Abstract

The administration of probiotic lactic acid bacteria (LAB) has been studied for its potential to prevent atopic dermatitis (AD). The objective of this study was to assess the inhibitory mechanism of a skin lesion by LAB using an experimental model that we previously demonstrated in NC/Nga mice. Lactobacillus johnsonii NCC533 (La1) was administered orally to the La1 group from 20 to 22 days after birth, while phosphate-buffered saline was given to the control group. After the induction of skin lesions in 6-week-old mice, the expression of genes supposedly involved in AD was evaluated. Gene expression of the proinflammatory cytokines [interleukin-8 (IL-8), IL-12 and IL-23] was significantly enhanced in the lesional skin of the control group by the induction of the lesion, whereas gene expression of those in the La1 group was not elevated. Interestingly, expression of the costimulatory molecule CD86 showed a pattern similar to the expression of the cytokines in the lesional skin. Moreover, the La1 group showed a significantly lower gene expression of CD86 in Peyer's patches and mesenteric lymph nodes than the control group. The suppression of proinflammatory cytokines and CD86 by primary administration of La1 may significantly contribute to the inhibitory effect on the skin lesion.

Introduction

Atopic dermatitis (AD) is a highly pruritic chronic inflammatory skin disease with a wide variety of clinical manifestations. Regardless of a patient's age, mild to severe erythema, scaling, haemorrhage and excoriation with severe itch are generally present (Leung & Bieber, 2003). Interest in this disease has been sparked by reports of its increasing prevalence and significant adverse effects on quality of life.

At least two types of AD have been identified. The first, which affects 70–80% of patients, is extrinsic and is associated with immunoglobulin E (IgE)-mediated sensitization; the second, affecting 20–30% of patients, is intrinsic without IgE-mediated sensitization (Johansson et al., 2001). Evidence suggests that various factors, including immunological abnormalities (Leung & Bieber, 2003), barrier dysfunction of the skin (Werner & Lindberg, 1985), exposure to allergens such as mites (Platts-Mills et al., 1983) and environmental factors (Adinoff et al., 1988), contribute to the pathogenesis and development of this disease.

It was first suggested by Isolauri (2000) that the oral administration of lactic acid bacteria (LAB) could inhibit and/or prevent the development of AD in human infants. Several clinical studies supported this beneficial effect of probiotic bacteria on AD (Kalliomaki et al., 2001, 2003; Rosenfeldt et al., 2003; Viljanen et al., 2005; Weston et al., 2005). However, more studies will be required to ensure the potency of the oral administration of probiotics on AD, as Brouwer (2006) reported that no beneficial effect was observed after probiotic administration to AD infants in their study.

The NC/Nga mouse was originally established as an inbred strain in 1957 (Kondo et al., 1969; Festing, 1996) and is now used as a useful model for AD research. It develops human AD-like skin lesions mediated by elevated levels of serum IgE under conventional circumstances (Matsuda et al., 1997) or as a result of the application of a mite antigen (Matsuoka et al., 2003). In fact, this mouse model has been used for the evaluation of the preventive effects of functional foods, such as astragalin, royal jelly and konjac glucomannan, on AD (Kotani et al., 2000; Taniguchi et al., 2003; Onishi et al., 2005).

This mouse model was previously used to demonstrate that the administration of Lactobacillus johnsonii strain NCC533 (La1) at the time of weaning can significantly inhibit the development of AD-like lesions (Inoue et al., 2007). Our findings indicated that La1 definitely possessed the ability to inhibit the development of AD, although the timing of probiotic administration is a key to efficient immunomodulation.

The objective of this study was to assess the mechanism involved in the inhibitory effect on AD-like lesions by the primary administration of La1. The expression of the genes supposedly involved in the development of AD was analysed in skin and gut-associated lymph tissues using real-time RT-PCR to clarify the mechanism contributing to lesion inhibition.

Materials and methods

Mice and administration of La1

Four pregnant NC/Nga mice were obtained from a commercial supplier (Japan SLC, Shizuoka, Japan). Pups delivered from these mice were used in this experiment. They were divided into three groups and treated as follows.

La1 group (n=9): La1 was cultured for 20 h at 37°C with 5 mL of anaerobic GAM broth (Nissui, Tokyo, Japan) supplemented with 1% glucose. The bacteria were collected by centrifugation (10 000 g, 4°C) and suspended in phosphate-buffered saline (PBS). The suspension containing 1010 cells of La1 was orally administered from 20 to 22 days of age. The administration and La1 preparation were performed as described in Inoue (2007).

Control group (n=8) and nontreated negative control (NT) group (n=5): PBS was orally administered during the same period as the La1 group. The mice were housed and reared as described in Inoue (2007).

The experiment was conducted in accordance with the guidelines for studies with laboratory animals of the Kyoto Prefectural University Experimental Animal Committee.

Induction of human AD-like lesions

Human AD-like lesions were induced in 6-week-old mice. Mite antigen (Mite Extract Dermatophagoides farinae, LSL, Tokyo, Japan) diluted with PBS was applied three times weekly onto the back of the mice in the La1 and control groups, as described in Inoue (2007). As a negative control, PBS was applied to the NT group. The severity of skin lesions was scored as described in Inoue (2007).

Dissection and sample collection

The application of the mite antigen was carried out for 5 weeks (15 applications in total), as in the study by Inoue (2007). At the time for the 16th application, the mice were dissected, and no mite antigen was applied.

Each mouse was anaesthetized with an intraperitoneal injection of 50 µL of pentobarbital sodium (Schering-Plough, Osaka, Japan). The antigen-applied region was photographed using a Nikon Coolpix 990 (Nikon, Tokyo, Japan). The skin from that region was then collected and immersed in RNAlater (Ambion, Tokyo, Japan) for RNA preservation.

All visible Peyer's patches (PPs) and mesenteric lymph nodes (MLNs) were collected and immersed in RNAlater. The samples in RNAlater were stored at −80°C until use.

RNA extraction and cDNA synthesis

All samples were washed with diethylpyrocarbonate-treated water prior to RNA extraction to remove the remaining RNAlater.

The antigen-applied skin (1.5 × 1.5 cm) was ground in liquid nitrogen with a pestle and mortar and suspended with a Denaturation Solution of Totally RNA kit (Ambion, Tokyo, Japan). Total RNA was then extracted with a Totally RNA kit according to the manufacturer's instructions. The extracted total RNA was treated with DNase and further purified with the RNeasy Mini Kit and RNase-free DNase Set (Qiagen, Tokyo, Japan) according to the manufacturer's instructions.

MLNs were minced with a Biomasher (Hitec, Osaka, Japan) and RNA extraction and DNase treatment were performed with the RNeasy Mini Kit and RNase Free DNase Set according to the manufacturer's instructions.

Total RNA was extracted from PPs in the same manner as for MLNs, but PP tissue was minced by bead beating for 45 s.

From the total RNA (250 ng), cDNA was synthesized using ReverTraAce-α (TOYOBO, Osaka, Japan) according to the manufacturer's instructions using the Oligo (dT)20 primer.

Real-time PCR

Real-time PCR was performed using a light cycler system (Roche Applied Science, Tokyo, Japan). The expression of 12 genes (Table 1) including a housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), was evaluated in skin samples, and five of them [CD80, CD86, CD28, Cyto-toxic T-lymphocyte antigen 4 (CTLA-4) and GAPDH] were evaluated in the samples from PPs and MLNs. Amplification was carried out in a 20-µL reaction volume containing 2 µL of LightCycler FastStart DNA Master SYBR Green I (Roche Applied Science, Tokyo, Japan), 2.4 µL of 2.5 mM MgCl2, 0.4 µL cDNA and 0.4 µM of each primer. The thermal cycling profile was 10 min at 95°C followed by 45 cycles of 15 s at 95°C, 5 s at appropriate annealing temperature (Table 1) and 15 s at 72°C. Melting curves were generated for each sample to verify the specificity of the amplicons. For a standard curve preparation, a high-concentration mouse cDNA, previously obtained in our laboratory from a healthy BALB/c mouse, was serially diluted and included in every run. The arbitrary gene expression unit for each sample was calculated from the standard curve and normalized with the unit for GAPDH.

Table 1

Genes evaluated and their primer set in this study

Gene name Primer 5′–3′ Annealing temperature (°C) Reference 
GAPDH F- CCACCCAGAAGACTGTGGAT 62 Dieterich (2000) 
 R- CACATTGGGGGTAGGAACAC  Blavier (2006) 
INF-γ F- ATCTGGAGGAACTGGCAAAA 58 This study 
 R- TGAGCTCATTGAATGCTTGG  Schroppel (2004) 
TGF-β F- TGACGTCACTGGAGTTGTACGG 62 Choi (2003) 
 R- GGTTCATGTCATGGATGGTGC  This study 
IL-8 F- ATGGCTGGGATTCACCTCAA 58 Heishi (2003) 
 R- AAGCCTCGCGACCATTCTT   
IL-10 F- TGCTATGCTGCCTGCTCTTA 58 This study 
 R- TCATTTCCGATAAGGCTTGG   
IL-12 p40 F- AGGTGCGTTCCTCGTAGAGA 58 Nishihori (2000) 
 R- AAAGCCAACCAAGCAGAAGA   
IL-18 F- GAGGAAATGGATCCACCTGA 60 This study 
 R- ACAAACCCTCCCCACCTAAC  Van Der Sluijs (2005) 
IL-23 p19 F- AATAATGTGCCCCGTATCCA 58 Leithauser (2006) 
 R- CTGGAGGAGTTGGCTGAGTC  Becker (2003) 
CD80 F- ATGCTCACGTGTCAGAGGA 60 Serebrisky (2000) 
 R- GACGGTCTGTTCAGCTAATG   
CD86 F- CAACTGGACTCTACGACTTC 60 Serebrisky (2000) 
 R- TGCTTAGACGTGCAGGTCAA   
CD28 F- CTCTGGAATCTGCACGTCAA 60 This study 
 R- AACAGGACTCCAGCAACCAC   
CTLA-4 F- ACAGGTGACCCAACCTTCAG 62 This study 
(CD152) R- CAGTCCTTGGATGGTGAGGT   
Gene name Primer 5′–3′ Annealing temperature (°C) Reference 
GAPDH F- CCACCCAGAAGACTGTGGAT 62 Dieterich (2000) 
 R- CACATTGGGGGTAGGAACAC  Blavier (2006) 
INF-γ F- ATCTGGAGGAACTGGCAAAA 58 This study 
 R- TGAGCTCATTGAATGCTTGG  Schroppel (2004) 
TGF-β F- TGACGTCACTGGAGTTGTACGG 62 Choi (2003) 
 R- GGTTCATGTCATGGATGGTGC  This study 
IL-8 F- ATGGCTGGGATTCACCTCAA 58 Heishi (2003) 
 R- AAGCCTCGCGACCATTCTT   
IL-10 F- TGCTATGCTGCCTGCTCTTA 58 This study 
 R- TCATTTCCGATAAGGCTTGG   
IL-12 p40 F- AGGTGCGTTCCTCGTAGAGA 58 Nishihori (2000) 
 R- AAAGCCAACCAAGCAGAAGA   
IL-18 F- GAGGAAATGGATCCACCTGA 60 This study 
 R- ACAAACCCTCCCCACCTAAC  Van Der Sluijs (2005) 
IL-23 p19 F- AATAATGTGCCCCGTATCCA 58 Leithauser (2006) 
 R- CTGGAGGAGTTGGCTGAGTC  Becker (2003) 
CD80 F- ATGCTCACGTGTCAGAGGA 60 Serebrisky (2000) 
 R- GACGGTCTGTTCAGCTAATG   
CD86 F- CAACTGGACTCTACGACTTC 60 Serebrisky (2000) 
 R- TGCTTAGACGTGCAGGTCAA   
CD28 F- CTCTGGAATCTGCACGTCAA 60 This study 
 R- AACAGGACTCCAGCAACCAC   
CTLA-4 F- ACAGGTGACCCAACCTTCAG 62 This study 
(CD152) R- CAGTCCTTGGATGGTGAGGT   

Statistical analysis

One-way anova was used to analyse the differences among the means of experimental groups with regard to gene expression. The statistical analysis was performed with the arbitrary gene expression unit normalized by GAPDH. When a parameter of any of the experimental groups was significant, Scheffé's posthoc comparison was used. The difference among means was considered significant at P<0.05. All data were analysed using Statcel (OMS, Saitama, Japan), which is an add-in application for Microsoft Excel (Seattle, WA USA).

Results

Skin lesion

Figure 1 shows the appearance of the antigen-applied region in three representative individuals from each experimental group. As in a previous study (Inoue et al., 2007), the administration of La1 at the age of 20–22 days remarkably inhibited the development of AD-like lesions. The skin scores in the control group were significantly higher than those in the La1 group from the 11th application to the end of the experimental period, except for the day of the 12th application (Fig. 2). The skin scores in the La1 and NT groups remained low or zero throughout the experimental period.

Figure 1

Skin features of the antigen-applied region in NC/Nga mice after 15 antigen applications in each group. Control, mice were administered PBS from 20 to 22 days after birth; La1, mice were administered La1 at the same period as controls; NT, mice were administered PBS at the same period as controls without any subsequent mite antigen applications.

Figure 1

Skin features of the antigen-applied region in NC/Nga mice after 15 antigen applications in each group. Control, mice were administered PBS from 20 to 22 days after birth; La1, mice were administered La1 at the same period as controls; NT, mice were administered PBS at the same period as controls without any subsequent mite antigen applications.

Figure 2

Skin scores of NC/Nga mice from the seventh to the 15th mite antigen application. Control, mice were administered PBS from 20 to 22 days after birth (▪); La1, mice were administered La1 at the same period as controls (•); NT, mice were administered PBS at the same period as controls without any subsequent mite antigen applications (▲). Data are shown as means, and bars represent the SE. *P<0.05, control vs. La1 and NT; P<0.05, control vs. La1.

Figure 2

Skin scores of NC/Nga mice from the seventh to the 15th mite antigen application. Control, mice were administered PBS from 20 to 22 days after birth (▪); La1, mice were administered La1 at the same period as controls (•); NT, mice were administered PBS at the same period as controls without any subsequent mite antigen applications (▲). Data are shown as means, and bars represent the SE. *P<0.05, control vs. La1 and NT; P<0.05, control vs. La1.

Gene expression in antigen-applied skin

The control group showed a significantly higher gene expression of interleukin-8 (IL-8), IL-10, IL-12 and IL-23 than the La1 and NT groups (P<0.05; Fig. 3). The control group expressed approximately ninefold higher levels of IL-8 gene compared with the NT group while the La1 group showed comparable levels of IL-8 gene expression with the NT group. The La1 group showed about twofold higher expression of IL-12 and IL-23 than the NT group, but the control group showed a much higher expression of both genes. Gene expression levels of IL-12 and IL-23 were six and 4.3-fold higher in the control group than in the NT group, respectively. The IL-10 gene was expressed at a more than 10-fold higher level in the control group than in the NT group, whereas it was expressed at a 3.5-fold higher level in the La1 group than in the NT group.

Figure 3

Gene expression of cytokines in antigen-applied skin. The cytokine genes evaluated in this study are detailed in Table 1. The filled bar represents the NT group. The shaded and blank bars represent the control and La1 groups, respectively. The arbitrary unit for each gene was normalized by that for GAPDH and was used for the statistical analysis. Data are presented as fold-change compared with the NT group (mean±SE). *P<0.05.

Figure 3

Gene expression of cytokines in antigen-applied skin. The cytokine genes evaluated in this study are detailed in Table 1. The filled bar represents the NT group. The shaded and blank bars represent the control and La1 groups, respectively. The arbitrary unit for each gene was normalized by that for GAPDH and was used for the statistical analysis. Data are presented as fold-change compared with the NT group (mean±SE). *P<0.05.

Gene expression of interferon-γ (IFN-γ), transforming growth factor-β (TGF-β and IL-18) was not significantly different among the experimental groups.

Gene expressions of CD86 and CTLA-4 in the control group were significantly higher than those in the La1 and NT groups (P<0.05; Fig. 4). CD86 and CTLA-4 genes were expressed at three and 6.5-fold higher levels in the control group than the NT group. The La1 group showed a comparable level of CD86 and CTLA-4 gene expression with the NT group. The expression level of CD80 was significantly higher in the control group than in the La1 and NT groups; however, the difference in the expression level of this gene among the experimental groups was relatively small compared with that of CD86 and CTLA-4 (c. 1.8-fold higher in the control group than in the La1 and NT groups).

Figure 4

Gene expression of CD80, CD86, CD28 and CTLA-4 in antigen-applied skin. The filled bar represents the NT group. The shaded and blank bars represent the control and La1 groups, respectively. The arbitrary unit for each gene was normalized by that for GAPDH and was used for the statistical analysis. Data are presented as fold-change compared with the NT group (mean±SE). *P<0.05.

Figure 4

Gene expression of CD80, CD86, CD28 and CTLA-4 in antigen-applied skin. The filled bar represents the NT group. The shaded and blank bars represent the control and La1 groups, respectively. The arbitrary unit for each gene was normalized by that for GAPDH and was used for the statistical analysis. Data are presented as fold-change compared with the NT group (mean±SE). *P<0.05.

There was no significant difference in CD28 gene expression among the experimental groups.

Gene expression of CD80, CD86, CD28 and CTLA-4 in PPs and MLNs

PPs and MLNs showed similar expression patterns with the genes evaluated in this study (Fig. 5). In both organs, the control and NT groups showed significantly higher gene expression of CD86 than the La1 group (P<0.05). The La1 group showed lower gene expression of CD80 and CTLA-4 than the other experimental groups in PPs, but the difference between the control and La1 groups was not significant. In MLN, CTLA-4 gene expression was significantly lower in the La1 group than the other two experimental groups (P<0.05). No significant difference was found in the CD80 gene expression level in MLN among the experimental groups. There were no significant differences in the gene expression of CD28 among the experimental groups in either organ.

Figure 5

Gene expression of CD80, CD86, CD28 and CTLA-4 in PPs and MLNs. The filled bar represents the NT group. The shaded and blank bars represent the control and La1 groups, respectively. The arbitrary unit for each gene was normalized by that for GAPDH and was used for the statistical analysis. Data are presented as fold-change compared with the NT group (mean±SE). *P<0.05.

Figure 5

Gene expression of CD80, CD86, CD28 and CTLA-4 in PPs and MLNs. The filled bar represents the NT group. The shaded and blank bars represent the control and La1 groups, respectively. The arbitrary unit for each gene was normalized by that for GAPDH and was used for the statistical analysis. Data are presented as fold-change compared with the NT group (mean±SE). *P<0.05.

Discussion

Since the first report by Isolauri (2000), the oral administration of probiotic bacterium has received attention as a nondrug-dependent therapy for AD. This is evidenced by the large number of studies, both in agreement and in disagreement, that have been published on the topic (Murch, 2001; Kalliomaki et al., 2001, 2003; Niers et al., 2003; Rosenfeldt et al., 2003; Weston et al., 2005; Viljanen et al., 2005; Hoekstra & Niers, 2006; Shaw, 2006). However, the potency of probiotic therapy on AD still needs to be elucidated because the inhibitory mechanism has not been fully established. This is attributed primarily to the lack of appropriate animal models for understanding the positive effects of probiotics.

The experimental model previously presented (Inoue et al., 2007) seems to be useful in clarifying the inhibitory mechanisms on AD by LAB administration. It was confirmed in that study that the primary administration of LAB significantly decreases the number of infiltrated mast cells in antigen-applied skin, the IgE concentration and IgG1/G2a ratio in the serum, and the scratching scores in NC/Nga mice.

The induction of AD-like lesions and its inhibition by the primary administration of La1 were successfully reproduced in this study, as in a previous experiment (Figs 1 and 2; Inoue et al., 2007).

Gene expression of IL-8, IL-12 and IL-23 was significantly higher in the mite antigen-applied skin of the control group than in that of the NT group (Fig. 3). In agreement with these results, the upregulation of these cytokines has been reported in humans with chronic AD (Hamid et al., 1996; Mullings et al., 2001; Kopp et al., 2003). IL-8, the C-X-C chemokine, clearly plays a key role in neutrophil emigration (Kunkel et al., 1991) and IL-12 is considered to be involved in chronic AD (Hamid et al., 1996; Yawalkar et al., 2000). Moreover, a repeated subcutaneous injection of IL-23 seems to result in skin inflammation (Kopp et al., 2003). With regard to the functions of those cytokines, it is quite likely that they participated as highly causative agents of skin lesions.

In contrast, the level of gene expression of these cytokines in the La1 group was comparable with that in the NT group and was significantly lower than that in the control group (Fig. 3). This suggested that the administration of La1 in early life could impede the overexpression of these proinflammatory cytokines and that this impediment was presumably involved in the inhibitory process on skin lesions by La1 administration.

The higher gene expression of IL-10 in the antigen-applied region of the control group than that in the La1 and NT groups (Fig. 3) did not seem to agree with the theory that IL-10 has the potential to inhibit inflammation, the so-called immune regulatory function (Asseman et al., 1999). However, IL-10 was significantly overexpressed in AD patients relative to healthy controls according to Aleksza (2002) and Ohmen (1995). Thus, the impediment of IL-10 overexpression may also have partly contributed to the inhibitory effect on skin lesions by La1.

Considering the fact that IL-12 and IL-23 are involved in innate immunity (Langrish et al., 2004) and IL-8 is the product of active dendritic cells (DCs) (Ramoner et al., 1998; Verhasselt et al., 1998; Caron et al., 2001), we hypothesized that the primary administration of La1 may have affected the activity of the cells involved in innate immunity such as macrophages (Mϕ) and DCs after maturation. Thus, the costimulatory molecules, CD80 and CD86, were further examined in this study because their expression could be affected if the above hypothesis was plausible.

CD80 and CD86 are generally expressed in antigen presenting cells (APCs), such as Mϕ and DCs (Bhatia et al., 2006), and are occasionally upregulated with proinflammatory cytokines (Windhagen et al., 1995; Willmann & Dunne, 2000; Caron et al., 2001). Moreover, overexpression of CD80 and especially of CD86 has been observed in humans with AD and atopic rhinitis (Ohki et al., 1997; Hattori et al., 2001; Schuller et al., 2001), although their expression has not yet been investigated in this mouse model. It is noteworthy that CD80 and CD86 are in fact the positional candidate genes for AD in humans, according to the genome screens conducted by Lee (2000).

Indeed, the gene expression of costimulatory molecules, especially CD86, in the antigen-applied skin of the control group was significantly higher than that of NT, while the La1 group showed a comparable level of expression of these genes in antigen-applied skin (Fig. 4). These results indicated that the overexpression of costimulatory molecules might contribute to the development of skin lesions in this mouse model as well as human AD. This result agrees with the observation that IL-10 is preferentially produced by T cells as a result of the costimulation through CD86 (Nakajima et al., 1997).

The attenuation of CD86 by the primary La1 administration was presumably a part of the inhibitory mechanism on the skin lesion. It has been demonstrated that the blockade of CD86 by monoclonal antibodies significantly improved the allergic pulmonary inflammation and allergic airway hyper-responsiveness in model mice (Mark et al., 1998; Haczku et al., 1999).

Interestingly, the expression of CD86 was significantly attenuated not only in antigen-applied skin but also in gut-associated lymph tissues (PPs and MLNs) of the La1 group, whereas this was not the case in the control group (Fig. 5). This strongly suggests that the immunomodulatory effect of La1 may have been achieved first in the gut and was subsequently expressed in a systemic immune site, including the cutaneous immune system, through the common mucosal immune system, the immunological relationship of the mucosal immune system with the systemic immune system (Iijima et al., 2001; Mowat, 2003).

Gene expressions of CD80 and CD86 were unexpectedly higher in PPs and MLNs of the NT group than those of the La1 group (Fig. 5). However, it is worth mentioning that, in our evaluation, CD80 and CD86 gene expression levels in PPs and MLNs of healthy Balb/c mice were comparable with those of the La1 group, and not the NT group (mean expression levels of CD80 and CD86 in PPs and MLNs of healthy Balb/c mice were 0.75 and 0.16, respectively, and 0.26 and 0.34 for the NT group). These data imply genuine dysfunction of the intestinal immune system in this mouse model. Consistent with this implication, it has been demonstrated that oral tolerance could not be developed in this mouse model, while this was not the case in Balb/c mice (Sakai et al., 2006). Moreover, this mouse model is used as a model for food allergy, which is associated with an elevated level of serum IgE (Sakamoto et al., 1999). Interestingly, abnormality of the intestinal immune system in patients with AD was also reported by Majamaa (1996). According to the latter study, levels of intestinal inflammation markers were significantly higher in patients with AD than in healthy controls, while upregulation of CD86 was also reported in inflamed intestine (Vuckovic et al., 2001). Although the gut immune system of this mouse model and that of the AD patients merit further investigation, it seems likely that dysfunction of the gut immune system is enhanced upon oral administration of La1.

The gene for CTLA-4 showed the most surprising expression pattern in this experiment (Fig. 3). CTLA-4 is a known counter receptor of CD80 and CD86, as is CD28. However, in contrast to CD28, CTLA-4 is reported as a negative receptor for T-cell activation. Briefly, the binding of CD80 and CD86 to CTLA-4 is considered to result in the suppression of the differentiation of the naïve T cell into Th1- and/or Th2-type cells (Thompson & Allison, 1997). Thus, in theory, the immune response in the control group should have been suppressed. However, this was clearly not the case, which suggested another role of CTLA-4 in AD and/or drastically increased numbers of T cells. In accordance, Choi (2005) demonstrated the overexpression of CTLA-4 in AD infants but not in healthy controls. Jones (2006) suggested that there were some polymorphisms on CTLA-4 genes and that at least some of them seemed to contribute to the development of AD in human infants. Furthermore, Wu (1997) proposed that the interaction of CD80/86–CTLA-4 is sufficient to activate T-cell differentiation. Given these results, it is suggested that the overexpression of CTLA-4 in the control group might be related to the development of skin lesions. In the La1 group, gene expression was probably attenuated in response to the decrease in cotimulation provided by CD80/86. Further studies are required to classify its exact role in AD.

This study demonstrated that the gene expression of proinflammatory cytokines (IL-8, IL-12 and IL-23) and CD86 was enhanced by the repeated application of mite antigens in NC/Nga mice and that the elevation in these gene expressions was suppressed by the administration of La1 in the weaning period. Although it is still unclear from this study which exactly type of cells are expressing CD86 and producing proinflammatory cytokines, and where these cells are localized, the suppression of these genes by La1 may participate to a large degree in the inhibitory effect on skin lesions in this experimental model. The oral administration of La1 in early life may have affected cell number and/or cell activity of CD86- and perhaps CD80-bearing cells in mucosal and cutaneous immune sites. The administered La1 may have achieved this immunomodulatory effect first in the mucosal and subsequently in the systemic immune system. This immunomodulatory process by La1 may involve cells such as Mϕ and DCs because these cells are the most plausible CD86-expressing cells. However, it has been reported that B and/or T cells also express CD86 during atopic disease (Jirapongsananuruk et al., 1998; Nakada et al., 1999; Hattori et al., 2001) and the cytokines that were upregulated in the antigen-applied skin are theoretically produced by various kinds of cells.

Further immunohistochemical or flow cytometry studies focused on the costimulatory molecules will provide useful information regarding the localization and population of cells affected by La1 and such information would certainly help to reveal more precisely the inhibitory mechanism on skin lesions by La1.

Acknowledgements

We thank Dr Yoichi Fukushima (Nestlé Japan Manufacturing, Tokyo, Japan) for his help during this study. Lactobacillus johnsonii NCC533 (La1) was supplied from NESTEC.LTD (Avenue Nestlé 55, CH-1800 Vevey, Switzerland).

References

Adinoff
A.D.
Tellez
P.
Clark
R.A.
(
1988
)
Atopic dermatitis and aeroallergen contact sensitivity
.
J Allergy Clin Immunol
 
81
:
736
742
.
Aleksza
M.
Lukacs
A.
Antal-Szalmas
P.
Hunyadi
J.
Szegedi
A.
(
2002
)
Increased frequency of intracellular interleukin (IL)-13 and IL-10, but not IL-4, expressing CD4+and CD8+peripheral T cells of patients with atopic dermatitis
.
Br J Dermatol
 
147
:
1135
1141
.
Asseman
C.
Mauze
S.
Leach
M.W.
Coffman
R.L.
Powrie
F.
(
1999
)
An essential role for interleukin 10 in the function of regulatory T cells that inhibit intestinal inflammation
.
J Exp Med
 
190
:
995
1004
.
Becker
C.
Wirtz
S.
Blessing
M.
Pirhonen
J.
Strand
D.
Bechthold
O.
Frick
J.
Galle
P.R.
Autenrieth
I.
Neurath
M.F.
(
2003
)
Constitutive p40 promoter activation and IL-23 production in the terminal ileum mediated by dendritic cells
.
J Clin Invest
 
112
:
693
706
.
Bhatia
S.
Edidin
M.
Almo
S.C.
Nathenson
S.G.
(
2006
)
B7-1 and B7-2: similar costimulatory ligands with different biochemical, oligomeric and signaling properties
.
Immunol Lett
 
104
:
70
75
.
Blavier
L.
Lazaryev
A.
Dorey
F.
Shackleford
G.M.
DeClerck
Y.A.
(
2006
)
Matrix metalloproteinases play an active role in Wnt1-induced mammary tumorigenesis
.
Cancer Res
 
66
:
2691
2699
.
Brouwer
M.L.
Wolt-Plompen
S.A.
Dubois
A.E.
Van Der Heide
S.
Jansen
D.F.
Hoijer
M.A.
Kauffman
H.F.
Duiverman
E.J.
(
2006
)
No effects of probiotics on atopic dermatitis in infancy: a randomized placebo-controlled trial
.
Clin Exp Allergy
 
36
:
899
906
.
Caron
G.
Delneste
Y.
Roelandts
E.
Duez
C.
Herbault
N.
Magistrelli
G.
Bonnefoy
J.Y.
Pestel
J.
Jeannin
P.
(
2001
)
Histamine induces CD86 expression and chemokine production by human immature dendritic cells
.
J Immunol
 
166
:
6000
6006
.
Choi
E.H.
Kim
M.J.
Yeh
B.I.
Ahn
S.K.
Lee
S.H.
(
2003
)
Iontophoresis and sonophoresis stimulate epidermal cytokine expression at energies that do not provoke a barrier abnormality: lamellar body secretion and cytokine expression are linked to altered epidermal calcium levels
.
J Invest Dermatol
121
:
1138
1144
.
Choi
S.Y.
Sohn
M.H.
Kwon
B.C.
Kim
K.E.
(
2005
)
CTLA-4 expression in T cells of patients with atopic dermatitis
.
Pediatr Allergy Immunol
 
16
:
422
427
.
Dieterich
S.
Bieligk
U.
Beulich
K.
Hasenfuss
G.
Prestle
J.
(
2000
)
Gene expression of antioxidative enzymes in the human heart: increased expression of catalase in the end-stage failing heart
.
Circulation
 
101
:
33
39
.
Festing
M.
(
1996
)
Origins and characteristics of inbred strains of mice
.
Genetic Variants and Strains of the Laboratory Mouse
  (
Lyon
M.
Rastan
S.
Brown
S.
, eds), pp.
1537
1576
.
Oxford University Press
,
New York
.
Haczku
A.
Takeda
K.
Redai
I.
Hamelmann
E.
Cieslewicz
G.
Joetham
A.
Loader
J.
Lee
J.J.
Irvin
C.
Gelfand
E.W.
(
1999
)
Anti-CD86 (B7.2) treatment abolishes allergic airway hyperresponsiveness in mice
.
Am J Respir Crit Care Med
 
159
:
1638
1643
.
Hamid
Q.
Naseer
T.
Minshall
E.M.
Song
Y.L.
Boguniewicz
M.
Leung
D.Y.
(
1996
)
In vivo expression of IL-12 and IL-13 in atopic dermatitis
.
J Allergy Clin Immunol
 
98
:
225
231
.
Hattori
H.
Okano
M.
Yoshino
T.
Akagi
T.
Nakayama
E.
Saito
C.
Satoskar
A.R.
Ogawa
T.
Azuma
M.
Nishizaki
K.
(
2001
)
Expression of costimulatory CD80/CD86-CD28/CD152 molecules in nasal mucosa of patients with perennial allergic rhinitis
.
Clin Exp Allergy
 
31
:
1242
1249
.
Heishi
M.
Imai
Y.
Katayama
H.
Hashida
R.
Ito
M.
Shinagawa
A.
Sugita
Y.
(
2003
)
Gene expression analysis of atopic dermatitis-like skin lesions induced in NC/Nga mice by mite antigen stimulation under specific pathogen-free conditions
.
Int Arch Allergy Immunol
 
132
:
355
363
.
Hoekstra
M.O.
Niers
L.E.
(
2006
)
Effects of probiotics on atopic dermatitis? Additional studies are still needed!
Arch Dis Child
 
91
:
276
;
author reply 276
.
Iijima
H.
Takahashi
I.
Kiyono
H.
(
2001
)
Mucosal immune network in the gut for the control of infectious diseases
.
Rev Med Virol
 
11
:
117
133
.
Inoue
R.
Nishio
A.
Fukushima
Y.
Ushida
K.
(
2007
)
Administration of probiotic Lacobacillus johnsonii NCC533 (La1) in a specific time of the weaning period prevents the development of atopic dermatitis induced after maturation in model mice, NC/Nga
.
Br J Dermatol
 
156
:
499
509
.
Isolauri
E.
Arvola
T.
Sutas
Y.
Moilanen
E.
Salminen
S.
(
2000
)
Probiotics in the management of atopic eczema
.
Clin Exp Allergy
 
30
:
1604
1610
.
Jirapongsananuruk
O.
Hofer
M.F.
Trumble
A.E.
Norris
D.A.
Leung
D.Y.
(
1998
)
Enhanced expression of B7.2 (CD86) in patients with atopic dermatitis: a potential role in the modulation of IgE synthesis
.
J Immunol
 
160
:
4622
4627
.
Johansson
SGO
Hourihane
JOB
Bousquet
J.
Bruijnzeel-Koomen
C.
Dreborg
S.
Haahtela
T.
Kowalski
M.L.
Mygind
N.
Ring
J.
Van Cauwenberge
P.
(
2001
)
A revised nomenclature for allergy
.
Allergy
 
56
:
813
824
.
Jones
G.
Wu
S.
Jang
N.
Fulcher
D.
Hogan
P.
Stewart
G.
(
2006
)
Polymorphisms within the CTLA4 gene are associated with infant atopic dermatitis
.
Br J Dermatol
 
154
:
467
471
.
Kalliomaki
M.
Salminen
S.
Arvilommi
H.
Kero
P.
Koskinen
P.
Isolauri
E.
(
2001
)
Probiotics in primary prevention of atopic disease: a randomised placebo-controlled trial
.
Lancet
 
357
:
1076
1079
.
Kalliomaki
M.
Salminen
S.
Poussa
T.
Arvilommi
H.
Isolauri
E.
(
2003
)
Probiotics and prevention of atopic disease: 4-year follow-up of a randomised placebo-controlled trial
.
Lancet
 
361
:
1869
1871
.
Kondo
K.
Nagami
T.
Tadokoro
S.
(
1969
)
Differences in haematopoeitic death among inbred strains of mice
.
Comparative Cellular and Species Radiosensitivity
  (
Bond
P.
Sugawara
S.
, eds), pp.
20
24
.
Igakushoin
,
Tokyo, Japan
.
Kopp
T.
Lenz
P.
Bello-Fernandez
C.
Kastelein
R.A.
Kupper
T.S.
Stingl
G.
(
2003
)
IL-23 production by cosecretion of endogenous p19 and transgenic p40 in keratin 14/p40 transgenic mice: evidence for enhanced cutaneous immunity
.
J Immunol
 
170
:
5438
5444
.
Kotani
M.
Matsumoto
M.
Fujita
A.
Higa
S.
Wang
W.
Suemura
M.
Kishimoto
T.
Tanaka
T.
(
2000
)
Persimmon leaf extract and astragalin inhibit development of dermatitis and IgE elevation in NC/Nga mice
.
J Allergy Clin Immunol
 
106
:
159
166
.
Kunkel
S.L.
Standiford
T.
Kasahara
K.
Strieter
R.M.
(
1991
)
Interleukin-8 (IL-8): the major neutrophil chemotactic factor in the lung
.
Exp Lung Res
 
17
:
17
23
.
Langrish
C.L.
McKenzie
B.S.
Wilson
N.J.
De Waal Malefyt
R.
Kastelein
R.A.
Cua
D.J.
(
2004
)
IL-12 and IL-23: master regulators of innate and adaptive immunity
.
Immunol Rev
 
202
:
96
105
.
Lee
Y.A.
Wahn
U.
Kehrt
R.
et al
. (
2000
)
A major susceptibility locus for atopic dermatitis maps to chromosome 3q21
.
Nat Genet
 
26
:
470
473
.
Leithauser
F.
Meinhardt-Krajina
T.
Fink
K.
Wotschke
B.
Moller
P.
Reimann
J.
(
2006
)
Foxp3-expressing CD103 regulatory T cells accumulate in dendritic cell aggregates of the colonic mucosa in murine transfer colitis
.
Am J Pathol
 
168
:
1898
1909
.
Leung
D.Y.
Bieber
T.
(
2003
)
Atopic dermatitis
.
Lancet
 
361
:
151
160
.
Majamaa
H.
Miettinen
A.
Laine
S.
Isolauri
E.
(
1996
)
Intestinal inflammation in children with atopic eczema: faecal eosinophil cationic protein and tumour necrosis factor-alpha as non-invasive indicators of food allergy
.
Clin Exp Allergy
 
26
:
181
187
.
Mark
D.A.
Donovan
C.E.
De Sanctis
G.T.
Krinzman
S.J.
Kobzik
L.
Linsley
P.S.
Sayegh
M.H.
Lederer
J.
Perkins
D.L.
Finn
P.W.
(
1998
)
Both CD80 and CD86 co-stimulatory molecules regulate allergic pulmonary inflammation
.
Int Immunol
 
10
:
1647
1655
.
Matsuda
H.
Watanabe
N.
Geba
G.P.
et al
. (
1997
)
Development of atopic dermatitis-like skin lesion with IgE hyperproduction in NC/Nga mice
.
Int Immunol
 
9
:
461
466
.
Matsuoka
H.
Maki
N.
Yoshida
S.
Arai
M.
Wang
J.
Oikawa
Y.
Ikeda
T.
Hirota
N.
Nakagawa
H.
Ishii
A.
(
2003
)
A mouse model of the atopic eczema/dermatitis syndrome by repeated application of a crude extract of house-dust mite Dermatophagoides farinae
.
Allergy
 
58
:
139
145
.
Mowat
A.M.
(
2003
)
Anatomical basis of tolerance and immunity to intestinal antigens
.
Nat Rev Immunol
 
3
:
331
341
.
Mullings
R.E.
Wilson
S.J.
Puddicombe
S.M.
Lordan
J.L.
Bucchieri
F.
Djukanovic
R.
Howarth
P.H.
Harper
S.
Holgate
S.T.
Davies
D.E.
(
2001
)
Signal transducer and activator of transcription 6 (STAT-6) expression and function in asthmatic bronchial epithelium
.
J Allergy Clin Immunol
 
108
:
832
838
.
Murch
S.H.
(
2001
)
Toll of allergy reduced by probiotics
.
Lancet
 
357
:
1057
1059
.
Nakada
M.
Nishizaki
K.
Yoshino
T.
Okano
M.
Yamamoto
T.
Masuda
Y.
Ohta
N.
Akagi
T.
(
1999
)
CD80 (B7-1) and CD86 (B7-2) antigens on house dust mite-specific T cells in atopic disease function through T–T cell interactions
.
J Allergy Clin Immunol
 
104
:
222
227
.
Nakajima
A.
Watanabe
N.
Yoshino
S.
Yagita
H.
Okumura
K.
Azuma
M.
(
1997
)
Requirement of CD28-CD86 co-stimulation in the interaction between antigen-primed T helper type 2 and B cells
.
Int Immunol
 
9
:
637
644
.
Niers
L.E.
Rijkers
G.
Knol
E.F.
Meijer
Y.
Hoekstra
M.O.
(
2003
)
Probiotics for prevention of atopic disease?
Lancet
 
362
:
496
;
author reply 496
.
Nishihori
H.
Tsuji
H.
Wang
H.
Tahara
H.
Akiyama
M.
Ogawa
Y.
Matsushima
K.
Iwakura
Y.
Mukaida
N.
(
2000
)
Participation of endogenously produced interferon gamma in interleukin 4-mediated tumor rejection
.
Hum Gene Ther
 
11
:
659
668
.
Ohki
O.
Yokozeki
H.
Katayama
I.
Umeda
T.
Azuma
M.
Okumura
K.
Nishioka
K.
(
1997
)
Functional CD86 (B7-2/B70) is predominantly expressed on Langerhans cells in atopic dermatitis
.
Br J Dermatol
 
136
:
838
845
.
Ohmen
J.D.
Hanifin
J.M.
Nickoloff
B.J.
et al
. (
1995
)
Overexpression of IL-10 in atopic dermatitis. Contrasting cytokine patterns with delayed-type hypersensitivity reactions
.
J Immunol
 
154
:
1956
1963
.
Onishi
N.
Kawamoto
S.
Nishimura
M.
Nakano
T.
Aki
T.
Shigeta
S.
Shimizu
H.
Hashimoto
K.
Ono
K.
(
2005
)
A new immunomodulatory function of low-viscous konjac glucomannan with a small particle size: its oral intake suppresses spontaneously occurring dermatitis in NC/Nga mice
.
Int Arch Allergy Immunol
 
136
:
258
265
.
Platts-Mills
T.A.
Mitchell
E.B.
Rowntree
S.
Chapman
M.D.
Wilkins
S.R.
(
1983
)
The role of dust mite allergens in atopic dermatitis
.
Clin Exp Dermatol
 
8
:
233
247
.
Ramoner
R.
Rieser
C.
Herold
M.
Klocker
H.
Bartsch
G.
Stenzl
A.
Thurnher
M.
(
1998
)
Activation of human dendritic cells by bacillus Calmette–Guerin
.
J Urol
 
159
:
1488
1492
.
Rosenfeldt
V.
Benfeldt
E.
Nielsen
S.D.
Michaelsen
K.F.
Jeppesen
D.L.
Valerius
N.H.
Paerregaard
A.
(
2003
)
Effect of probiotic Lactobacillus strains in children with atopic dermatitis
.
J Allergy Clin Immunol
 
111
:
389
395
.
Sakai
T.
Kogiso
M.
Mitsuya
K.
Komatsu
T.
Yamamoto
S.
(
2006
)
Defect of oral tolerance in NC/Nga mice
.
J Med Invest
 
53
:
29
33
.
Sakamoto
Y.
Ueno
K.
Yofu
S.
Fujita
K.
Iikura
Y.
(
1999
)
The expression of IL-4, IL-6 and TNF-alpha in the liver of food-sensitized mice after oral challenge
.
Int Arch Allergy Immunol
 
118
:
226
227
.
Schroppel
B.
Zhang
N.
Chen
P.
Zang
W.
Chen
D.
Hudkins
K.L.
Kuziel
W.A.
Sung
R.
Bromberg
J.S.
Murphy
B.
(
2004
)
Differential expression of chemokines and chemokine receptors in murine islet allografts: the role of CCR2 and CCR5 signaling pathways
.
J Am Soc Nephrol
 
15
:
1853
1861
.
Schuller
E.
Teichmann
B.
Haberstok
J.
Moderer
M.
Bieber
T.
Wollenberg
A.
(
2001
)
In situ expression of the costimulatory molecules CD80 and CD86 on langerhans cells and inflammatory dendritic epidermal cells (IDEC) in atopic dermatitis
.
Arch Dermatol Res
 
293
:
448
454
.
Serebrisky
D.
Teper
A.A.
Huang
C.K.
Lee
S.Y.
Zhang
T.F.
Schofield
B.H.
Kattan
M.
Sampson
H.A.
Li
X.M.
(
2000
)
CpG oligodeoxynucleotides can reverse Th2-associated allergic airway responses and alter the B7.1/B7.2 expression in a murine model of asthma
.
J Immunol
 
165
:
5906
5912
.
Shaw
L.
(
2006
)
Effects of probiotics on atopic dermatitis
.
Arch Dis Child
 
91
:
373
.
Taniguchi
Y.
Kohno
K.
Inoue
S.
Koya-Miyata
S.
Okamoto
I.
Arai
N.
Iwaki
K.
Ikeda
M.
Kurimoto
M.
(
2003
)
Oral administration of royal jelly inhibits the development of atopic dermatitis-like skin lesions in NC/Nga mice
.
Int Immunopharmacol
 
3
:
1313
1324
.
Thompson
C.B.
Allison
J.P.
(
1997
)
The emerging role of CTLA-4 as an immune attenuator
.
Immunity
 
7
:
445
450
.
Van Der Sluijs
K.F.
Van Elden
L.J.
Arens
R.
et al
. (
2005
)
Enhanced viral clearance in interleukin-18 gene-deficient mice after pulmonary infection with influenza A virus
.
Immunology
 
114
:
112
120
.
Verhasselt
V.
Goldman
M.
Willems
F.
(
1998
)
Oxidative stress up-regulates IL-8 and TNF-alpha synthesis by human dendritic cells
.
Eur J Immunol
 
28
:
3886
3890
.
Viljanen
M.
Savilahti
E.
Haahtela
T.
Juntunen-Backman
K.
Korpela
R.
Poussa
T.
Tuure
T.
Kuitunen
M.
(
2005
)
Probiotics in the treatment of atopic eczema/dermatitis syndrome in infants: a double-blind placebo-controlled trial
.
Allergy
 
60
:
494
500
.
Vuckovic
S.
Florin
T.H.
Khalil
D.
Zhang
M.F.
Patel
K.
Hamilton
I.
Hart
D.N.
(
2001
)
CD40 and CD86 upregulation with divergent CMRF44 expression on blood dendritic cells in inflammatory bowel diseases
.
Am J Gastroenterol
 
96
:
2946
2956
.
Werner
Y.
Lindberg
M.
(
1985
)
Transepidermal water loss in dry and clinically normal skin in patients with atopic dermatitis
.
Acta Derm Venereol
 
65
:
102
105
.
Weston
S.
Halbert
A.
Richmond
P.
Prescott
S.L.
(
2005
)
Effects of probiotics on atopic dermatitis: a randomised controlled trial
.
Arch Dis Child
 
90
:
892
897
.
Willmann
K.
Dunne
J.F.
(
2000
)
A flow cytometric immune function assay for human peripheral blood dendritic cells
.
J Leukoc Biol
 
67
:
536
544
.
Windhagen
A.
Newcombe
J.
Dangond
F.
Strand
C.
Woodroofe
M.N.
Cuzner
M.L.
Hafler
D.A.
(
1995
)
Expression of costimulatory molecules B7-1 (CD80), B7-2 (CD86), and interleukin 12 cytokine in multiple sclerosis lesions
.
J Exp Med
 
182
:
1985
1996
.
Wu
Y.
Guo
Y.
Huang
A.
Zheng
P.
Liu
Y.
(
1997
)
CTLA-4-B7 interaction is sufficient to costimulate T cell clonal expansion
.
J Exp Med
 
185
:
1327
1335
.
Yawalkar
N.
Karlen
S.
Egli
F.
Brand
C.U.
Graber
H.U.
Pichler
W.J.
Braathen
L.R.
(
2000
)
Down-regulation of IL-12 by topical corticosteroids in chronic atopic dermatitis
.
J Allergy Clin Immunol
 
106
:
941
947
.

Author notes

Present address: Ryo Inoue, Hokkaido University, Creative Research Initiative ‘Sousei’ (CRIS), N21W10 Kita-ku Sapporo 001-0021, Japan.
Editor: Patrik Bavoil