transfer them to a nonpathogenic host, in vitro transposition was performed with transposon EZ::TN <KAN-2>, bearing a kanamycin resistance gene. This resulted in the selection of three recombinant plasmids in E. coli NM522: pIGMS31KAN, pIGMS32KAN, and pIGRKKAN (Table 0001). Purified DNA of these plasmids served as the templates for DNA sequencing reactions. The position of the transposon insertion site in the individual plasmids is shown in Fig. 0001.
Genetic organization of plasmids pIGMS31 (a), pIGRK (b), and pIGMS32 (c) of Klebsiella pneumoniae 287-w. A comparison of the genetic structure of pIGMS32 with closely related plasmid 15S of K. pneumoniae S15 (accession no. FJ223606) is presented in panel c. Predicted coding regions are denoted by arrows indicating the direction of transcription (genes involved in replication and mobilization for conjugal transfer are shown as gray and black arrows, respectively). Putative genetic modules distinguished by in silico sequence analysis are shown as black blocks (REP, replication system; MOB, mobilization system; TA, toxin–antitoxin plasmid stabilization system). The locations of the predicted oriT, dso, and sso are indicated by white circles. The GC profiles of plasmids pIGMS31 and pIGRK (shown in panels a and b) were determined using Artemis software.
The full nucleotide sequences of plasmids pIGMS31 (2520 bp), pIGRK (2348 bp), and pIGMS32 (9294 bp) were determined. Interestingly, the plasmids pIGMS31 and pIGRK were found to have a very low GC content (32.7% and 33.4%, respectively; Fig. 0001), well below that of pIGMS32 (55.2%) or the total DNA of K. pneumoniae (57%; Fouts et al., 2008; Wu et al., 2009), which suggested the relatively recent acquisition of these replicons by HGT.
Detailed sequence analysis identified a number of putative functional genetic modules in the plasmids: (1) a replication system (REP; in pIGRK, pIGMS31), (2) a system for mobilization for conjugal transfer (MOB; in pIGMS31, pIGMS32), (3) a toxin–antitoxin system (TA) encoding a ParE family toxin (in pIGMS32; Jiang et al., 2002), and (4) a phenotypic module responsible for bacteriocin (cloacin) production (in pIGMS32; Fig. 0001).
Comparative sequence analysis (NCBI database) revealed that pIGMS32 is identical to a recently reported plasmid pCKO3 from Citrobacter koseri ATCC BAA-895 (accession no. CP000823). Moreover, it shows significant similarity to other ColE1-like plasmids, such as CloDF13 (Nijkamp et al., 1986), and to a much larger plasmid 15S (23.7 kb) from K. pneumoniae strain 15 (Gootz et al., 2009; Fig. 0001c). The core region of 15S is 100% identical to pIGMS32, but the structure of this plasmid has been affected by insertions and deletions generated by two transposons containing antibiotic resistance genes (Fig. 0001c). This analysis also identified plasmids related to pIGMS31 and pIGRK, containing homologous REP or MOB systems (Fig. 0001a and b), which indicated recombinational shuffling of the plasmid-encoded genetic modules.
Characterization of the REP modules
Comparative sequence analysis revealed that plasmids pIGMS31 and pIGRK carry related replication systems. Their predicted replication initiation proteins (ReppIGMS31 and ReppIGRK) exhibit 35% identity at the amino acid sequence level. ReppIGMS31 also shows local similarities (c. 45% identity) to Rep proteins encoded by plasmids residing in Pectobacterium atrosepticum, Salmonella enterica, and E. coli (all Gammaproteobacteria), while ReppIGRK is most similar (58% identity) to a replication protein of pHW126 from Rahnella genomospecies 3 (strain WMR126; Rozhon et al., 2010).
Several direct and inverted repeat sequences were identified upstream of the predicted rep genes of pIGMS31 and pIGRK, and their arrangement and location strongly resemble double-stranded origins of replication (dso) of rolling circle replicating plasmids (Khan, 2000). In addition, upstream of the putative dso in pIGMS31 and downstream of the pIGRK rep gene, inverted repeats containing CS-6 [5′-TAGCG(A/T)-3′] sequences, which are characteristic of the ssoA-type single-stranded origin of replication found in pMV158-type plasmids (Lorenzo-Diaz & Espinosa, 2009), were identified. The presence of the aforementioned sequences strongly suggested that pIGMS31 and pIGRK replicate via a rolling circle mechanism. The location of the predicted origins is shown in Fig. 0001.
In contrast, no Rep protein coding sequences were identified in plasmid pIGMS32. Its similarity to ColE1-type plasmids indicated that replication initiation of this replicon is tightly controlled by an antisense RNA mechanism. This notion is supported by the presence of an open reading frame (ORF), coding for a putative protein homologous to the Rop proteins (modulator proteins of transcript RNAI) (Fig. 0001c), which are typical components of ColE1-type replication systems.
Characterization of the MOB modules
According to bioinformatic predictions, pIGMS31 and pIGMS32 are mobilizable plasmids. The MOBpIGMS31 region encodes a single ORF (Fig. 0001a) with significant similarity to proteins of the Mob_Pre family, which comprises enzymes involved in conjugative mobilization (Marchler-Bauer & Bryant, 2004; Marchler-Bauer et al., 2009). A putative oriT was identified within the promoter region of mobpIGMS31, whose sequence is highly conserved in many related MOB systems. MOBpIGMS32 has a more complex structure and encodes two putative proteins that are highly similar to the MobB and MobC proteins of the well-characterized MOB module of plasmid CloDF13 (Nunez & de la Cruz, 2001; Fig. 0001c). The presumed oriT of the MOBpIGMS32 was identified by sequence similarities upstream of the mobB gene (Fig. 0001c).
Tests were performed to determine whether pIGMS31 and pIGMS32 could be mobilized for conjugal transfer in the presence of a helper transfer system originating from the BHR plasmid RK2. Plasmid pIGRK was also tested in an analogous manner, initially as a negative control in the mating procedure because in silico analysis indicated that it lacks a MOB module. For this experiment, Kmr derivatives of the plasmids (pIGMS31KAN, pIGMS32KAN, and pIGRKKAN) containing the transposon EZ::TN <KAN-2> were used. As expected, the MOB-containing plasmids pIGMS31KAN and pIGMS32KAN could be efficiently transferred between E. coli strains (from the S17-1 donor strain, containing a helper transfer system inserted into the chromosome). Surprisingly, conjugal transfer of pIGRKKAN (Table 0002) was also observed, which goes against the bioinformatic predictions.
Frequency of mobilization for conjugal transfer between various Escherichia coli strains of derivatives of Klebsiella pneumoniae 287-w plasmids in the presence of the RK2 helper transfer system
Results are the means of at least three mating experiments.
Control plasmid (contains oriT of RK2).
Frequency of mobilization for conjugal transfer between various Escherichia coli strains of derivatives of Klebsiella pneumoniae 287-w plasmids in the presence of the RK2 helper transfer system
Results are the means of at least three mating experiments.
Control plasmid (contains oriT of RK2).
Besides the rep gene (ORF1), pIGRK also carries ORF2, whose predicted protein product shares similarity with proteins belonging to the DNA_BRE_C superfamily of DNA breaking–rejoining enzymes (Marchler-Bauer & Bryant, 2004; Marchler-Bauer et al., 2009). The highest similarities of the ORF2-encoded protein (c. 28% identity) were with phage-related integrases encoded by Acidovorax sp. JS42 (accession no. YP_987802) and Methylophaga thiooxidans DMS010 (accession no. ZP_05103682). Mutational analysis was performed to investigate the role of ORF2 (named int) in plasmid mobilization. A 4-bp not-in-frame insertion into the int gene of pIGRKKAN was created, and this completely abolished transfer of the mutant plasmid (pIGRKKAN-NdeI), which indicated that the integrase-like protein functions in plasmid mobilization.
To localize the putative oriT of MOBpIGRK, a two-plasmid system was constructed in E. coli S17-1 composed of (1) a helper replicon pWSK-int (pWSK29 Apr vector containing MOBpIGRK – a source of the predicted integrase) and (2) compatible nonmobilizable vector pBGS18 (Kmr) carrying the putative oriT of pIGRK. As it was not possible to predict the oriT from the nucleotide sequence of pIGRK, several DNA fragments (ranging in size from 370 to 455 bp) covering the whole plasmid genome were amplified by PCR and cloned into pBGS18. Only one of the pBGS18 derivatives (pBGS18/3oriT), containing a 455-bp DNA fragment of pIGRK, including the upstream region of the int gene (Fig. 0001b), was successfully transferred. None of the obtained transconjugants carried the helper plasmid, which precluded the possibility that pBGS18/3oriT was transferred as a plasmid co-integrate.
In summary, this series of experiments revealed the presence of a novel two-component mobilization system in pIGRK composed of an integrase-like protein Int and an oriT, placed upstream of the int gene.
Host range of the REP and MOB modules
The host range of the mobilizable plasmids pIGMS31KAN, pIGMS32KAN, and pIGRKKAN was examined by testing whether they could be transferred and maintained in several hosts belonging to (1) the Gammaproteobacteria (E. coli DH5αR – a control strain, Serratia sp. OS9) and (2) the Alphaproteobacteria (A. tumefaciens LBA1010, Brevundimonas sp. LM18, P. aminovorans JCM 7685, R. etli CE3). Transconjugants containing the plasmids were obtained exclusively with the gammaproteobacterial recipients, which indicated that either the replication or the mobilization systems of the plasmids are not functional for the alphaproteobacterial hosts.
To test the host range of the MOB modules of pIGMS31KAN, pIGMS32KAN, and pIGRKKAN, attempts were made to introduce a DIY-series genetic cassette (from plasmid pDIY-312T; Dziewit et al., 2011), carrying a replication system specific for Alphaproteobacteria, derived from plasmid pAMI3 of Paracoccus aminophilus JCM 7686, into the plasmids. Unfortunately, it was only possible to introduce the DIY cassette into pIGMS32KAN (resulting plasmid pMS32-DIY). Therefore, in the case of pIGMS31KAN and pIGRKKAN, an alternative strategy was applied, in which PCR-amplified DNA fragments carrying MOBpIGMS31 and MOBpIGRK were cloned separately into nonmobilizable vector pMAO1 (carries the replication system of a BHR plasmid RA3, functional in Alphaproteobacteria). The resulting shuttle plasmid pMS32-DIY and BHR plasmids pMAO-RK (with MOBpIGRK) and pMAO-MS (with MOBpIGMS31) were first introduced into E. coli S17-1, and the obtained strains were used in bi-parental mating assays. In this case, transconjugants containing pMS32-DIY and pMAO-MS (but not pMAO-RK) were obtained for (1) A. tumefaciens LBA1010 (transfer frequency 3.2 × 10−6 and 2.8 × 10−8, respectively) and P. aminovorans JCM 7685 (transfer frequency 2.3 × 10−7 and 3.4 × 10−6, respectively) – both plasmids transferred, (2) R. etli CE3 (transfer of pMS32-DIY; frequency 1.4 × 10−4), and (3) Brevundimonas sp. LM18R (transfer of pMAO-MS; 7.5 × 10−7).
In summary, the aforementioned results provide evidence that the replication systems of pIGMS31 and pIGMS32 are active only in Gammaproteobacteria, but the mobilization systems of these plasmids function in a wider range of hosts.
Discussion
In this study, three plasmids (pIGMS31, pIGMS32, and pIGRK) harbored by a pathogenic strain of K. pneumoniae 287-w have been fully sequenced and functionally characterized. These analyses revealed that pIGMS31, pIGMS32, and pIGRK contain different systems for mobilization for conjugal transfer, which are compatible with the helper transfer system of RK2. An intriguing observation was the transfer (at low frequency) of a Kmr derivative of plasmid pIGRK, whose MOB system was not predicted by classical comparative sequence analysis. pIGRK is a small cryptic plasmid, which, besides the rep gene, carries only an ORF encoding a protein with similarity to phage-related integrases. The results of this study strongly suggest that pIGRK contains a true mobilization system, because transfer of this plasmid was dependent on the presence of (1) the helper system of plasmid RK2, (2) an intact int gene, and (3) a short DNA region placed upstream of the int gene (putative oriT). These observations indicate that the MOB of pIGRK is composed of both a cis-required sequence and a trans-acting protein, which is a typical structure in other well-defined mobilization systems. However, the predicted MOB of pIGRK does not share any sequence similarity with the MOBs of other plasmids. Although plasmids encoding phage-related integrases have been described previously (e.g. Werbowy et al., 2009; Zhang & Gu, 2009), to our knowledge, this is the first study to provide evidence that such a protein may participate in mobilization for conjugal transfer. Further studies are required to confirm these observations by more detailed molecular analyses.
It was also demonstrated that pIGMS31, pIGMS32, and pIGRK are NHR plasmids, which can be maintained solely in closely related species of Gammaproteobacteria, but not in Alphaproteobacteria. In contrast, the MOBs of pIGMS31 and pIGMS32 enabled the conjugal transfer of heterogeneous replicons into several Alphaproteobacteria hosts (from the genera Agrobacterium, Brevundimonas, Paracoccus, and Rhizobium).
This finding provides evidence that NHR mobilizable plasmids may be efficiently transferred among evolutionarily distinct bacterial species. Such plasmids (not able to replicate in many hosts) may carry highly recombinogenic TEs (i.e. insertion sequences, transposons, or transposable modules), whose activity may lead to insertion of the TEs (or the whole plasmids) into the chromosome or natural plasmid of a new host. The transferred genes can be therefore maintained as a part of the host genome. This strongly suggests that NHR mobilizable plasmids may act as natural suicide vectors promoting the dissemination of diverse genetic information in HGT over a much wider range than previously thought.
Acknowledgements
We acknowledge L. Drewniak, R. Matlakowska, A. Sklodowska (Laboratory of Environmental Pollution Analysis, University of Warsaw) for providing bacterial strains and G. Jagura-Burdzy, A. Bartosik (Institute of Biochemistry and Biophysics, Polish Academy of Sciences) for providing mini-derivative of plasmid RA3 used for construction of vector pMAO1. This work was supported by the State Committee for Scientific Research, Poland (grant PBZ-MNiSW-04/I/2007).
References
Author notes
Editor: Wolfgang Schumann
