Abstract

The expression of the Flo11 flocculin in Saccharomyces cerevisiae offers the cell a wide range of phenotypes, depending on the strain and the environmental conditions. The most important are pseudohyphae development, invasive growth and flocculation. The mechanism of cellular adhesion mediated by Flo11p is not well understood. Therefore, the N-terminal domain of Flo11p was purified and studied. Although its amino acid sequence shows less similarity with the other flocculins, Flo11p belongs to the flocculin family. However, the N-terminal domain contains the ‘Flo11-domain’ (PF10181), but not the mannose-binding PA14 domain, which is present in the other flocculins (Flo1p, Flo5p, Flo9p and Flo10p). Structural and binding properties of the N-terminal domain of Flo11p were studied. It is shown that this domain is O-glycosylated and is structurally composed mainly of β-sheets, which is typical for the members of the flocculin family. Furthermore, fluorescence spectroscopy binding studies revealed that N-Flo11p does not bind mannose, which is in contrast to the other Flo proteins. However, surface plasmon resonance analysis showed that N-Flo11p self-interacts and explains the cell–cell interaction capacity of FLO11-expressing cells.

Introduction

Saccharomyces cerevisiae shows different phenotypes depending on its genetic background and its environmental condition. The yeast has been commonly studied as a single-cell organism living freely in suspension. However, in its natural environment, the cells frequently switch over from a planktonic life style to complex multicellular structures such as flocs, filaments, mats and flors (Palkova, 2004). These morphological transitions have been suggested as a mechanism for this nonmotile species to permit foraging for nutrients (Gimeno et al., 1992; Iserentant, 1996; Cullen & Sprague, 2000; Dickinson, 2008).

For example, haploid cells become adherent and invade the surface of a semi-solid agar medium, so that they do not wash off. This is called invasive growth, and this morphological switch is caused by glucose depletion around the growing cells (Roberts & Fink, 1994; Cullen & Sprague, 2000). Diploid cells display a similar filamentous transition by adhering to each other after cell division, when sensing a low nitrogen concentration. In diploid pseudohyphal growth, the cells adopt an elongated shape and form long filaments that grow out from the colony edge (Gimeno et al., 1992; Kron et al., 1994; Mosch, 2000). Pseudohyphal development of S. cerevisiae has features in common with dimorphism of pathogenic fungi, where the dimorphic transition is often correlated with pathogenicity. Thus, the molecular models drawn from studies of pseudohyphal development of S. cerevisiae build a valuable basis for studying dimorphism in pathogenic fungi that are experimentally less accessible and therefore offer important insights into the mechanism and control of fungal disease (Mosch, 2000).

Yeast cells exhibit these morphological transitions when a class of genes, encoding flocculins, is present in their genome. More specifically, the adhesion of the cells to substrates, the pseudohyphal and the invasive growth are S. cerevisiae phenotypes resulting from the expression of the FLO11 (also known as MUC1) gene (Lambrechts et al., 1996; Lo & Dranginis, 1998; Rupp et al., 1999). Other phenotypes of S. cerevisiae associated with the FLO11 expression are the formation of mats, complex colony-like structures on low-density semi-solid medium (Reynolds & Fink, 2001; Reynolds et al., 2008); the air–liquid interfacial cellular aggregation in the process of sherry-like wine fermentations, called a flor or velum (Zara et al., 2005; Ishigami et al., 2006); and the adherence to a range of solid surfaces, such as glass, stainless steel, agar and plastics, possibly leading to the development of biofilms (Reynolds & Fink, 2001; Mortensen et al., 2007). Biofilm formation is a severe problem in the medical sector as they offer protection to the cells, for example, by conferring resistance to antifungal drugs (Bryers, 2007).

Furthermore, it was observed that the expression of the FLO11 gene also controls cell–cell adhesion, which leads to the aggregation of the yeast cells into clumps that sediment to the bottom of the fermentor (Lo & Dranginis, 1996; Bayly et al., 2005; Douglas et al., 2007). This phenomenon occurs at the end of the beer fermentation, when almost all fermentable sugars are converted into ethanol and carbon dioxide and is called flocculation.

Remarkably, the flocculation phenotype caused by Flo11p was observed only for Saccharomyces cerevisiae var. diastaticus (Lo & Dranginis, 1996; Bayly et al., 2005; Douglas et al., 2007), and also microscopic flocs consisting of 6–30 cells could be observed under the microscope for the laboratory strains BY4741 and BY4742 (S288C) when Flo11p was overexpressed (Purevdorj-Gage et al., 2007; Van Mulders et al., 2009). The other phenotypes, such as invasive growth, pseudohyphal growth, development of mats and biofilm formation, are mainly associated with S. cerevisiae strain Σ1278b, expressing Flo11p (Lo & Dranginis, 1998; Cullen & Sprague, 2000; Douglas et al., 2007). However, when overexpressed in S. cerevisiae strain Σ1278b, a Flo11p-dependent, but calcium-independent flocculation behaviour was observed (Guo et al., 2000), indicating that an identical adhesin expressed in different yeast strains can exhibit different FLO11-dependent properties. Clearly, other factors must be involved in these phenomena.

The FLO11 gene in S. cerevisiae encodes the Flo11 protein, which is a member of the flocculin family. However, Flo11p is more distantly related to the other flocculins in this family. Indeed, the predicted protein product of FLO11 is 37% similar to the product of FLO1 (26% identical) (Lo & Dranginis, 1996), while the other members of the flocculin family show a higher degree of similarity (Jin & Speers, 1998). The FLO11 gene contains 4101 base pairs and is located on chromosome IX. It encodes a 1367 amino acid cell wall protein assembled by three major domains: a carboxy (C)-terminal domain possessing a glycosylphosphatidylinositol (GPI) remnant to anchor the protein in the cell wall, a central domain containing a highly repeated threonine- and serine-rich sequence and finally an amino (N)-terminal domain located outside the cell wall (Lambrechts et al., 1996; Lo & Dranginis, 1996, 1998).

The wide range of phenotypes that are directly attributed to the FLO11-encoded glycoprotein are based on adhesion events, and therefore, the binding properties of Flo11p were investigated in this study. As Flo11p is an adhesin from the Flo family, where the adhesive properties are located in the N-terminus of the proteins, only the N-terminal domain was examined. In the Pfam database, a domain is associated with this part of Flo11p, which is called the ‘Flo11-domain’ (PF10181), covering residues 42–195. This domain is conserved in some related species within the Saccharomycotina (Linder & Gustafsson, 2008). Moreover, it is suggested that Flo11p shows a lectin activity that is related to amino acids present in the N-terminus, in particular the WQWGT motif (Bayly et al., 2005; Douglas et al., 2007). The N-terminal domain of Flo11p was expressed in S. cerevisiae, purified and studied. The secondary structure of the domain was evaluated as well as the presence of glycans on the protein. Our results show that N-Flo11p is not a mannose-binding protein but can make homotypic interactions.

Materials and methods

Construction of N-FLO11 expression plasmid

The determination of the N-terminal domain of FLO11 was based on the results of Lambrechts et al. (1996). It was proposed that the N-terminal domain stops where the tandem repeats start (at aa 210). Two oligonucleotides [Flo11_3, 5′-(TCCTTAGTCAAAAGGTTTCCAACTGCACTAGTTCCAAGA)-3′; and Flo11_4, 5′-(GGAGATCGGA ATTCGTCAGTGATGGTGATGGTGATGCTTCGTACCGCCACAATTATTGTCA)-3′] were designed to amplify the N-terminal domain of Flo11p coding sequence from the genomic DNA of S. cerevisiae strain S288C. Primer Flo11_4 contains a sequence for 6 histidines to add a histidine tag to the C-terminal part of the protein, which will allow purifying the protein using a Ni-NTA column. The predicted molecular weight of the expressed protein is 22 kDa. The yeast-Escherichia coli shuttle vector pYEX-S1 was used for cloning of the N-terminal part of the FLO11 gene. Cloning was performed using the In-Fusion™ method (Clontech, Mountain View, CA), which is based on the recombination between identical sequences of the vector and the amplified gene (Benoit et al., 2006; Zhu et al., 2007). The construction of the expression plasmid was confirmed by a combination of PCR and DNA sequence analysis (Genetic Service Facility, VIB, Belgium). In the pYEX-S1 vector, the cloned gene is regulated by the strong constitutive phosphoglycerate kinase (PGK) promoter, and this vector includes the β-lactamase gene for selection in E. coli and the yeast-selectable marker URA3. The Flo11p secretion sequence (aa 1–21) was not included during cloning, as the pYEX-S1 vector contains the full-length leader sequence from Kluyveromyces lactis to direct proteins through the secretory pathway for secretion into the growth medium. Transformation into E. coli strain DH5α was carried out using a heat shock as described previously (Sambrook & Russel, 2001). The S. cerevisiae strain S288C BY4741 was transformed using the lithium acetate procedure (Ito et al., 1983; Gietz & Schiestl, 2007).

Expression and purification of the N-terminal domain of Flo11p

Transformed S. cerevisiae cells were cultivated in shake flasks. The cells were grown in yeast extract-peptone-dextrose (YPD) medium containing 1% (w/v) yeast extract, 2% (w/v) peptone and 2% (w/v) d-glucose. Overnight cultures were grown by inoculating 90 mL YPD medium with one pYEX-S1-containing S. cerevisiae colony. Cultures were shaken and incubated at 30 °C. Subsequently, the overnight cultures were diluted into 2 L of YPD medium and allowed to grow to an OD600nm of 10 by incubation at 30 °C for 64 h while shaking (110 r.p.m.). The cells were separated from the medium by centrifugation (12 000 g, 20 min, 4 °C), and the resulting supernatant was adjusted to pH 7.2 to protonate the histidines of the His-tag. The N-terminal domain of Flo11p was captured from the growth medium by affinity chromatography using a nickel-nitrilotriacetic acid (Ni-NTA) Sepharose column (6 mL) and was eluted with 1 M imidazole in phosphate-buffered saline. To further purify N-Flo11p, the elution fractions were pooled, concentrated to 2 mL (using an Amicon centrifugal filter unit with MWCO of 3000 Da; Millipore, Billerica, MA), and subjected to gel filtration chromatography (Superdex 75 HR 10/30; GE Healthcare) in 20 mM Tris, pH 7.5 and 150 mM NaCl. The eluate of the Ni-column and the purified proteins from gel filtration were analysed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE). The concentration of pure N-Flo11p was estimated from the absorption at 280 nm.

Detection of (glyco) proteins

After purifying the N-terminal domain of Flo11p, SDS-PAGE was performed to visualize the protein and to estimate its molecular mass. The gel (15% resolving gel) was stained with Coomassie staining [1 g L−1 Coomassie Brilliant Blue R250, 50% (v/v) methanol, 10% (v/v) acetic acid] for 30 min and destained with 50% (v/v) methanol and 10% (v/v) acetic acid. To visualize glycans, the Pro-Q Emerald 300 Glycoprotein Gel and Blot Stain kit (Invitrogen) was used.

Enzymatic deglycosylation

To remove the N-glycans, the protein was treated with endo-β-N-acetylglucosaminidase H (Endo H; New England Biolabs) at a concentration of 100 U μg−1 protein, in 20 mM Na-acetate buffer (pH 5.0). The mixture was incubated at 37 °C for 4 h.

Circular dichroism

Circular dichroism (CD) measurements were performed with a J715 spectropolarimeter (Jasco) in the far-UV (200–240 nm) region, using a cell with a path length of 0.1 cm. The protein was diluted in 400 μL phosphate buffer (50 mM at pH 7.5) to obtain a final concentration of 0.3 mg mL−1. Data were acquired with a scanning speed of 50 nm min−1, a 2-s integration time and a 1-nm bandwidth at a constant temperature of 25 °C. Six spectra were measured and averaged. The mean residual ellipticity, [θ], was calculated as follows: [θ] = (100 × θm) (cL)−1, where θ is the observed ellipticity, m is the mean residual weight, c is the concentration (mg mL−1) and L is the path length (cm). A quantitative estimation of the secondary structure composition was facilitated by applying the K2D2 method and using the selcon3, continll and cdsstr programs (Provencher & Glockner, 1981; Andrade et al., 1993; Johnson, 1999; Sreerama et al., 1999; Perez-Iratxeta & Andrade-Navarro, 2008).

Fluorescence spectroscopy

The binding of d-(+)-mannose to N-Flo11p was studied by fluorescence spectroscopy. The measurements were performed at 20 °C, using a luminescence spectrometer (model LS55; PerkinElmer, MA). An excitation wavelength of 277 nm, a scan speed of 100 nm min−1 and an excitation and emission slit width of 5 nm were used during the experiments. The initial sample volume was 500 μL, containing 2 μM N-Flo11p in flocculation buffer (50 mM sodium acetate, pH 4.5, 100 mM NaCl and 7 mM CaCl2). One hundred millimolars of mannose from a concentrated stock solution containing 2 M sugar was added to the protein solution, then the sample was mixed and the fluorescence was measured immediately. As a positive control, 100 mM d-(+)-mannose was added to N-Flo1p, under exactly the same conditions. Emission spectra were collected from 300 to 450 nm and corrected relative to a buffer blank. Averages obtained from three independent experiments were displayed on the graph.

Surface plasmon resonance

The interaction of the N-terminal domain of Flo11p to another N-Flo11p was studied by surface plasmon resonance (SPR) using a Biacore 3000TM instrument (GE Healthcare, Upsalla, Sweden) at 25 °C. The covalent immobilization of N-Flo11p in flow cell 2 (FC 2) on the CM5 BIAsensor chip was accomplished via amine coupling chemistry, using an amino coupling kit (BIAcore; GE Healthcare) with 20 mM sodium acetate pH 4.0 as immobilization buffer. Glycosylated N-Flo11p was immobilized to a response around 95 resonance units (RU). Flow cell 1 (FC 1) was treated in the same way as FC 2 except that it was blocked immediately after activation and was used as the reference surface to subtract the RU as a result of the refractive index of the protein solution and any instrument noise.

Increasing concentrations ranging from 11 nM to 90 μM of glycosylated N-Flo11p were allowed to flow across both flow cells FC 1 and FC 2 of the CM5 chip containing N-Flo11p. The experiment was carried out in HBS buffer [20 mM Hepes pH 7.4, 150 mM NaCl, 10 mM CaCl2 and 0.005% (v/v) Tween 20]. No binding was detected in the control flow cells. Complete dissociation of N-Flo11p was performed with HBS buffer before starting a new binding cycle. The association time was 3 min, and the dissociation time was 7 min. Additionally, a zero concentration cycle of N-Flo11p (injection of running buffer) was run to determine the effect of the buffer. All measurements were performed at a flow rate of 20 μL min−1 in HBS buffer, and the proteins were dialysed to exactly the same buffer (Spectra/Por® Dialysis membrane, 3500 Da MWCO; Spectrum Laboratories, Inc., CA). The buffer was filtered through a 0.45-μm filter (MF-Millipore™ membrane filter) and degassed before usage.

The results were analysed with the BIAevaluation software version 4.1 (GE Healthcare). Binding was observed by measuring the increase in RU when injecting different concentrations of the analyte and after subtracting the background response.

Results

Expression and purification of N-Flo11p

N-Flo11p was captured from the growth medium using a nickel column and was eluted with imidazole. The eluate was analysed by SDS-PAGE, and staining of the proteins revealed two bands with different molecular masses (Fig. 1a). N-terminal sequencing and mass spectrometric analysis of the protein bands revealed that the upper band corresponds to N-Flo11p. Four peptides belonging to N-Flo11p were identified after trypsin digestion (FPTALVPRG, KENIDLKY, KYLWSLKI and KIIGVTGPKG). To further purify N-Flo11p, the elution fractions were subjected to gel filtration chromatography. The purified protein was visualized with SDS-PAGE (Fig. 1b), and the concentration was estimated from the absorption at 280 nm. The yield obtained with this purification protocol was about 0.5 mg L−1 culture.

1

(a) SDS-PAGE of the eluted proteins after affinity chromatography using a Ni-column. The Coomassie-stained gel shows that two protein bands with different molecular masses were purified. Mass spectroscopy revealed that the upper band corresponds to N-Flo11p as indicated with an arrow. Lane 1, molecular mass marker; lane 2, eluted fraction from the Ni-column. (b) SDS-PAGE of N-Flo11p after gel-filtration chromatography. The gel is Coomassie-stained. Lane 1, molecular mass marker; lane 2, pure N-Flo11p. (c) SDS-PAGE of N-Flo11p treated with Endo H. The gel is Coomassie-stained. Lane 1, molecular mass marker; lane 2, untreated N-Flo11p; and lane 3, N-Flo11p treated with Endo H to remove the N-glycans. (d) SDS-PAGE of N-Flo11p. The gel was stained with the Pro-Q Emerald 300 Glycoprotein Gel and Blot Stain kit to visualize glycans on the proteins. Lane 1, molecular mass marker; lane 2, glycosylated N-Flo11p.

1

(a) SDS-PAGE of the eluted proteins after affinity chromatography using a Ni-column. The Coomassie-stained gel shows that two protein bands with different molecular masses were purified. Mass spectroscopy revealed that the upper band corresponds to N-Flo11p as indicated with an arrow. Lane 1, molecular mass marker; lane 2, eluted fraction from the Ni-column. (b) SDS-PAGE of N-Flo11p after gel-filtration chromatography. The gel is Coomassie-stained. Lane 1, molecular mass marker; lane 2, pure N-Flo11p. (c) SDS-PAGE of N-Flo11p treated with Endo H. The gel is Coomassie-stained. Lane 1, molecular mass marker; lane 2, untreated N-Flo11p; and lane 3, N-Flo11p treated with Endo H to remove the N-glycans. (d) SDS-PAGE of N-Flo11p. The gel was stained with the Pro-Q Emerald 300 Glycoprotein Gel and Blot Stain kit to visualize glycans on the proteins. Lane 1, molecular mass marker; lane 2, glycosylated N-Flo11p.

The N-terminal domain of Flo11p is O-glycosylated

The calculated molecular mass of the N-terminal domain of Flo11p without glycosylation is 22 kDa. On the SDS gel (Fig. 1b), it is observed that N-Flo11p corresponds to this molecular mass, which indicates that the protein is not N-glycosylated. This observation is in accordance with the prediction of N-glycosylation sites based on the amino acid sequence of the N-terminal domain of Flo11p (data not shown). To confirm the absence of N-glycans on N-Flo11p, the protein was treated with Endo H and visualized with SDS-PAGE (Fig. 1c). No decrease in molecular mass of N-Flo11p is observed. Hence, it is concluded that no N-glycans are present on the N-terminal domain of Flo11p.

O-glycosylation often occurs in a region of the protein that contains a high proportion of serine and threonine, with neighbouring proline residues (Lehle & Bause, 1984). In the amino acid sequence of the N-terminal domain of Flo11p, several threonine (18), serine (14) and proline (7) residues are found. To verify whether N-Flo11p contains O-glycans, the SDS gel containing N-Flo11p was stained with the Pro-Q Emerald 300 Glycoprotein Gel and Blot Stain kit (Fig. 1d). This staining procedure allows the visualization of glycans. As N-Flo11p can be visualized on the SDS gel, it is concluded that N-Flo11p is O-glycosylated.

N-Flo11p is mainly composed of β-sheets

A CD spectrum of N-Flo11p was recorded in the far-UV spectrum to investigate its secondary structure (Fig. 2). The observed spectrum is typical for folded proteins, and its shape, exhibiting one minimum around 215 nm, indicates a prevalence of β-sheets. The fitting of the CD spectrum, using the method of Perez-Iratxeta and Andrade-Navarro, indicates a β-sheet content of 48% and an α-helix content of 4% (Perez-Iratxeta & Andrade-Navarro, 2008). In addition, secondary structure content deconvolution of the spectrum, using the selcon3, continll and cdsstr programs, suggested that the β-sheet content was 31%, 40.5% and 42.8%, respectively. The α-helix content was also evaluated with the same programs. Values of 2%, 3% and 2.8% were found for the α-helix content using selcon3, continll and cdsstr, respectively. On average, the secondary structure of N-Flo11p contains about 40.6% β-sheets and 3.0% α-helices.

2

Far-UV CD spectrum of N-Flo11p.

2

Far-UV CD spectrum of N-Flo11p.

N-Flo11p does not bind mannose

A pentapeptide in the N-terminal ligand-binding domain of several yeast adhesins was identified to be involved in sugar recognition (Kobayashi et al., 1998; Zupancic et al., 2008). In the case of the epithelian adhesins proteins from Candida glabrata, this pentapeptide is the EYDGA motif (Zupancic et al., 2008). In the flocculin family from S. cerevisiae, the amino acids interacting with the carbohydrate are found in the VSWGT motif (Kobayashi et al., 1998). This pentapeptide is well conserved among the members of the flocculin family (Bayly et al., 2005; Van Mulders et al., 2009; Veelders et al., 2010). The tryptophan residue at position 228, which is present in all the studied adhesins with the exception of Lg-Flo1, was shown to be involved in mannose recognition through binding with the C-2 hydroxyl group of mannose (Kobayashi et al., 1998; Veelders et al., 2010). Aligning the binding region of the flocculins shows convincingly that Flo11p also contains the crucial tryptophan residue (Fig. 3). In binding studies using fluorescence spectroscopy, the quenching of this residue upon binding with mannose can be followed by measuring the intensity of the emission peak at 350 nm (Goossens et al., 2011). For N-Flo1p – a known mannose-binding protein – the fluorescence intensity decreases to approximately 50% of the initial value upon the addition of 100 mM mannose (dashed line in Fig. 4). In contrast, no change in the intensity of the emission peak at 350 nm was observed upon addition of 100 mM mannose to N-Flo11p (Fig. 4). This result indicates that mannose does not interact with the N-terminal domain of Flo11p, in contrast to the other flocculins (Flo1p, Flo5p, Flo9p and Flo10p).

3

Multiple sequence alignment of the amino acid sequences involved in sugar recognition of the Flo1, Flo5, Flo9, Flo10 and Flo11 adhesins from Saccharomyces cerevisiae. The region corresponding to the pentapeptide, containing the amino acids that interact with the carbohydrate (Kobayashi et al., 1998; Zupancic et al., 2008), is marked as a grey box. The conserved tryptophan residue is outlined in red.

3

Multiple sequence alignment of the amino acid sequences involved in sugar recognition of the Flo1, Flo5, Flo9, Flo10 and Flo11 adhesins from Saccharomyces cerevisiae. The region corresponding to the pentapeptide, containing the amino acids that interact with the carbohydrate (Kobayashi et al., 1998; Zupancic et al., 2008), is marked as a grey box. The conserved tryptophan residue is outlined in red.

4

Emission spectrum of N-Flo11p compared with the N-Flo11p spectrum with the addition of mannose from a stock solution to a final concentration of 100 mM. Averages of three independent experiments are shown. As a positive control, the decrease of the fluorescence signal upon addition of 100 mM mannose to a known mannose-binding protein (N-Flo1p) is shown in the graph.

4

Emission spectrum of N-Flo11p compared with the N-Flo11p spectrum with the addition of mannose from a stock solution to a final concentration of 100 mM. Averages of three independent experiments are shown. As a positive control, the decrease of the fluorescence signal upon addition of 100 mM mannose to a known mannose-binding protein (N-Flo1p) is shown in the graph.

N-Flo11p molecules self-interact

Recently, a homotypic adhesive mechanism has been detected for Flo11p (Douglas et al., 2007). The whole Flo11 protein was purified and covalently attached to microscopic beads. The Flo11p-coated beads were able to bind S. cerevisiae var. diastaticus expressing Flo11p, but not to cells that do not express Flo11p. Therefore, Flo11p itself was considered as an important adhesive target on the cell wall for Flo11p, if not the only target (Douglas et al., 2007).

In our study, we have assessed the homotypic interaction of the N-terminal domain of Flo11p. SPR was used to determine qualitatively the binding between N-Flo11 proteins. Therefore, N-Flo11p was coupled to a BIAsensor chip, and increasing concentrations of N-Flo11p (11 nM, 88 nM, 350 nM, 5.6 μM, 11.2 μM, 22.5 μM, 45 μM and 90 μM) were flown over that chip allowing the proteins to interact. The clear concentration-dependent increase in signal indicates that N-Flo11p is able to bind to N-Flo11p, which is called a homotypic interaction (Fig. 5).

5

SPR sensorgram of N-Flo11p–N-Flo11p interactions N-Flo11p was covalently coupled to a CM5 chip at 95 relative units (RU), and an N-Flo11p solution with the indicated concentrations was injected. A concentration-dependent interaction between immobilized N-Flo11p and injected N-Flo11p at different concentrations (11 nM, 88 nM, 350 nM, 56 μM, 112 μM, 225 μM, 45 μM and 90 μM) was observed.

5

SPR sensorgram of N-Flo11p–N-Flo11p interactions N-Flo11p was covalently coupled to a CM5 chip at 95 relative units (RU), and an N-Flo11p solution with the indicated concentrations was injected. A concentration-dependent interaction between immobilized N-Flo11p and injected N-Flo11p at different concentrations (11 nM, 88 nM, 350 nM, 56 μM, 112 μM, 225 μM, 45 μM and 90 μM) was observed.

Discussion

The flocculin encoded by the FLO11 gene is responsible for a wide variety of phenotypes exhibited by S. cerevisiae cells expressing this Flo11p. These include haploid invasive growth (Roberts & Fink, 1994; Cullen & Sprague, 2000), development of pseudohyphae (Gimeno et al., 1992; Kron et al., 1994; Mosch, 2000), biofilm formation (Reynolds & Fink, 2001), mat formation (Reynolds & Fink, 2001; Reynolds et al., 2008), flor formation (Zara et al., 2005; Ishigami et al., 2006), adhesion to surfaces (Lo & Dranginis, 1998; Reynolds & Fink, 2001; Mortensen et al., 2007) and flocculation (Lo & Dranginis, 1996; Bayly et al., 2005). These cellular adhesion phenomena are mediated by Flo11p, but the mechanism is not well understood at the molecular level and very little is known about the structure and function of the protein. Therefore, in this study, this versatile flocculin was purified and studied.

The members of the flocculin family are composed of three domains, and the binding activity is located in the N-terminal part (Bony et al., 1997; Kobayashi et al., 1998; Goossens et al., 2011). Other adhesins from both pro- and eukaryotic origin also possess their binding domain at the distal tip of the protein. For example, FimH is the lectin domain at the tip of type 1 pili from E. coli and recognizes terminal mannose units of uroplakin Ia, a membrane glycoprotein that is abundantly expressed on superficial epithelial umbrella cells of the urinary tract (Zhou et al., 2001); the N-terminal part of Als1p from Candida albicans interacts with extracellular matrix proteins, epithelial and endothelial cells (Loza et al., 2004; Sheppard et al., 2004; Donohue et al., 2011). Also, it was suggested that Flo11p shows a lectin activity that is related to amino acids present in the N-terminus (Bayly et al., 2005; Douglas et al., 2007). For these reasons, only the N-terminal domain of Flo11p was cloned, expressed and purified from S. cerevisiae to study its structural and binding properties.

In this study, the purified N-Flo11p was analysed by SDS-PAGE, and it was found that this domain is decorated with O-glycans and does not contain N-glycans. Moreover, the secondary structure was evaluated by CD. By analysing the spectrum, we calculated that the secondary structure of N-Flo11p contains about 40.6% β-sheets and 3.0% α-helices. These values are comparable with the percentages found for N-Flo1p (37.7% β-sheets and 6.5% α-helices) (Goossens et al., 2011). The prevalence of β-sheets in the N-terminal domain is typical for flocculins. This part of most of the flocculins has been assigned to a new domain family (PF07691) in Pfam (Finn et al., 2010) (http://pfam.sanger.ac.uk), called the PA14 domain (Rigden et al., 2004). The PA14 domain is a conserved domain that has been discovered in a wide variety of bacterial and eukaryotic proteins, which include many glycosidases, glycosyltransferases, proteases, amidases, bacterial toxins, such as anthrax protective antigen (PA), and also yeast adhesins. Most of the experimentally characterized PA14-containing proteins are involved in carbohydrate binding and/or metabolism. Therefore, the N-terminal domains of the member proteins of the flocculin family were considered as one of the many PA14 domain variants (Rigden et al., 2004). The anthrax toxin PA also contains a PA14 domain, and the crystal structure of this toxin revealed that this domain consists of a series of antiparallel β-strands (Petosa et al., 1997). Although a PA14 domain was not predicted for Flo11p (Goossens & Willaert, 2010), the secondary fold of the N-terminal part of the protein is also dominated by β-sheets.

The fact that the Flo11 flocculin does not contain this PA14 domain indicates that no lectin activity was predicted. Indeed, by fluorescence spectroscopy, it was shown that N-Flo11p is not able to bind mannose (Fig. 4). Glycan array screening for N-Flo11p confirmed this result (Consortium for Functional Glycomics, www.functionalglycomics.org, request 2078 and 1224, supplying investigator: Lars-Oliver Essen, Department of Chemistry/Biochemistry, Philipps-Universität Marburg, Germany). The Flo11 protein was tested for its interaction with 465 different glycan structures (version 4.1) printed on an array (request 2078) and 377 glycan structures (version 3.1) (request 1224), but no conclusive data were obtained for glycan interaction analysis of N-Flo11p with and without the GST tag, N-Flo11p with a His-tag and after dimerization of N-Flo11p. No binding to mannose or to any other glycans from the array was detected. The detection was based on fluorescence as the adhesin was directly labelled with the fluorophore ‘Alexa 488’. Other members of the flocculin family, however, are able to bind mannose, and their N-terminal domains correspond to the PA14 domain (Rigden et al., 2004). Indeed, a clear lectin activity was demonstrated for N-Flo1p and N-Flo5p (Veelders et al., 2010; Goossens et al., 2011).

In contrast, Douglas et al. (2007) indirectly detected mannose-binding activity for Flo11p. The whole Flo11 protein was purified from the growth medium after overexpression in S. cerevisiae var. diastaticus or in S. cerevisiae Σ1278b. It was observed that beads coated with Flo11p were able to bind S. cerevisiae var. diastaticus cells expressing Flo11p. This interaction was inhibited by the addition of a high (1 M) concentration of mannose, which suggests that Flo11p is a member of the Flo1-type flocculins and functions as a lectin in S. cerevisiae var. diastaticus (Douglas et al., 2007). Moreover, by studying the interaction between the coated beads and yeast cells, it was put forward that Flo11p shows a homotypic interaction (Douglas et al., 2007). Indeed, the beads could only interact with yeast cells that express Flo11p, suggesting that Flo11p itself is an important part of the adhesive target on the cell wall, if not the only target.

In this study, the homotypic binding of Flo11 proteins was confirmed by SPR as a clear and concentration-dependent interaction of N-Flo11p molecules was observed (Fig. 5). The mechanism of this interaction cannot be based on a lectin–carbohydrate interaction. The protein–protein interaction could be based on electrostatic and hydrophobic interactions, and influenced by the presence of the O-glycans (Fig. 1). Also, yeast cells expressing Flo11p have a highly hydrophobic character (Reynolds & Fink, 2001; Van Mulders et al., 2009), although the link between the hydrophobicity of the cell wall and the presence of expressed Flo11p on the cell wall is not yet clear. Recently, it was suggested that the whole Flo11 protein has a hydrophilic character (Karunanithi et al., 2010).

Recently, it has been demonstrated that many adhesins from budding yeasts contain amyloid-forming sequences that can play a role in cell–cell interactions (Otoo et al., 2008; Alsteens et al., 2010; Frank et al., 2010; Nobbs et al., 2010; Ramsook et al., 2010; Garcia et al., 2011). These adhesins contain sequences with high β-aggregation potential; VVSTTV and VTTAVTTTVV were indicated for the full Flo11p (Ramsook et al., 2010) (these sequences are, however, not present in the N-terminal part of Flo11p). Experimental results indicate that amyloid formation leads to the bundling of adhesins into nanodomains, which can greatly increase the intercellular binding strength by increasing the avidity (Douglas et al., 2007; Ramsook et al., 2010) and, consequently, can reinforce the Flo11p homotypic interactions between cells. It has been shown that an applied force can induce the formation of these nanodomains (Alsteens et al., 2010) and that they can be regulated by exogenous peptides (Garcia et al., 2011). Experimental results also suggest that amyloids are formed between adhesion molecules on contacting cells (Rauceo et al., 2004; Ramsook et al., 2010). Such intercellular amyloids would also strengthen the protein–protein intercellular adhesive bonds.

In conclusion, this study describes for the first time the purification and subsequent characterization of the N-terminal domain of Flo11p, a flocculin exhibiting a plethora of phenotypes. SPR analysis showed a homotypic interaction. However, in contrast to the other Flo proteins, N-Flo11p does not bind mannose. The exact mechanism of this protein–protein interaction and the involvement of the O-glycans have still to be revealed.

Acknowledgements

We thank Prof. J. E. Edwards (Division of Infectious Diseases, Medicine Deptartment, Harbor-UCLA, CA, USA) for providing us with the pYEX-S1 vector. We also acknowledge Msc. Catherine Stassen and Prof. Dr. Bart Devreese (L-Probe, Ghent University) for the mass spectrometry analysis. This work was supported by the European Space Agency (Prodex program), the Institute for the promotion of Innovation by Science and Technology in Flanders (IWT) and the Research Council of the VUB.

References

Alsteens
D
Garcia
MC
Lipke
PN
Dufrene
YF
(
2010
)
Force-induced formation and propagation of adhesion nanodomains in living fungal cells
.
P Natl Acad Sci USA
 
107
:
20744
20749
.
Andrade
MA
Chacon
P
Merelo
JJ
Moran
F
(
1993
)
Evaluation of secondary structure of proteins from UV circular dichroism spectra using an unsupervised learning neural network
.
Protein Eng
 
6
:
383
390
.
Bayly
JC
Douglas
LM
Pretorius
IS
Bauer
FF
Dranginis
AM
(
2005
)
Characteristics of Flo11-dependent flocculation in Saccharomyces cerevisiae
.
FEMS Yeast Res
 
5
:
1151
1156
.
Benoit
RM
Wilhelm
RN
Scherer-Becker
D
Ostermeier
C
(
2006
)
An improved method for fast, robust, and seamless integration of DNA fragments into multiple plasmids
.
Protein Expr Purif
 
45
:
66
71
.
Bony
M
Thines-Sempoux
D
Barre
P
Blondin
B
(
1997
)
Localization and cell surface anchoring of the Saccharomyces cerevisiae flocculation protein Flo1p
.
J Bacteriol
 
179
:
4929
4936
.
Bryers
JD
(
2008
)
Medical biofilms
.
Biotechnol Bioeng
 
100
:
1
18
.
Cullen
PJ
Sprague
GF
Jr
(
2000
)
Glucose depletion causes haploid invasive growth in yeast
.
P Natl Acad Sci USA
 
97
:
13619
13624
.
Dickinson
JR
(
2008
)
Filament formation in Saccharomyces cerevisiae – a review
.
Folia Microbiol (Praha)
 
53
:
3
14
.
Donohue
DS
Ielasi
F
Goossens
KY
Willaert
RG
(
2011
)
The Als1 protein from Candida albicans specifically binds fucose-containing glycans
.
Mol Microbiol
 
80
:
1667
1679
.
Douglas
LM
Li
L
Yang
Y
Dranginis
AM
(
2007
)
Expression and characterization of the flocculin Flo11/Muc1, a Saccharomyces cerevisiae mannoprotein with homotypic properties of adhesion
.
Eukaryot Cell
 
6
:
2214
2221
.
Finn
RD
Mistry
J
Tate
J
et al.   (
2010
)
The Pfam protein families database
.
Nucleic Acids Res
 
38
:
D211
D222
.
Frank
AT
Ramsook
C
Otoo
HN
Tan
C
Soybelman
G
Rauceo
JM
Gaur
NK
Klotz
SA
Lipke
PN
(
2010
)
Structure and function of glycosylated tandem repeats from Candida albicans Als adhesins
.
Eukaryot Cell
 
9
:
405
414
.
Garcia
MC
Lee
JT
Ramsook
CB
Alsteens
D
Dufrene
YF
Lipke
PN
(
2011
)
A role for amyloid in cell aggregation and biofilm formation
.
PLoS ONE
 
6
:
e17632
.
Gietz
RD
Schiestl
RH
(
2007
)
High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method
.
Nat Protoc
 
2
:
31
34
.
Gimeno
CJ
Ljungdahl
PO
Styles
CA
Fink
GR
(
1992
)
Unipolar cell divisions in the yeast S. cerevisiae lead to filamentous growth: regulation by starvation and RAS
.
Cell
 
68
:
1077
1090
.
Goossens
K
Willaert
R
(
2010
)
Flocculation protein structure and cell-cell adhesion mechanism in Saccharomyces cerevisiae
.
Biotechnol Lett
 
32
:
1571
1585
.
Goossens
KV
Stassen
C
Stals
I
Donohue
DS
Devreese
B
De Greve
H
Willaert
RG
(
2011
)
The N-terminal domain of the Flo1 flocculation protein from Saccharomyces cerevisiae binds specifically to mannose carbohydrates
.
Eukaryot Cell
 
10
:
110
117
.
Guo
B
Styles
CA
Feng
Q
Fink
GR
(
2000
)
A Saccharomyces gene family involved in invasive growth, cell-cell adhesion, and mating
.
P Natl Acad Sci USA
 
97
:
12158
12163
.
Iserentant
D
(
1996
)
Practical aspects of yeast flocculation
.
Cerevisiae
 
21
:
30
33
.
Ishigami
M
Nakagawa
Y
Hayakawa
M
Iimura
Y
(
2006
)
FLO11 is the primary factor in flor formation caused by cell surface hydrophobicity in wild-type flor yeast
.
Biosci Biotechnol Biochem
 
70
:
660
666
.
Ito
H
Fukuda
Y
Murata
K
Kimura
A
(
1983
)
Transformation of intact yeast cells treated with alkali cations
.
J Bacteriol
 
153
:
163
168
.
Jin
Y-L
Speers
RA
(
1998
)
Flocculation of Saccharomyces cerevisiae
.
Food Res Int
 
31
:
421
440
.
Johnson
WC
(
1999
)
Analyzing protein circular dichroism spectra for accurate secondary structures
.
Proteins
 
35
:
307
312
.
Karunanithi
S
Vadaie
N
Chavel
CA
Birkaya
B
Joshi
J
Grell
L
Cullen
PJ
(
2010
)
Shedding of the mucin-like flocculin Flo11p reveals a new aspect of fungal adhesion regulation
.
Curr Biol
 
20
:
1389
1395
.
Kobayashi
O
Hayashi
N
Kuroki
R
Sone
H
(
1998
)
Region of Flo1 proteins responsible for sugar recognition
.
J Bacteriol
 
180
:
6503
6510
.
Kron
SJ
Styles
CA
Fink
GR
(
1994
)
Symmetric cell division in pseudohyphae of the yeast Saccharomyces cerevisiae
.
Mol Biol Cell
 
5
:
1003
1022
.
Lambrechts
MG
Bauer
FF
Marmur
J
Pretorius
IS
(
1996
)
Muc1, a mucin-like protein that is regulated by Mss10, is critical for pseudohyphal differentiation in yeast
.
P Natl Acad Sci USA
 
93
:
8419
8424
.
Lehle
L
Bause
E
(
1984
)
Primary structural requirements for N- and O-glycosylation of yeast mannoproteins
.
Biochim Biophys Acta
 
799
:
246
251
.
Linder
T
Gustafsson
CM
(
2008
)
Molecular phylogenetics of ascomycotal adhesins–a novel family of putative cell-surface adhesive proteins in fission yeasts
.
Fungal Genet Biol
 
45
:
485
497
.
Lo
WS
Dranginis
AM
(
1996
)
FLO11, a yeast gene related to the STA genes, encodes a novel cell surface flocculin
.
J Bacteriol
 
178
:
7144
7151
.
Lo
WS
Dranginis
AM
(
1998
)
The cell surface flocculin Flo11 is required for pseudohyphae formation and invasion by Saccharomyces cerevisiae
.
Mol Biol Cell
 
9
:
161
171
.
Loza
L
Fu
Y
Ibrahim
AS
Sheppard
DC
Filler
SG
Edwards
JE
Jr
(
2004
)
Functional analysis of the Candida albicans ALS1 gene product
.
Yeast
 
21
:
473
482
.
Mortensen
HD
Dupont
K
Jespersen
L
Willats
WG
Arneborg
N
(
2007
)
Identification of amino acids involved in the Flo11p-mediated adhesion of Saccharomyces cerevisiae to a polystyrene surface using phage display with competitive elution
.
J Appl Microbiol
 
103
:
1041
1047
.
Mosch
HU
(
2000
)
Pseudohyphal development of Saccharomyces cerevisiae
.
Contrib Microbiol
 
5
:
185
200
.
Nobbs
AH
Vickerman
MM
Jenkinson
HF
(
2010
)
Heterologous expression of Candida albicans cell wall-associated adhesins in Saccharomyces cerevisiae reveals differential specificities in adherence and biofilm formation and in binding oral Streptococcus gordonii
.
Eukaryot Cell
 
9
:
1622
1634
.
Otoo
HN
Lee
KG
Qiu
W
Lipke
PN
(
2008
)
Candida albicans Als adhesins have conserved amyloid-forming sequences
.
Eukaryot Cell
 
7
:
776
782
.
Palkova
Z
(
2004
)
Multicellular microorganisms: laboratory versus nature
.
EMBO Rep
 
5
:
470
476
.
Perez-Iratxeta
C
Andrade-Navarro
MA
(
2008
)
K2D2: estimation of protein secondary structure from circular dichroism spectra
.
BMC Struct Biol
 
8
:
25
.
Petosa
C
Collier
RJ
Klimpel
KR
Leppla
SH
Liddington
RC
(
1997
)
Crystal structure of the anthrax toxin protective antigen
.
Nature
 
385
:
833
838
.
Provencher
SW
Glockner
J
(
1981
)
Estimation of globular protein secondary structure from circular dichroism
.
Biochemistry
 
20
:
33
37
.
Purevdorj-Gage
B
Orr
ME
Stoodley
P
Sheehan
KB
Hyman
LE
(
2007
)
The role of FLO11 in Saccharomyces cerevisiae biofilm development in a laboratory based flow-cell system
.
FEMS Yeast Res
 
7
:
372
379
.
Ramsook
C
Tan
C
Garcia
MC
et al.   (
2010
)
Yeast cell adhesion molecules have functional amyloid-forming sequences
.
Eukaryot Cell
 
9
:
393
404
.
Rauceo
JM
Gaur
NK
Lee
KG
Edwards
JE
Klotz
SA
Lipke
PN
(
2004
)
Global cell surface conformational shift mediated by a Candida albicans adhesin
.
Infect Immun
 
72
:
4948
4955
.
Reynolds
TB
Fink
GR
(
2001
)
Bakers’ yeast, a model for fungal biofilm formation
.
Science
 
291
:
878
881
.
Reynolds
TB
Jansen
A
Peng
X
Fink
GR
(
2008
)
Mat formation in Saccharomyces cerevisiae requires nutrient and pH gradients
.
Eukaryot Cell
 
7
:
122
130
.
Rigden
DJ
Mello
LV
Galperin
MY
(
2004
)
The PA14 domain, a conserved all-beta domain in bacterial toxins, enzymes, adhesins and signaling molecules
.
Trends Biochem Sci
 
29
:
335
339
.
Roberts
RL
Fink
GR
(
1994
)
Elements of a single MAP kinase cascade in Saccharomyces cerevisiae mediate two developmental programs in the same cell type: mating and invasive growth
.
Genes Dev
 
8
:
2974
2985
.
Rupp
S
Summers
E
Lo
HJ
Madhani
H
Fink
G
(
1999
)
MAP kinase and cAMP filamentation signaling pathways converge on the unusually large promoter of the yeast FLO11 gene
.
EMBO J
 
18
:
1257
1269
.
Sambrook
J
Russel
DW
(
2001
)
Preparation and transformation of competent E. coli using calcium chloride
.
Molecular Cloning: A Laboratory Manual
  (
Sambrook
J
Russel
DW
, eds), pp.
1116
1118
.
Cold Spring Harbor Laboratory Press
,
New York
.
Sheppard
DC
Yeaman
MR
Welch
WH
Phan
QT
Fu
Y
Ibrahim
AS
Filler
SG
Zhang
M
Waring
AJ
Edwards
JE
Jr
(
2004
)
Functional and structural diversity in the Als protein family of Candida albicans
.
J Biol Chem
 
279
:
30480
30489
.
Sreerama
N
Venyaminov
SY
Woody
RW
(
1999
)
Estimation of the number of alpha-helical and beta-strand segments in proteins using circular dichroism spectroscopy
.
Protein Sci
 
8
:
370
380
.
Van Mulders
SE
Christianen
E
Saerens
SM
Daenen
L
Verbelen
PJ
Willaert
R
Verstrepen
KJ
Delvaux
FR
(
2009
)
Phenotypic diversity of Flo protein family-mediated adhesion in Saccharomyces cerevisiae
.
FEMS Yeast Res
 
9
:
178
190
.
Veelders
M
Bruckner
S
Ott
D
Unverzagt
C
Mosch
HU
Essen
LO
(
2010
)
Structural basis of flocculin-mediated social behavior in yeast
.
P Natl Acad Sci USA
 
107
:
22511
22516
.
Zara
S
Bakalinsky
AT
Zara
G
Pirino
G
Demontis
MA
Budroni
M
(
2005
)
FLO11-based model for air-liquid interfacial biofilm formation by Saccharomyces cerevisiae
.
Appl Environ Microbiol
 
71
:
2934
2939
.
Zhou
G
Mo
WJ
Sebbel
P
Min
G
Neubert
TA
Glockshuber
R
Wu
XR
Sun
TT
Kong
XP
(
2001
)
Uroplakin Ia is the urothelial receptor for uropathogenic Escherichia coli: evidence from in vitro FimH binding
.
J Cell Sci
 
114
:
4095
4103
.
Zhu
B
Cai
G
Hall
EO
Freeman
GJ
(
2007
)
In-fusion assembly: seamless engineering of multidomain fusion proteins, modular vectors, and mutations
.
BioTechniques
 
43
:
354
359
.
Zupancic
ML
Frieman
M
Smith
D
Alvarez
RA
Cummings
RD
Cormack
BP
(
2008
)
Glycan microarray analysis of Candida glabrata adhesin ligand specificity
.
Mol Microbiol
 
68
:
547
559
.

Author notes

Editor: Jens Nielsen