Chlamydia muridarum infection induces CD4⁺ T cells apoptosis via PI3K/AKT signal pathway

ABSTRACT

Apoptosis is essential for the homeostatic control of the lymphocytes number during the development of an immune response to an invasive microorganism. CD4⁺ T cells play a major role in homeostasis of the immune system and are sufficient to confer protection against Chlamydia muridarum (Cm) infection in mice. The present study demonstrated that phosphatidylinositol 3-kinase (PI3K) p110δ mRNA and phosphorylation of protein kinase B (p-AKT) level were significantly increased in lung cells and spleen cells at day 3 and day 7 post-infection, p-AKT level was inhibited when adding PI3K inhibitor LY294002. Moreover, Cm infection induced high levels of IL-2/IL-2Rα in CD4⁺ T cells, which may relate to PI3K/AKT signal pathway activation. We observed that Cm infection significantly induced apoptosis of CD4⁺ T cells. The related apoptosis proteins Bcl-2 and Mcl-1 uneven expression levels were induced in CD4⁺ T cells by Cm infection. These findings provided in vivo and in vitro evidence that Cm infection induces CD4⁺ T cells apoptosis possibly via PI3K/AKT signal pathway.

Chlamydia muridarum, CD4⁺ T cells, apoptosis, PI3K/AKT, Bcl-2/Bax/Mcl-1, IL-2

INTRODUCTION

Chlamydia is an obligate intracellular bacterial pathogen that enters host by infected epithelial cells of the conjunctivae, respiratory and genital tract, results in several types of diseases, including blindness, pelvic inflammatory disease, infertility and newborn pneumonia (Nelson et al. 2005; Mpiga and Ravaoarinoro 2006). The evidence derived from the study to Chlamydial immunity in the animal model demonstrates that protective immunity to Chlamydia trachomatis (Ct) depends on the elicitation of type 1 CD4⁺ and CD8⁺ T cell immune responses (Nogueira et al. 2015). CD4⁺ T cells are necessary and sufficient to confer protection against Ct infection in mice (Morrison et al. 2000; Gondek et al. 2012). Depletion of CD4⁺ T cells, but not depletion of CD8⁺ T cells, diminishes vaccine-induced protection, and more inclusion-forming units (IFU) levels challenges vaginally with Chlamydia muridarum (Cm) (Farris, Morrison and Morrison 2010).

During the development of an immune response to an invasive microorganism, apoptosis is essential for the homeostatic control of the lymphocytes number (Scaffidi et al. 1999). A large majority of activated CD4⁺ T cell effectors died via apoptosis, the left small but relatively stable population of memory cells usually correlates with the decline of inflammation and antigen clearance (Swainet al. 1996; McKinstry, Strutt and Swain 2010). Leishmania braziliensis infection induces apoptosis of host CD4⁺ T lymphocytes (Bertho et al. 2000). Similar to other pathogens, the apoptosis observed at the end of the Chlamydia infection cycle may contribute to the inflammatory response or facilitate release of bacteria from infected cells (Perfettini et al. 2002).

p110δ as the main isoform among the three class I-A phosphatidylinositol 3-kinase (PI3K) is highly enriched in leukocytes (Durand et al. 2009). PI3K/protein kinase B (AKT) signal pathway is important for T cell proliferation and apoptosis (Xu et al. 2002). Previous study showed that Ct infection could activate PI3K/AKT pathway, and inhibition of PI3K/AKT sensitized Ct-infected cells to granzyme B-mediated cell death (Rajalingam et al. 2008). The T cell growth factor and cytokine, interleukin-2 (IL-2) plays a pivotal role in activation-induced cell death (Maher et al. 2005). Upon T cell antigen activation, IL-2/IL-2R binding triggers multiple signal cascades, such as PI3K signals (Fung, Rohwer and McGuire 2003). To a large extent, apoptosis is determined by the Bcl-2 family of proteins in resting T cells. Bcl-2 family members Bcl-2, Bax and Mcl-1 as downstream of the PI3K/AKT signaling pathway are involved in the regulation of T cells apoptosis (Shenoy, Kirschnek and Häcker 2014).

In this study, our data show that Cm infection induces CD4⁺ T cells apoptosis and PI3K/AKT signal pathway activation in CD4⁺ T cells. The related apoptosis proteins Bcl-2 and Mcl-1 uneven expression levels are induced in CD4⁺ T cells by Cm infection. This finding is helpful to understand CD4⁺ T cells function in response to Cm infection.

MATERIALS AND METHODS

Organism and mice infection

Cm as a natural Ct strain of mouse, was grown in Hela 229 cells and purified by discontinuous density gradient centrifugation as described previously (Qiu et al. 2008). For ultraviolet (UV) inactivating, live Cm was exposed to UV light at a distance of 5 cm for 2 h at room temperature, which led to complete inactivating of Cm confirmed by viability testing. Female 6–8 weeks of C57BL/6 mice were purchased from the Military Academy of Medical Sciences Laboratory Animal Center. Cm was used for infection of the mice at a dose of 1 × 10³ IFUs in 40 μl sucrose phosphate glutamic acid buffer by intranasal inhalation. Mice were daily monitored for the body weight change and were sacrificed at indicated time (at day 3, day 7 and day 14) post-infection (p.i.). The animal-use-protocol listed below has been reviewed and approved by the Animal Ethical and Welfare Committee (AEWC) of Tianjin Medical University.

The in vivo growth of the organism

The mice were killed at designed days p.i. and lung tissues were homogenized in 3 ml sucrose phosphate glutamic acid buffer. The tissue supernatants were spun down at 1900 g for 30 min at 4°C. HeLa 229 cell monolayers were inoculated with 100 μl serially diluted tissue supernatants for 48 h at 37°C. Plates were incubated with Chlamydia-specific murine monoclonal antibody and stained with goat anti-mouse IgG conjugated to horseradish peroxidase (HPR). The number of inclusions was counted under a microscope at 100 × magnification. The Chlamydial levels were calculated based on dilution titers of the original inoculum as previously described (Zhang et al. 2010).

Mononuclear cells preparation

Firstly, spleen and lung were aseptically removed at day 3 and day 7 p.i. and were cut into small pieces. Spleen tissue was digested in 2 mg ml⁻¹ collagenase D (Sigma-Aldrich) RPMI 1640 for 30 min at 37°C and lung tissue was digested in containing 2 mg ml⁻¹ collagenase type XI (Sigma-Aldrich) of RPMI 1640 for 60 min at 37°C. A quantity of 2 mM EDTA was added to lung digestion at the last 5 min of incubation. After enzymatic digestion, total lung cells were further enriched by 35% Percoll (Sigma-Aldrich) centrifugation at 2000 rpm for 20 min. Erythrocytes were lysed with ammonium-chloride-potassium lysing buffer. Single-cell suspension of spleen and lung were diluted by proper medium or buffer according to different applications.

CD4⁺ T cells preparation

CD4⁺ T cells were isolated from spleen cells by positive selection using anti-CD4 magnetic beads and MACS LS column (Miltenyi Biotec) according to the manufacturer suggested protocols. The purity of the CD4⁺ T cells was > 90% by flow cytometry using an PE labeled anti-CD4 monoclonal antibody (BD Biosciences).

Flow cytometry analysis

All fluorochrome-conjugated specific (PECY7 anti-mouse CD4, APC anti-mouse CD25), or isotype control mAbs used in flow cytometry analysis were purchased from eBioscience and BD Biosciences. For cell-surface staining, cells were incubated with mAbs for 20 min on ice following by washing in phosphate buffered saline containing 2% bovine serum albumin. Cells were acquired and analyzed using flow cytometry.

Apoptosis assays

A quantity of 100 μl of 1 × 10⁶ cells/ml of mouse spleen and lung mononuclear cells were added to a flow cytometer, 0.2 μl of anti-mouse fluorescent antibody (PECY7 anti-mouse CD3, APC anti-mouse CD4, BD) were injected with 5 μl of Annexin V-FITC and 5 μl of the PI-PE solution, and the cells were incubated for 15 min at room temperature and detected by a flow cytometer (Canto II) according to the method of the apoptosis detection kit (purchased from DOJINDO).

Reverse transcription polymerase chain reaction

Total RNA was extracted from the lung tissue and spleen CD4⁺ T cells by Trizol RNA extraction kit, reversed transcribed to cDNA amplification, PI3K p110δ primer (bp): upstream: AACTCCCAGATCAGCCTCCT, downstream: GGCATGTCCTTGGTGGATAC. Polymerase chain reaction (PCR) reaction conditions were as follows: 94°C for 5 min, at 94°C for 30 sec, 60°C for 45 sec, 72°C for 30 sec and 72°C for 10 min. IL-2 primer (bp): upstream: GAGCAGGATGGAGAATTACAGG, downstream: CGCAGAGGTCCAAGTTCATC. PCR reaction conditions were as follows: 94°C for 5 min, at 94°C for 30 sec, 55°C for 45 sec, 72°C for 30 sec and 72°C for 10 min. The products were analyzed by gel electrophoresis.

Western blot

Total protein was extracted from the lung cells, spleen cells and spleen CD4⁺ T cells from C57BL/6 mice at different infected days, adding the same amount of protein in SDS-PAGE. The primary antibody was incubated overnight. Antibodies: rabbit anti-mouse phosphorylated AKT (p-AKT) Ser473 (CST, 1: 1000), rabbit anti-mouse Bcl-2 (CST, 1: 1000), rabbit anti-mouse Bax (CST, 1: 1000) and rabbit anti-mouse Mcl-1 (CST, 1: 1000) antibodies and PI3K inhibitor LY294002 (CST, 50 μM). Membrane was incubated with anti-rabbit IgG conjugated to horseradish peroxidase and exposed to chemiluminescence detection system.

Statistical analysis

Data were presented as means ± standard error of means (SEMs). Unpaired Student's t test was used to compare the significance of differences between groups and one-way ANOVA was used for analyzing the significance among multiple groups. The statistics significance was considered if P < 0.05.

RESULTS

Cm infection induces PI3K/AKT signal pathway activation

As we have previously shown that C57BL/6 mice were intranasally infected with Cm at day 3 (early stage), day 7 (peak stage) and day 14 (later stage) (Bai et al. 2009; Zhang et al. 2010). Body weight monitoring showed that body weight loss started from day 3 p.i. and dropped to the lowest at day 7 p.i. (Fig. 1A). And the lung bacterial loads (IFUs) were detected from day 3 p.i. and peaked at day 7 p.i. (P < 0.01; Fig. 1B). These data indicate that early stage of Cm infection is on day 3 p.i., and the disease is the most severe on the day 7 p.i.

Figure 1.

Cm infection induces PI3K/AKT signal pathway activation. Mice were inoculated intranasally with 1 × 10³ IFUs of Cm. Mice were monitored daily for body weight change (A), and were sacrificed at day 3, day 7 or day 14 p.i., the lungs were analyzed for in vivo Chlamydia growth as described in Materials and Methods(B). p110δ mRNA expression was measured by RT-PCR at day 3 and day 7 p.i. in lung cells (C and D). Cells were pretreated with LY294002 (LY) with an effective dose at 50 μM for 1 h. p-AKT expression level was detected by western blot at day 3 and day 7 p.i. in lung cells (E and F) and spleen cells (G and H). Data was shown the mean ± SEMs. At least three independent experiments with five mice in each group were performed. *P < 0.05, **P < 0.01, ***P < 0.001 vs the control group, ^###P < 0.001 vs the Cm infection group.

p110δ is the main isoform among the three class I-A PI3Ks involved in T-cell-receptor signaling (Durand et al. 2009). We found that p110δ mRNA expression was increased in lung at day 3 p.i. and significantly increased at day 7 p.i. compared with naïve mice (P < 0.05; P < 0.001; Fig. 1C and D). Moreover, p-AKT was induced at day 3 and dramatically increased at day 7 p.i. in the lung (P < 0.01; P < 0.001; Fig. 1E and F) and spleen cells (P < 0.01; P < 0.001; Fig. 1G and H), which was consistent with that of p110δ mRNA expression. AKT could be activated in a PI3K-dependent or independent manner. p-AKT levels were inhibited both in lung (Fig. 1E and F) and spleen cells (Fig. 1G and H) by adding PI3K inhibitor LY294002 (chemical inhibitors, LY) at day 3 and day 7 p.i. (P < 0.001). These results suggest that Cm infection induces PI3K/AKT signal pathway activation.

Cm infection induces high levels of IL-2/IL-2Rα in CD4⁺ T cells

Previous study showed that IL-2 is a key cytokine vital for T cells activation and regulating T cells apoptosis (Maher et al. 2005). IL-2 mRNA expression was significantly increased at day 7 p.i. in spleen CD4⁺ T cells by reverse transcription (RT)-PCR (P < 0.01; Fig. 2A and B) and the level of CD25 (IL-2Rα) also significantly increased at day 7 p.i. (P < 0.01; Fig. 2C and D) by flow cytometry analysis. IL-2/IL-2Rα binding triggers PI3K signals (Fung, Rohwer and McGuire 2003). p-AKT was significantly inhibited at day 7 p.i. when blocking IL-2 expression in spleen CD4⁺ T cells of infected mice (P < 0.01; Fig. 2E and F). Meanwhile, when adding anti-IL-2 antibody and LY294002 into the cells, p-AKT was further inhibited (P < 0.01; Fig. 2E and F). These results indicate that Cm infection activates IL-2/IL-2Rα, which may relate to PI3K/AKT signal pathway activation.

Figure 2.

Cm infection induces IL-2/IL-2Rα expression in spleen CD4⁺ T cells. Spleen cells and spleen CD4⁺ T cells were isolated at day 3 and 7 p.i. CD4⁺ T cells were cultured at a concentration of 1 × 10⁶ cells/well in the presence or absence of UV-Cm (1 × 10⁵ IFUs/ml) stimulation overnight. IL-2 mRNA expression was measured by RT-PCR at day 3 and day 7 p.i. in spleen CD4⁺ T cells (A and B). The expression of CD25 (IL-2Rα) at day 3 and day 7 p.i. in spleen cells were detected by flow cytometry (C and D). After UV-Cm stimulation overnight, CD4⁺ T cells were pretreated with LY294002 with an effective dose at 50 μM for 1 h and then incubated with 10 μg/ml anti-IL-2 at 37°C for 6 h. p-AKT level was measured by western blot with or without anti-IL-2 and LY294002 in spleen CD4⁺ T cells at day 7 p.i. (E and F). Data was shown the mean ± SEMs. One representative experiment of at least three independent experiments (five mice in each group) is shown. **P < 0.01 vs the control group.

Cm infection induces CD4⁺ T cells apoptosis possibly via PI3K/AKT signal pathway

Accumulating evidences derived from the studies on Chlamydial immunity demonstrated that CD4⁺ T cell immune response is the main protection to Cm infection (Morrison et al. 2000; Gondek et al. 2012). CD4⁺ T cell activity and apoptosis are closely related to its function. Apoptosis of CD4⁺ T cells were analyzed in lung and spleen cells of Cm infected mice and naïve mice by flow cytometry apoptosis assay. The results showed an consistant increase in early apoptosis of CD4⁺ T cells (CD3⁺ CD4⁺ Annexin⁺ PI⁺) (Fig. 3A and B) and total apoptosis of CD4⁺ T cells (CD3⁺ CD4⁺ Annexin⁺ PI) (Fig. 3A and C) at day 3 (P < 0.01) and day 7 (P < 0.001) p.i. in the lung cells. And Cm infection also induced a higher percentage of CD4⁺ T cells total apoptosis at day 3 (P < 0.05) and reached a higher level at day 7 (P < 0.001) p.i. in spleen cells (Fig. 3D and F), while early apoptosis of CD4⁺ T cells was significantly noted at day 7 p.i. in spleen cells (P < 0.01; Fig. 3D and E). These results indicate that Cm infection induces CD4⁺ T cells apoptosis.

Figure 3.

Cm infection induces CD4⁺ T cells apoptosis possibly via PI3K/AKT signal pathway. Lung, spleen and spleen CD4⁺ T cells were collected at day 3 and 7 p.i. The early apoptosis (A and B) and total apoptosis (A and C) of CD4⁺ T cells at day 3 and day 7 p.i. in lung cells were measured by flow cytometry. The early apoptosis (D and E) and total apoptosis (D and F) of CD4⁺ T cells at day 3 and day 7 p.i. in spleen cells were measured by flow cytometry. CD4⁺ T cells were cultured at a concentration of 1 × 10⁶ cells/well in the presence or absence of UV-Cm (1 × 10⁵ IFUs/ml) stimulation overnight, and then were pretreated with LY294002 (LY) with an effective dose at 50 μM for 1 h. p-AKT levels were detected by western blot at day 3 and day 7 p.i. in spleen CD4⁺ T cells with or without adding LY294002 (LY) (G and H). Data was shown as the mean ± SEMs. One representative experiment of at least three independent experiments (five mice in each group) is shown. *P < 0.05, **P < 0.01, ***P < 0.001 vs the control group; ^###P < 0.001 vs the Cm infection group.

To investigate whether Cm infection-induced CD4⁺ T cells apoptosis is related to PI3K/AKT signal pathway, spleen CD4⁺ T cells were enriched by MACS. The results showed that p-AKT was significantly activated at day 3 (P < 0.01) and day 7 (P < 0.001) p.i. in CD4⁺ T cells (Fig. 3G and H), and it was significantly inhibited when adding LY294002 (P < 0.001; Fig. 3G and H). The above results indicate that Cm infection induces CD4⁺ T cells apoptosis possibly via PI3K/AKT signal pathway.

Cm infection-induced CD4⁺ T cells apoptosis is related to uneven levels of Bcl-2 and Mcl-1

Bcl-2 family members, Bcl-2, Bax and Mcl-1 as downstream of the PI3K/AKT signal pathway are involved in the regulation of T cells apoptosis (Shenoy, Kirschnek and Häcker 2014). To determine whether Bcl-2, Bax or Mcl-1 were involved in Cm infection-induced CD4⁺ T cells apoptosis, the expression levels of Bcl-2, Bax and Mcl-1 were detected by western blot in spleen CD4⁺ T cells. Bcl-2 protein level decreased at day 3 and dropped to a lower level at day 7 p.i. (P < 0.01; Fig. 4A and B). While no significant change in Bax protein level was seen after the infection neither at day 3 nor at day 7 p.i. (Fig. 4A and C). The ratio of Bcl-2 to Bax (Bcl-2/Bax) was dramatically decreased at day 3 (P < 0.05) and day 7 (P < 0.001) p.i. (Fig. 4D). Meanwhile, Mcl-1 expression was significantly increased at day 3 (P < 0.01) and day 7 (P < 0.01) p.i. (Fig. 4E and F). These results demonstrate that apoptosis of CD4⁺ T cells is related to uneven expression levels of Bcl-2 and Mcl-1 following Cm infection.

Figure 4.

Cm infection-induced CD4⁺ T cells apoptosis is related to uneven levels of Bcl-2 and Mcl-1. Spleen CD4⁺ T cells were isolated at day 3 and 7 p.i., and then were cultured at a concentration of 1 × 10⁶ cells/well in the presence or absence of UV-Cm (1 × 10⁵ IFUs/ml) stimulation overnight. Bcl-2 (A and B), Bax (A and C) and Mcl-1 (E and F) protein expression levels were detected by western blot at day 3 and day 7 p.i. in spleen CD4⁺ T cells. (D) The ratio Bcl-2 to Bax (Bcl-2/Bax). Data was shown as the mean ± SEMs. At least three independent experiments with five mice in each group were performed. *P < 0.05, **P < 0.01, ***P < 0.001 vs the control group.

DISCUSSION

Apoptosis is essential for homeostatic control of lymphocyte numbers, particularly following the development of an immune response to an invasive microorganism (Scaffidi et al. 1999). Apoptosis of T lymphocytes following Toxoplasma gondii infection was associated with the virulence and density of the parasite in the host (Gavrilescu and Denkers 2001). A large majority of activated CD4⁺ T cell apoptosis usually correlated with the decline of inflammation and antigen clearance following the resolution of a primary immune response (Swain et al. 1996; McKinstry, Strutt and Swain 2010). Sanchez-Torres et al. (2001) found that high CD4⁺ T cells apoptosis associated with high parasitaemia and splenomegaly in CB6F1 mice-infected with Plasmodium chabaudi chabaudi AS.

Previous study has demonstrated that host defensed against Cm infection is primarily dependent on CD4⁺ T cells (Li et al. 2008). Ag-specific CD4⁺ T cells could reduce Chlamydia infection through adoptive immunity in naïve mice (Murphey et al. 2006; Cunningham et al. 2010) and induce protective immunity against infectious agents via the Fas-FasL pathway (Malyshkina et al. 2017). Our previous study suggested that the mice-infected with Cm suffered more severe disease, body weight loss and higher bacterial loads at day 7 p.i. (Bai et al. 2009). In the present study, we found that Cm infection significantly induced CD4⁺ T cells apoptosis at day 7 p.i., and the disease is the most severe on the day 7 p.i. Therefore, one hypothesis is that CD4⁺ T cells apoptosis may correlate with its severity and bacterial loads. This may provide a new insight into the role of CD4⁺ T cells apoptosis in pathogenesis of Cm infection. However, more experiments are needed to futher explore this possibility.

p110δ, a catalytic isoform of Class I PI3K lipid kinases, plays an important role in the development of host protective immune responses (Durand et al. 2009). With respect to the important role of PI3K/AKT pathway in T cell apoptosis (Xu et al. 2002), we found that Cm infection significantly induced p110δ mRNA expression and PI3K/AKT signal pathway activation. IL-2/IL-2R binding could activate PI3K/AKT pathway (Fung, Rohwer and McGuire 2003; Shenoy, Kirschnek and Häcker 2014). Previous study indicated that the frequency of apoptotic CD4⁺ CD25⁺ T cells was significantly increased under IL-2 stimulatory condition tested (Maher et al. 2005; Frazer et al. 2013). We found that Cm infection induced IL-2/IL-2Rα (CD25) expression in CD4⁺ T cells. The level of p-AKT was significantly inhibited when blocking IL-2 expression, suggesting that Cm infection induced IL-2/IL-2Rα expression might associated with activation of PI3K/AKT signal pathway. Previous study demonstrated that TNF-α mediated the PI3K/AKT pathway activation (Wang et al. 2017). And PI3K inhibitor LY294002 prevented AKT phosphorylation as expected and down-regulated the expression of TNF-α in activated macrophages (Eräsalo et al. 2015). In addition, DAB₃₈₉IL-2 (a chimeric fusion protein of IL-2 and diphtheria toxin) treatment could suppress TNF-α expression (Bhopale et al. 2014). Therefore, IL-2 inhibitor and LY294002 are additive in reducing AKT phosphorylation might via inhibiting TNF-α expression in CD4⁺ T cells. Our research revealed the possible relation between PI3K/AKT signal pathway and IL-2 to further affect CD4⁺ T cells apoptosis induced by Cm infection.

Yoo et al. (2002) found that IL-12 suppressed the apoptosis of activated CD4⁺ T cells by upregulating anti-apoptotic molecules through PI3K/AKT pathway. Plasmodium vivax infection induced a higher percentage apoptosis in CD4⁺ T cells, which associated with a reduction of Bcl-2 expression (Hojo-Souza et al. 2015). In our research, we found that Cm infection induced uneven levels of Bcl-2, Bax and Mcl-1 expression in CD4⁺ T cells. Mcl-1 is also an anti-apoptotic molecule, which was significantly increased at day 3 and day 7 p.i. In addition, we found Bcl-2 protein level significantly decreased about 80% at day 7 p.i. whereas the apoptosis of CD4⁺ T cells was increased 4%–8% at day 7 p.i. Taken together, when Bcl-2 expression was extremely low, the anti-apoptotic Mcl-1 could be a survival factor for CD4⁺ T cells. The present results demonstrated that Cm infection-induced CD4⁺ T cells apoptosis correlated with uneven levels of Bcl-2 and Mcl-1.

In summary, our research demonstrated that Cm infection induces CD4⁺ T cells apoptosis possibly via PI3K/AKT/Bcl-2/Mcl-1 signal pathway. The data presented in this work demonstrated a new insight to understand the immunological mechanism of CD4⁺ T cells following Cm infection.

FUNDING

This work was supported by the Key Program from Tianjin Municipal Science and Technology Commission (TSTC) [15JCZDJC34900] to BH*.

Conflict of interest. None declared.