Abstract

Using two types of genome-wide analysis to investigate yeast genes involved in response to lactic acid and acetic acid, we found that the acidic condition affects metal metabolism. The first type is an expression analysis using DNA microarrays to investigate ‘acid shock response’ as the first step to adapt to an acidic condition, and ‘acid adaptation’ by maintaining integrity in the acidic condition. The other is a functional screening using the nonessential genes deletion collection of Saccharomyces cerevisiae. The expression analysis showed that genes involved in stress response, such as YGP1, TPS1 and HSP150, were induced under the acid shock response. Genes such as FIT2, ARN1 and ARN2, involved in metal metabolism regulated by Aft1p, were induced under the acid adaptation. AFT1 was induced under acid shock response and under acid adaptation with lactic acid. Moreover, green fluorescent protein-fused Aft1p was localized to the nucleus in cells grown in media containing lactic acid, acetic acid, or hydrochloric acid. Both analyses suggested that the acidic condition affects cell wall architecture. The depletion of cell-wall components encoded by SED1, DSE2, CTS1, EGT2, SCW11, SUN4 and YNL300W and histone acetyltransferase complex proteins encoded by YID21, EAF3, EAF5, EAF6 and YAF9 increased resistance to lactic acid. Depletion of the cell-wall mannoprotein Sed1p provided resistance to lactic acid, although the expression of SED1 was induced by exposure to lactic acid. Depletion of vacuolar membrane H+-ATPase and high-osmolarity glycerol mitogen-activated protein kinase proteins caused acid sensitivity. Moreover, our quantitative PCR showed that expression of PDR12 increased under acid shock response with lactic acid and decreased under acid adaptation with hydrochloric acid.

Introduction

Saccharomyces cerevisiae is used for making fermented foods such as breads and alcoholic drinks. Sourdough, which is used in traditional breadmaking, is a spontaneously fermented mixture of flour and water containing yeasts, lactic acid bacteria, or acetic acid bacteria (Ng et al., 1972; Foschino et al., 2004). The organic acids from these microorganisms decrease the pH in sourdough. Sake mash and shochu moromi also contain organic acids and have low pH values. Organic acids produced by their normal fermentation as well as by competing microorganisms frequently inhibit growth of S. cerevisiae. However, the S. cerevisiae used for sake making is more resistant to organic acids than competing bacteria or wild yeasts. In this report, the condition with organic acids and low pH, such as found in sourdough, sake mash, and shochu moromi, is termed the acidic condition.

Previous studies have examined how some organic acids inhibit the growth of microorganisms (Narendranath et al., 2001; Thomas et al., 2002). The genetic mechanism involved in organic acid inhibition of the growth of yeasts has been studied (Casal et al., 1996; Ludovico et al., 2001; Paiva et al., 2004). Some organic acids are used as energy sources by some microorganisms. In S. cerevisiae cultures that are low in fermentable sugars, acetic acid and lactic acid are taken up from the medium and metabolized to acetyl-coenzyme A (CoA), which enters the TCA and glyoxylate cycles to fulfil the needs for energy and biosynthetic metabolites (Casal et al., 1996; Flores et al., 2000). However, a high concentration of organic acids is stressful. Organic acid stress is not simply owing to the toxic effect of a high hydrogen ion concentration, but is also dependent on the chemical nature of the organic acid to which the organism is exposed (Bayrock & Ingledew et al., 2004). Organic acids exert stronger inhibitory effects at low pH, where they are substantially undissociated.

Several studies have examined the effects of food preservatives, such as sorbic acid and benzoic acid, on S. cerevisiae (Holyoak et al., 1996, 1999; Piper et al., 1998, 2001; Bauer et al., 2003; Mollapour et al., 2004; Schuller et al., 2004). These studies have indicated the importance of the Pdr12 ATP-binding cassette transporter in the development of resistance to some weak acids. Growth of S. cerevisiae in the presence of such moderately lipophilic carboxylate preservatives is dependent on the induction of a specific stress response, involving the War1p transcription factor-dependent induction of Pdr12p (Schuller et al., 2004).

Citric acid also imposes a toxic effect on S. cerevisiae in high concentrations. A previous study (Lawrence et al., 2004) has indicated that the high-osmolarity glycerol mitogen-activated protein kinase (HOG MAPK) pathway regulates a unique stress response in S. cerevisiae upon exposure to citric acid. Citric acid does not induce osmotic stress, but it does induce a general stress response and glycerol biosynthesis. The inhibitory effects of citric acid are counteracted by a number of cellular proteins, including transcription factors mediating glucose depression, enzymes involved in amino acid biosynthesis, calcium transport channels, and the vacuolar membrane H+-ATPase (V-ATPase).

Microorganisms are able to adapt quickly to acidic environments such as those encountered in the mammalian stomach, whose low pH is due to hydrochloric acid (Tucker et al., 2002; Wen et al., 2003). In this report, the rapid response to an acidic environment by lactic acid, acetic acid or hydrochloric acid is termed the ‘acid shock response’ and is considered as the first step to adapt to an acidic condition. Microorganisms in fermented foods such as sourdough are affected by acids in the long term, which we call ‘acid adaptation’ and consider to be the result of maintaining integrity in the acidic condition.

The study of the yeast response to organic acids and low pH is important in the food industry. Moreover, S. cerevisiae is useful for studying the general response of eukaryotes to organic acids. We describe the genes involved in the organic acid response of S. cerevisiae using lactic acid and acetic acid. Hydrochloric acid was used as a low-pH control. To characterize the genes involved in the response to the acidic condition, we screened by two types of genome-wide analysis. One is an expression change using DNA microarrays, and the other a functional screening using the nonessential genes deletion collection of S. cerevisiae.

Materials and methods

Strains and media

Saccharomyces cerevisiae S288C was used for the expression analysis using DNA microarrays. Saccharomyces cerevisiae BY4742 was a parent strain of the nonessential genes deletion collection (openbiosystems), which contains 4908 yeast strains with all nonessential ORFs disrupted by the kanMX4 cassette (http://www-sequence.stanford.edu/group/yeast_deletion_project/deletions3.html). Yeast green fluorescent protein (GFP) clone ID YGL071W (Invitrogen, Carlsbad, CA) was used for visualizing Aft1p. YNB medium (0.67% yeast nitrogen base without amino acids, 2% glucose) was used for DNA microarrays, and SC Amino Acid Mixture (BIO 101 Systems, Irvine, CA) was added to YNB medium for yeast GFP clones. Yeast cells were grown in YPD medium (2% glucose, 1% yeast extract, 2% Bacto-peptone).

Gene expression analysis

The acid concentrations to be used in the DNA microarray analysis were determined so that the time of growth from OD660=0.5 to 1.0 was double that for the untreated culture. For the study of acid shock response, cells were grown to early-log phase (OD660=1.0) in YNB and then l-lactic acid 0.3% (weight in volume, w/v), acetic acid 0.3% (w/v) or hydrochloric acid 0.03% (w/v) were added to the cultures. The corresponding pH values of the media were 2.8, 3.3 and 2.6, respectively. Then, the cells were incubated at 30°C for 30 min. For the study of acid adaptation, cells from overnight cultures in YNB were suspended in fresh YNB with l-lactic acid 0.3% (w/v), acetic acid 0.3% (w/v) or hydrochloric acid 0.03% (w/v) to OD660=0.1 (the corresponding pH values of cultures were 2.8, 3.2 and 2.5, respectively) and grown at 30°C until an OD660 of 0.95–1.05 was reached. Cells were collected and centrifuged at 2000 g for 5 min, then washed twice with distilled water and stored at −80°C until RNA preparation. Total RNA was collected by the hot-phenol method (Kohrer & Domdey et al., 1991) and then labelled with Cy5-dCTP or Cy3-dCTP. Yeast chip v. 2.0 (DNA Chip Research, Yokohama, Japan) was used according to the manufacturer's instructions. Arrays were scanned using a commercially available scanning laser microscope (Fla 8000, Fuji Photo Film, Tokyo, Japan) and analysed using ArrayGuage v. 2.0 (Fuji Photo Film). The data obtained from four independent hybridizations per each condition were normalized using GeneSpring v. 6.2.1 (Silicon Genetics, Palo Alto, CA) and then analysed by FunCat (MIPS, Neuherberg, Germany) and GO Term Finder (SGD, Stanford, CA). The data were mathematically transformed subsequent to clustering analysis by dividing the expression ratios for each gene measured on a given array by the corresponding ratios measured for the cells grown in YNB. The data were graphically displayed in tabular format in which each row of coloured boxes represents the variation in transcript abundance for each gene and each column represents the variation in transcript levels of every gene in a given mRNA sample. The variations in transcript abundance for each gene were depicted by means of a colour scale, in which shades of red represent increases and shades of green represent decreases in mRNA levels, relative to the untreated culture, and the saturation of the colour corresponds to the magnitude of the differences. A dendrogram constructed during the clustering process depicted the relationships between genes: the branch lengths represented the degree of similarity between genes based on their expression profiles.

Functional screening using the nonessential genes deletion collection

The acid concentrations added to the media for selection were determined by a preliminary spotting experiment. Different amounts of BY4742 cells (106, 104 and 102 cells) were spotted on media containing various acid concentrations and incubated for 72 h at 30°C.

The acid concentrations and pH values of the solid media for the functional screening were as follows: l-lactic acid 3.1% (w/v) (for sensitivity, pH 2.9) and 5.1% (w/v) (for resistance, pH 2.7), acetic acid 0.4% (w/v) (for sensitivity, pH 4.3) and 0.5% (w/v) (for resistance, pH 4.2), or hydrochloric acid 0.24% (w/v) (for sensitivity, pH 2.6) and 0.28% (w/v) (for resistance, pH 2.4) was added to YPD medium after autoclaving. Mutant strains were transferred to standard 96-well microtitre plates. These plates replicated screening media after incubation for 3 days at 30°C. The growth of strains on screening media was confirmed visually after 3 days at 30°C. The data were analysed by FunCat (MIPS) and GO Term Finder (SGD).

Quantitative PCR

Total RNA was collected as described above for the DNA microarray analysis, and reverse-transcribed with an ExScript RT reagent Kit (Takara Bio, Otsu, Shiga, Japan). Primers were designed to yield an 87-bp product for AFT1 (CCATTCCAACAGCTACAATCCC and CATTACTGTTAGTGGGCAATACGAC), a 125-bp product for PDR12 (CACATATGCCACCAAAGTCGGTAA and TTGTGGCGTTATCCCAAGAGTAG) and a 110-bp product for ACT1 (as a control; ACTTACAACTCCATCATGAAGTGTG and TGCATTCTTTCGGCAATACCTG). Quantitative PCR was performed with qPCR Master Mix Plus for SYBR Green (Eurogenetec, Seraing, Belgium) by GeneAmp5700 Sequence Detection System (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. DNA was amplified with an initial 2-min incubation at 50°C and 10-min incubation at 95°C followed by 40 cycles of 15 s at 95°C and 1 min at 60°C.

GFP microscopy

Yeast GFP clone ID YGL071W was used for visualizing Aft1p. Cells were cultured under the same conditions as the acid adaptation conditions of the DNA microarray analysis. DNA was counterstained with 4′,6-diamidino-2-phenylindole, dihydrochloride (DAPI). Fluorescence of cells was visualized on an ECLIPSE E600 microscope (Nikon, Tokyo, Japan) using the appropriate filter set.

Results

Gene expression analysis and clustering analysis

For studying S. cerevisiae response to the acidic condition, we performed DNA microarray analysis using lactic acid and acetic acid, in addition to hydrochloric acid as a low-pH control. Those genes whose expression level changed as compared with acid-absent media are detailed in Tables S1–S4 (lactic acid), Tables S5–S8 (acetic acid), Tables S9–S12 (hydrochloric acid), Tables S1, S3, S5, S7, S9 and S11 (induced), Tables S2, S4, S6, S8, S10 and S12 (repressed), Tables S1, S2, S5, S6, S9 and S10 (acid shock) and Tables S3, S4, S7, S8, S11 and S12 (acid adaptation). Genes involved in stress response such as YGP1, TPS1 and HSP150 were induced under the acid shock conditions (Tables S1, S5 and S9, and Fig. 1). Genes involved in metal metabolism such as FIT2, ARN1 and ARN2 were induced under the acid adaptation conditions (Tables S3, S7 and S11, and Fig. 1). Moreover, the genes involved in stress response such as YGP1, DAK2 and HSP26 were induced in the presence of acetic acid even under the acid adaptation condition (Table S7). Genes involved in nitrogen metabolism such as ASP3, DAL5 and ATO3 were repressed under all conditions (Tables S2, S4, S6, S8, S10 and S12).

1

The expression profiles of 277 genes whose expression levels changed in at least one condition. The tree is connected from the bottom column to the top of the next column and so on. (a–c) Acid shock, (d–f) acid adaptation. (a) and (d) are with lactic acid, (b) and (e) are with acetic acid, and (c) and (f) are with hydrochloric acid. Each horizontal strip represents a single gene, whose name is indicated on the right. The fold change is represented by colour indicated on the colour bar. Genes in bold typeface are localized or organized on the cell wall. Genes that are underlined are involved in metal metabolism.

1

The expression profiles of 277 genes whose expression levels changed in at least one condition. The tree is connected from the bottom column to the top of the next column and so on. (a–c) Acid shock, (d–f) acid adaptation. (a) and (d) are with lactic acid, (b) and (e) are with acetic acid, and (c) and (f) are with hydrochloric acid. Each horizontal strip represents a single gene, whose name is indicated on the right. The fold change is represented by colour indicated on the colour bar. Genes in bold typeface are localized or organized on the cell wall. Genes that are underlined are involved in metal metabolism.

Figure 1 shows a clustering analysis of the genes whose expression level changed under at least one of the six conditions. The 277 genes whose expression changed included many plasma membrane proteins, such as the transporters. Although some amino acid transporters were repressed under all conditions, some metal transporters and hexose transporters were induced at least under acid adaptation conditions.

Genes involved in metal homeostasis such as ARN1, CCC2, FIT1-3, CUP1 and SIT1 were also induced at least under acid adaptation conditions. Most of these genes were regulated by Aft1p, a transcription factor that responds to intracellular iron (Yamaguchi-Iwai et al., 1996; Rutherford et al., 2003). Most of Aft1p-regulated genes (FRE1-3, FRE5, FIT1-3, COT1, SIT1 and FET3) were in the same cluster; they did not change significantly under acid shock but were induced under acid adaptation. The regulation of Aft1p is associated with mitochondrial Fe–S cluster and iron concentration (Chen et al., 2004; Phadnis & Ayres Sia et al., 2004). LEU1 and ACO1, which encode Fe–S cluster proteins (Puig et al., 2005), decreased expression under all conditions (Fig. 1). A cell-wall protein encoded by SED1 and an uncharacterized protein encoded by VMR1, which are also regulated by Aft1p (Rutherford et al., 2003), were induced under all conditions (Fig. 1).

Sed1p is known as a cell-wall mannoprotein, which is highly expressed in the stationary phase (Shimoi et al., 1998). The genes encoding cell-wall components such as SCW10, HSP150 and CRH1 were induced under all conditions. We found that yeast cell aggregation was observed under the acidic conditions (data not shown). These aspects suggest that the acidic condition induced changes in cell-wall architecture.

Expression change of AFT1 and localization of Aft1p under the acid adaptation condition

DNA microarray analysis suggested that the acidic condition affects metal metabolism regulated by Aft1p in yeast. Because AFT1 is not one of the genes on the DNA microarray chip, we measured its expression change with quantitative PCR. AFT1 was found to be induced under acid shock response (2.3-fold for lactic acid, 3.5-fold for acetic acid, 1.8-fold for hydrochloric acid), and 2.5-fold under acid adaptation by lactic acid. A previous study (Yamaguchi-Iwai et al., 2002) had shown that iron-regulated expression of the target genes by Aft1p is due to the transport of Aft1p into the nucleus, rather than to the change in the total expression level of Aft1p. Therefore, we examined the subcellular localization of GFP-fused Aft1p (Fig. 2). We observed that GFP-fused Aft1p was localized to the nucleus in cells grown in media containing lactic acid, acetic acid or hydrochloric acid. By contrast, GFP-fused Aft1p was not localized to the nucleus in cells grown in YNB medium. These results indicated that the nuclear localization of Aft1p is important under the acidic condition.

2

Localization of green fluorescent protein-fused Aft1p. Cells were grown in media containing lactic acid, acetic acid or hydrochloric acid at 30°C until an OD660 of 0.95–1.05 was reached. DNA was counterstained with 4′,6-diamidino-2-phenylindole, dihydrochloride (DAPI). Fluorescence of cells was visualized on an ECLIPSE E600 microscope (Nikon) by using the appropriate filter set. DIC, differential interference contrast microscopy.

2

Localization of green fluorescent protein-fused Aft1p. Cells were grown in media containing lactic acid, acetic acid or hydrochloric acid at 30°C until an OD660 of 0.95–1.05 was reached. DNA was counterstained with 4′,6-diamidino-2-phenylindole, dihydrochloride (DAPI). Fluorescence of cells was visualized on an ECLIPSE E600 microscope (Nikon) by using the appropriate filter set. DIC, differential interference contrast microscopy.

A functional screening using the nonessential genes deletion collection

Functional screening was used to identify important genes under the acidic condition. The minimal inhibitory concentrations (w/v) of lactic acid, acetic acid and hydrochloric acid were 5.1, 0.5 and 0.3%, respectively (Fig. 3). The corresponding pH values were 2.7, 4.2 and 2.3.

3

Growth of Saccharomyces cerevisiae BY4742 is inhibited in the presence of acids. (a) Yeast cells were spotted onto YPD medium to give 106, 104 and 102 cells per spot. Plates were incubated for 72 h at 30°C before the plates were photographed. (b) Yeast cells were spotted onto YPD media with lactic acid at the indicated concentration (w/v). The cell number and culture condition were the same as in (a). The same tests were carried out with: (c) acetic acid and (d) hydrochloric acid. The pH values of media were: YPD (pH 6.1); YPD with lactic acid 2.1% (pH 3.1), 4.2% (pH 2.7) and 5.1% (pH 2.7); YPD with acetic acid 0.3% (pH 4.4), 0.4% (pH 4.3) and 0.5% (pH 4.2); YPD with hydrochloric acid 0.26% (pH 2.5), 0.28% (pH 2.4) and 0.30% (pH 2.3).

3

Growth of Saccharomyces cerevisiae BY4742 is inhibited in the presence of acids. (a) Yeast cells were spotted onto YPD medium to give 106, 104 and 102 cells per spot. Plates were incubated for 72 h at 30°C before the plates were photographed. (b) Yeast cells were spotted onto YPD media with lactic acid at the indicated concentration (w/v). The cell number and culture condition were the same as in (a). The same tests were carried out with: (c) acetic acid and (d) hydrochloric acid. The pH values of media were: YPD (pH 6.1); YPD with lactic acid 2.1% (pH 3.1), 4.2% (pH 2.7) and 5.1% (pH 2.7); YPD with acetic acid 0.3% (pH 4.4), 0.4% (pH 4.3) and 0.5% (pH 4.2); YPD with hydrochloric acid 0.26% (pH 2.5), 0.28% (pH 2.4) and 0.30% (pH 2.3).

Of 4908 yeast deletion strains, approximately 1% showed resistance and approximately 3–5% showed sensitivity to each acid. The deletion strains showing increased resistance to the organic acids and low pH by hydrochloric acid are indicated in Table 1. Although in the deletion strains identified by our functional analysis diverse cellular functions were involved with acetic acid and hydrochloric acid, the depletion of cell-wall components encoded by SED1, DSE2, CTS1, EGT2, SCW11, SUN4 and YNL300W and histone acetyltransferase complex proteins encoded by YID21, EAF3, EAF5, EAF6 and YAF9 increased resistance to lactic acid media (Table 1). Depletion of the cell-wall mannoprotein encoded by SED1 provided resistance to lactic acid, although the expression of SED1 was induced by exposure to lactic acid. Therefore, the genes involved in cell-wall component genes were identified as important for response to organic acids and low pH, especially lactic acid, as indicated by both the expression analysis and the functional analysis.

1

Resistance to acids

ORF name Gene Lactic acid Acetic acid Hydrochloric acid ORF name Gene Lactic acid Acetic acid Hydrochloric acid 
Cell wall Other function 
YLR286C CTS1   YLR131C ACE2  
YHR143W DSE2   YPL078C ATP4 
YNL327W EGT2 YJR092W BUD4   
YGL028C SCW11  YML012W ERV25   
YDR077W SED1   YGL080W FMP37   
YNL300W   YAL034C FUN19   
Histone acetyltransferase YAL031C FUN21   
YPR023C EAF3  YLL060C GTT2   
YEL018W EAF5   YNL215W IES2   
YJR082C EAF6   YNL265C IST1  
YDR359C VID21   YPL135W ISU1   
YNL107W YAF9   YPR138C MEP3   
Vacuolar transport YPL226W NEW1  
YCL038C ATG22   YDL046W NPC2  
YBR131W CCZ1  YPL159C PET20   
YHL002W HSE1   YOL136C PFK27   
YLR119W SRN2  YMR302C PRP12  
YAL014C SYN8  YMR063W RIM9   
YGL212W VAM7   YIL018W RPL2B   
YGL104C VPS73   YLR325C RPL38  
YPL019C VTC3   YML073C RPL6A   
YML001W YPT7   YBL103C RTG3   
Protein fate YMR305C SCW10  
YBR170C NPL4   YPL047W SGF11 
YCR008W SAT4   YMR140W SIP5  
YDL134C PPH21   YKR072C SIS2   
YDL137W ARF2   YJL151C SNA3  
YDR092W UBC13 YBR194W SOY1  
YEL053C MAK10   YDL048C STP4  
YER005W YND1   YDR346C SVF1  
YER120W SCS2   YDR058C TGL2   
YGR270W YTA7   YHL009C YAP3   
YGR285C ZUO1   YBR111C YSA1  
YJL168C SET2   YJR127C ZMS1   
YJL186W MNN5  YAL045C    
YJR075W HOC1   YCL062W    
YKL126W YPK1  YDR360W    
YML013W SEL1  YDR509W    
YMR154C RIM13   YEL043W   
YMR275C BUL1   YER113C    
YNR032W PPG1   YFR044C    
YNR069C BSC5  YGL177W    
Biogenesis of cellular components YGR206W   
YAL051W OAF1   YIL110W    
YCL063W VAC17   YJL051W   
YDL225W SHS1   YJL182C    
YDL240W LRG1   YJL206C    
YGL200C EMP24   YLR111W    
YIL146C ECM37   YLR346C   
YNL066W SUN4   YML082W    
YPL246C RBD2   YML084W    
YDR227W SIR4   YMR294W-a    
Cell fate YMR310C   
YER124C DSE1   YOL070C    
YNL325C FIG4   YOR240W    
YOR083W WHI5   YOR289W    
YPL176C         
YPL191C        
YPL194W        
ORF name Gene Lactic acid Acetic acid Hydrochloric acid ORF name Gene Lactic acid Acetic acid Hydrochloric acid 
Cell wall Other function 
YLR286C CTS1   YLR131C ACE2  
YHR143W DSE2   YPL078C ATP4 
YNL327W EGT2 YJR092W BUD4   
YGL028C SCW11  YML012W ERV25   
YDR077W SED1   YGL080W FMP37   
YNL300W   YAL034C FUN19   
Histone acetyltransferase YAL031C FUN21   
YPR023C EAF3  YLL060C GTT2   
YEL018W EAF5   YNL215W IES2   
YJR082C EAF6   YNL265C IST1  
YDR359C VID21   YPL135W ISU1   
YNL107W YAF9   YPR138C MEP3   
Vacuolar transport YPL226W NEW1  
YCL038C ATG22   YDL046W NPC2  
YBR131W CCZ1  YPL159C PET20   
YHL002W HSE1   YOL136C PFK27   
YLR119W SRN2  YMR302C PRP12  
YAL014C SYN8  YMR063W RIM9   
YGL212W VAM7   YIL018W RPL2B   
YGL104C VPS73   YLR325C RPL38  
YPL019C VTC3   YML073C RPL6A   
YML001W YPT7   YBL103C RTG3   
Protein fate YMR305C SCW10  
YBR170C NPL4   YPL047W SGF11 
YCR008W SAT4   YMR140W SIP5  
YDL134C PPH21   YKR072C SIS2   
YDL137W ARF2   YJL151C SNA3  
YDR092W UBC13 YBR194W SOY1  
YEL053C MAK10   YDL048C STP4  
YER005W YND1   YDR346C SVF1  
YER120W SCS2   YDR058C TGL2   
YGR270W YTA7   YHL009C YAP3   
YGR285C ZUO1   YBR111C YSA1  
YJL168C SET2   YJR127C ZMS1   
YJL186W MNN5  YAL045C    
YJR075W HOC1   YCL062W    
YKL126W YPK1  YDR360W    
YML013W SEL1  YDR509W    
YMR154C RIM13   YEL043W   
YMR275C BUL1   YER113C    
YNR032W PPG1   YFR044C    
YNR069C BSC5  YGL177W    
Biogenesis of cellular components YGR206W   
YAL051W OAF1   YIL110W    
YCL063W VAC17   YJL051W   
YDL225W SHS1   YJL182C    
YDL240W LRG1   YJL206C    
YGL200C EMP24   YLR111W    
YIL146C ECM37   YLR346C   
YNL066W SUN4   YML082W    
YPL246C RBD2   YML084W    
YDR227W SIR4   YMR294W-a    
Cell fate YMR310C   
YER124C DSE1   YOL070C    
YNL325C FIG4   YOR240W    
YOR083W WHI5   YOR289W    
YPL176C         
YPL191C        
YPL194W        

A plus sign indicates that the gene deletion strain has a resistance to the acid.

Proteins encoded by VMA2, VMA4, and VMA6, whose depletion causes sensitivity to all acids, were hydrogen-translocating V-ATPase complex proteins localized in the vacuole (Table 2). These findings suggest that the vacuole is essential for growth on organic acid media and at low pH. Depletion of the hyperosmolarity response proteins encoded by HOG1, PBS2, SSK1 and SSK2, which are in the HOG MAPK pathway, also resulted in acid sensitivity (Table 2). This result agrees with a study of the citric acid response of S. cerevisiae (Lawrence et al., 2004).

2

Sensitivity to acids

ORF name Gene Lactic acid Acetic acid Hydrochloric acid ORF name Gene Lactic acid Acetic acid Hydrochloric acid 
Cellular transport, transport facilitation and transport routes 
Vacuolar transport Vesicular transport (Golgi network etc.) 
YBR164C ARL1  –  YFL025C BST1 – – – 
YBR290W BSD2  –  YNL051W COG5 –   
YGL206C CHC1 – – – YAL026C DRS2 – – – 
YGR167W CLC1 – – – YGL054C ERV14  –  
YEL027W CUP5 – – – YGR166W KRE11 –  – 
YKL002W DID4   – YJL053W PEP8 –  – 
YCR034W FEN1  –  YKL212W SAC1 – – – 
YOR070C GYP1   – YIL076W SEC28 –   
YKL176C LST4  –  YMR183C SSO2  –  
YNL297C MON2 –   YLR372W SUR4  –  
YDR456W NHX1 –   YOR132W VPS17   – 
YLR148W PEP3 – – – YOR069W VPS5 –  – 
YMR231W PEP5 – – – YNL064C YDJ1  –  
YDR323C PEP7 – – – YLR262C YPT6 – –  
YLR025W SNF7 – – – Ion transport     
YDL185W TFP1   – YJR121W ATP2  –  
YPL234C TFP3  – – YMR038C CCS1 – – – 
YOL018C TLG2 –  – YLL027W ISA1  –  
YPR036W VMA13 –  – YNL291C MID1 –  – 
YBR127C VMA2 – – – YEL017C–A PMP2  –  
YOR332W VMA4 – – – YHR026W PPA1 – – – 
YKL080W VMA5 – – – YJL129C TRK1 – – – 
YLR447C VMA6 – – – Other     
YGR020C VMA7 – – – YGL148W ARO2 – – – 
YEL051W VMA8   – YBR068C BAP2 – –  
YKR001C VPS1 – – – YBR021W FUR4 – – – 
YBR097W VPS15 – – – YGL084C GUP1 – – – 
YPL045W VPS16 – – – YDR138W HPR1   – 
YMR077C VPS20 – – – YKL073W LHS1  –  
YOR089C VPS21 –   YDR432W NPL3  –  
YKL041W VPS24   – YMR091C NPL6   – 
YJR102C VPS25 – – – YBL079W NUP170  –  
YHR012W VPS29 –  – YPL148C PPT2  –  
YDR495C VPS3 – – – YJL204C RCY1 –   
YLR240W VPS34 –  – YDR137W RGP1 – – – 
YJL154C VPS35 –   YLR039C RIC1 – – – 
YLR417W VPS36 – –  YOL072W THP1  – – 
YGL095C VPS45 – – – YCR053W THR4 –  – 
YKR020W VPS51 – – – YPR156C TPO3  –  
YPR139C VPS66  –  YLR337C VRP1  –  
YML097C VPS9 –  –      
YDR136C  – – –      
Protein fate (folding, modification, destination) 
Protein modification 
YPL227C ALG5   – YGL194C HOS2  –  
YOR002W ALG6   – YKL101W HSL1   – 
YOR067C ALG8   – YGL203C KEX1   – 
YEL036C ANP1  –  YNL307C MCK1  – – 
YBR128C ATG14  – – YOL076W MDM20  –  
YLR423C ATG17  –  YJL183W MNN11  –  
YJL095W BCK1 –  – YDR140W MTQ2 – – – 
YGR262C BUD32 – – – YGL038C OCH1 – – – 
YGR036C CAX4  – – YDL232W OST4 – – – 
YKL190W CNB1 –  – YGL058W RAD6 –   
YKL139W CTK1  – – YBL082C RHK1   – 
YML112W CTK3 – – – YMR214W SCJ1  –  
YGR227W DIE2   – YDL047W SIT4   – 
YJL184W GON7 – – – YOL113W SKM1   – 
YPL254W HFI1 – – – YCR033W SNT1  –  
YJR075W HOC1  –  YJL127C SPT10  –  
YOL148C SPT20   – YMR304W UBP15  –  
YDR392W SPT3   – YML115C VAN1  –  
YAL016W TPD3  – – YLR020C YEH2  –  
Interaction with the cellular environment 
Osmosensing Cellular sensing and response 
YLR113W HOG1 –  – YDL100C ARR4  –  
YBR260C RGD1 –  – YPL161C BEM4  –  
YJL128C PBS2 –  – YCR002C CDC10   – 
YHR030C SLT2 –  – YOL051W GAL11  – – 
YLR006C SSK1   – YER068W MOT2   – 
YNR031C SSK2   – YBR289W SNF5 – –  
Ionic homeostasis YHL025W SNF6 – –  
YBR036C CSG2 –  – YJL176C SWI3 – –  
YKR007W MEH1  –  YPL129W TAF14   – 
YKL040C NFU1  –       
YCR044C PER1   –      
YPL188W POS5 – –       
YJR104C SOD1 –  –      
YKL119C VPH2 – – –      
Metabolism 
Amino acid metabolism C-compound and carbohydrate metabolism 
YDR173C ARG82   – YER155C BEM2  – – 
YDR127W ARO1 – – – YOR299W BUD7  –  
YAL021C CCR4  – – YGL027C CWH41   – 
YIR023W DAL81  –  YLR342W FKS1  –  
YAL044C GCV3  –  YPL262W FUM1  –  
YEL046C GLY1 – – – YMR307W GAS1 – – – 
YDR158W HOM2 –  – YHR183W GND1  –  
YER052C HOM3 –  – YNL322C KRE1   – 
YER086W ILV1 – – – YPR159W KRE6   – 
YLR451W LEU3  –  YGL035C MIG1  –  
YFL018C LPD1  –  YGR240C PFK1  –  
YIL128W MET18 –   YMR205C PFK2  –  
YOR323C PRO2  –  YNR052C POP2 – – – 
YHL011C PRS3 – –  YBR229C ROT2   – 
YHR025W THR1 –  – YJL121C RPE1  –  
YDR007W TRP1  –  YGR229C SMI1  – – 
YGL026C TRP5  –  YPL057C SUR1 – – – 
YBR166C TYR1 – – – YBR126C TPS1  –  
YNL241C ZWF1  –  YDR074W TPS2  –  
Lipid, fatty acid and isoprenoid metabolism 
YMR202W ERG2 – – –      
YNL280C ERG24 – – –      
YER044C ERG28  – –      
YLR056W ERG3 – – –      
YGL012W ERG4 – – –      
YMR015C ERG5  –       
YML008C ERG6 – – –      
YBR026C ETR1  –       
YMR207C HFA1  –       
YHR067W HTD2  –       
YDR017C KCS1  – –      
YKL055C OAR1  –       
YBR035C PDX3  –       
YBR058C-A TSC3 –        
Other function 
YOR092W ECM3 –   YOR001W RRP6  –  
YNL148C ALF1  –  YJL080C SCP160   – 
YMR116C ASC1 – – – YOR035C SHE4 – – – 
YLR399C BDF1   – YNL032W SIW14  –  
YPL221W BOP1   – YMR216C SKY1  –  
YEL029C BUD16  –  YNL243W SLA2 –  – 
YCR047C BUD23 – –  YBL058W SHP1  –  
YER014C-A BUD25  –  YNR023W SNF12 – –  
YLR226W BUR2 –   YAL047C SPC72 –  – 
YGR217W CCH1 –  – YOL091W SPO21  –  
YDR364C CDC40 – – – YGR063C SPT4  – – 
YLR418C CDC73  –  YNL138W SRV2 – – – 
YLR087C CSF1  – – YDR293C SSD1   – 
YKL046C DCW1   – YHR064C SSZ1  –  
YKL054C DEF1 – – – YMR125W STO1  – – 
YDL160C DHH1   – YMR039C SUB1  –  
YEL018W EAF5  –  YLR182W SWI6  –  
YKL204W EAP1   – YPR163C TIF3  – – 
YLR436C ECM30  –  YOR295W UAF30  –  
YLR443W ECM7 –  – YOR068C VAM10 –  – 
YNL133C FYV6   – YDR359C VID21  –  
YGR196C FYV8 –  – YGR105W VMA21  – – 
YGR163W GTR2  –  YNL197C WHI3 –   
YER057C HMF1 –   YCL002C   –  
YMR032W HOF1  –  YCR079W   –  
YJL159W HSP150 –   YDL173W   –  
YCR020W-B HTL1 – – – YEL007W   –  
YOL012C HTZ1  –  YGL007C-A  – – – 
YGL168W HUR1   – YGL188C-A   –  
YJL077C ICS3  – – YJL046W   –  
YEL044W IES6   – YKL077W   –  
YOL081W IRA2 – –  YKR041W  –  – 
YPL213W LEA1  –  YOL111C    – 
YNL323W LEM3 – –  YOR322C   –  
YOR196C LIP5  –  YPL144W   –  
YJL124C LSM1  –  YBL083C    – 
YDR378C LSM6  –  YCL007C  – – – 
YKL143W LTV1 –   YDL096C    – 
YFL016C MDJ1  –  YDL118W   –  
YGL143C MRF1 – –  YDL172C   –  
YDR162C NBP2   – YDR008C   –  
YBR279W PAF1 – – – YDR360W   –  
YCR077C PAT1   – YDR417C   –  
YBR221C PDB1  –  YDR433W   –  
YGL025C PGD1  –  YDR442W   – – 
YOR265W RBL2   – YEL045C  –  – 
YDR195W REF2  – – YEL059W  – – – 
YOL143C RIB4  –  YGL007W  – – – 
YPL089C RLM1   – YGL024W   –  
YER083C RMD7   – YGL042C   –  
YER070W RNR1  – – YGR064W   – – 
YPL123C RNY1 – – – YHR039C–B    – 
YBL093C ROX3 – – – YJL120W   –  
YJL140W RPB4  – – YJL175W   –  
YGL070C RPB9 – –  YLR261C  – –  
YMR142C RPL13B   – YLR322W   – – 
YGL135W RPL1B  –  YML095C–A    – 
YOR312C RPL20B   – YNL296W  –   
YBR191W RPL21A  –  YOR331C  – – – 
YIL052C RPL34B  –  YPR090W  –   
YDL081C RPP1A  – – YPR123C   –  
YBL025W RRN10  –       
ORF name Gene Lactic acid Acetic acid Hydrochloric acid ORF name Gene Lactic acid Acetic acid Hydrochloric acid 
Cellular transport, transport facilitation and transport routes 
Vacuolar transport Vesicular transport (Golgi network etc.) 
YBR164C ARL1  –  YFL025C BST1 – – – 
YBR290W BSD2  –  YNL051W COG5 –   
YGL206C CHC1 – – – YAL026C DRS2 – – – 
YGR167W CLC1 – – – YGL054C ERV14  –  
YEL027W CUP5 – – – YGR166W KRE11 –  – 
YKL002W DID4   – YJL053W PEP8 –  – 
YCR034W FEN1  –  YKL212W SAC1 – – – 
YOR070C GYP1   – YIL076W SEC28 –   
YKL176C LST4  –  YMR183C SSO2  –  
YNL297C MON2 –   YLR372W SUR4  –  
YDR456W NHX1 –   YOR132W VPS17   – 
YLR148W PEP3 – – – YOR069W VPS5 –  – 
YMR231W PEP5 – – – YNL064C YDJ1  –  
YDR323C PEP7 – – – YLR262C YPT6 – –  
YLR025W SNF7 – – – Ion transport     
YDL185W TFP1   – YJR121W ATP2  –  
YPL234C TFP3  – – YMR038C CCS1 – – – 
YOL018C TLG2 –  – YLL027W ISA1  –  
YPR036W VMA13 –  – YNL291C MID1 –  – 
YBR127C VMA2 – – – YEL017C–A PMP2  –  
YOR332W VMA4 – – – YHR026W PPA1 – – – 
YKL080W VMA5 – – – YJL129C TRK1 – – – 
YLR447C VMA6 – – – Other     
YGR020C VMA7 – – – YGL148W ARO2 – – – 
YEL051W VMA8   – YBR068C BAP2 – –  
YKR001C VPS1 – – – YBR021W FUR4 – – – 
YBR097W VPS15 – – – YGL084C GUP1 – – – 
YPL045W VPS16 – – – YDR138W HPR1   – 
YMR077C VPS20 – – – YKL073W LHS1  –  
YOR089C VPS21 –   YDR432W NPL3  –  
YKL041W VPS24   – YMR091C NPL6   – 
YJR102C VPS25 – – – YBL079W NUP170  –  
YHR012W VPS29 –  – YPL148C PPT2  –  
YDR495C VPS3 – – – YJL204C RCY1 –   
YLR240W VPS34 –  – YDR137W RGP1 – – – 
YJL154C VPS35 –   YLR039C RIC1 – – – 
YLR417W VPS36 – –  YOL072W THP1  – – 
YGL095C VPS45 – – – YCR053W THR4 –  – 
YKR020W VPS51 – – – YPR156C TPO3  –  
YPR139C VPS66  –  YLR337C VRP1  –  
YML097C VPS9 –  –      
YDR136C  – – –      
Protein fate (folding, modification, destination) 
Protein modification 
YPL227C ALG5   – YGL194C HOS2  –  
YOR002W ALG6   – YKL101W HSL1   – 
YOR067C ALG8   – YGL203C KEX1   – 
YEL036C ANP1  –  YNL307C MCK1  – – 
YBR128C ATG14  – – YOL076W MDM20  –  
YLR423C ATG17  –  YJL183W MNN11  –  
YJL095W BCK1 –  – YDR140W MTQ2 – – – 
YGR262C BUD32 – – – YGL038C OCH1 – – – 
YGR036C CAX4  – – YDL232W OST4 – – – 
YKL190W CNB1 –  – YGL058W RAD6 –   
YKL139W CTK1  – – YBL082C RHK1   – 
YML112W CTK3 – – – YMR214W SCJ1  –  
YGR227W DIE2   – YDL047W SIT4   – 
YJL184W GON7 – – – YOL113W SKM1   – 
YPL254W HFI1 – – – YCR033W SNT1  –  
YJR075W HOC1  –  YJL127C SPT10  –  
YOL148C SPT20   – YMR304W UBP15  –  
YDR392W SPT3   – YML115C VAN1  –  
YAL016W TPD3  – – YLR020C YEH2  –  
Interaction with the cellular environment 
Osmosensing Cellular sensing and response 
YLR113W HOG1 –  – YDL100C ARR4  –  
YBR260C RGD1 –  – YPL161C BEM4  –  
YJL128C PBS2 –  – YCR002C CDC10   – 
YHR030C SLT2 –  – YOL051W GAL11  – – 
YLR006C SSK1   – YER068W MOT2   – 
YNR031C SSK2   – YBR289W SNF5 – –  
Ionic homeostasis YHL025W SNF6 – –  
YBR036C CSG2 –  – YJL176C SWI3 – –  
YKR007W MEH1  –  YPL129W TAF14   – 
YKL040C NFU1  –       
YCR044C PER1   –      
YPL188W POS5 – –       
YJR104C SOD1 –  –      
YKL119C VPH2 – – –      
Metabolism 
Amino acid metabolism C-compound and carbohydrate metabolism 
YDR173C ARG82   – YER155C BEM2  – – 
YDR127W ARO1 – – – YOR299W BUD7  –  
YAL021C CCR4  – – YGL027C CWH41   – 
YIR023W DAL81  –  YLR342W FKS1  –  
YAL044C GCV3  –  YPL262W FUM1  –  
YEL046C GLY1 – – – YMR307W GAS1 – – – 
YDR158W HOM2 –  – YHR183W GND1  –  
YER052C HOM3 –  – YNL322C KRE1   – 
YER086W ILV1 – – – YPR159W KRE6   – 
YLR451W LEU3  –  YGL035C MIG1  –  
YFL018C LPD1  –  YGR240C PFK1  –  
YIL128W MET18 –   YMR205C PFK2  –  
YOR323C PRO2  –  YNR052C POP2 – – – 
YHL011C PRS3 – –  YBR229C ROT2   – 
YHR025W THR1 –  – YJL121C RPE1  –  
YDR007W TRP1  –  YGR229C SMI1  – – 
YGL026C TRP5  –  YPL057C SUR1 – – – 
YBR166C TYR1 – – – YBR126C TPS1  –  
YNL241C ZWF1  –  YDR074W TPS2  –  
Lipid, fatty acid and isoprenoid metabolism 
YMR202W ERG2 – – –      
YNL280C ERG24 – – –      
YER044C ERG28  – –      
YLR056W ERG3 – – –      
YGL012W ERG4 – – –      
YMR015C ERG5  –       
YML008C ERG6 – – –      
YBR026C ETR1  –       
YMR207C HFA1  –       
YHR067W HTD2  –       
YDR017C KCS1  – –      
YKL055C OAR1  –       
YBR035C PDX3  –       
YBR058C-A TSC3 –        
Other function 
YOR092W ECM3 –   YOR001W RRP6  –  
YNL148C ALF1  –  YJL080C SCP160   – 
YMR116C ASC1 – – – YOR035C SHE4 – – – 
YLR399C BDF1   – YNL032W SIW14  –  
YPL221W BOP1   – YMR216C SKY1  –  
YEL029C BUD16  –  YNL243W SLA2 –  – 
YCR047C BUD23 – –  YBL058W SHP1  –  
YER014C-A BUD25  –  YNR023W SNF12 – –  
YLR226W BUR2 –   YAL047C SPC72 –  – 
YGR217W CCH1 –  – YOL091W SPO21  –  
YDR364C CDC40 – – – YGR063C SPT4  – – 
YLR418C CDC73  –  YNL138W SRV2 – – – 
YLR087C CSF1  – – YDR293C SSD1   – 
YKL046C DCW1   – YHR064C SSZ1  –  
YKL054C DEF1 – – – YMR125W STO1  – – 
YDL160C DHH1   – YMR039C SUB1  –  
YEL018W EAF5  –  YLR182W SWI6  –  
YKL204W EAP1   – YPR163C TIF3  – – 
YLR436C ECM30  –  YOR295W UAF30  –  
YLR443W ECM7 –  – YOR068C VAM10 –  – 
YNL133C FYV6   – YDR359C VID21  –  
YGR196C FYV8 –  – YGR105W VMA21  – – 
YGR163W GTR2  –  YNL197C WHI3 –   
YER057C HMF1 –   YCL002C   –  
YMR032W HOF1  –  YCR079W   –  
YJL159W HSP150 –   YDL173W   –  
YCR020W-B HTL1 – – – YEL007W   –  
YOL012C HTZ1  –  YGL007C-A  – – – 
YGL168W HUR1   – YGL188C-A   –  
YJL077C ICS3  – – YJL046W   –  
YEL044W IES6   – YKL077W   –  
YOL081W IRA2 – –  YKR041W  –  – 
YPL213W LEA1  –  YOL111C    – 
YNL323W LEM3 – –  YOR322C   –  
YOR196C LIP5  –  YPL144W   –  
YJL124C LSM1  –  YBL083C    – 
YDR378C LSM6  –  YCL007C  – – – 
YKL143W LTV1 –   YDL096C    – 
YFL016C MDJ1  –  YDL118W   –  
YGL143C MRF1 – –  YDL172C   –  
YDR162C NBP2   – YDR008C   –  
YBR279W PAF1 – – – YDR360W   –  
YCR077C PAT1   – YDR417C   –  
YBR221C PDB1  –  YDR433W   –  
YGL025C PGD1  –  YDR442W   – – 
YOR265W RBL2   – YEL045C  –  – 
YDR195W REF2  – – YEL059W  – – – 
YOL143C RIB4  –  YGL007W  – – – 
YPL089C RLM1   – YGL024W   –  
YER083C RMD7   – YGL042C   –  
YER070W RNR1  – – YGR064W   – – 
YPL123C RNY1 – – – YHR039C–B    – 
YBL093C ROX3 – – – YJL120W   –  
YJL140W RPB4  – – YJL175W   –  
YGL070C RPB9 – –  YLR261C  – –  
YMR142C RPL13B   – YLR322W   – – 
YGL135W RPL1B  –  YML095C–A    – 
YOR312C RPL20B   – YNL296W  –   
YBR191W RPL21A  –  YOR331C  – – – 
YIL052C RPL34B  –  YPR090W  –   
YDL081C RPP1A  – – YPR123C   –  
YBL025W RRN10  –       

A dash indicates that the gene deletion strain has a sensitivity to the acid.

Discussion

The expression analysis and the functional screening both suggested that the acidic condition affects cell-wall architecture, which might indicate that expression change of cell-wall-related genes under the acidic conditions results in a change of cell-wall architecture. The expression analysis indicated that most of the genes involved in metal metabolism regulated by Aft1p were induced at least under the acid adaptation conditions. The functional screening indicated that loss of the V-ATPase and HOG MAPK proteins caused acid sensitivity.

The microarray results indicated that the expression levels of several genes regulated by transcription factors Aft1p and Aft2p (Blaiseau et al., 2001; Rutherford et al., 2003) changed at least under the acid adaptation conditions. These genes encode iron reductases (FRE1-3, FRE5) (Georgatsou & Alexandraki et al., 1999), iron permease (FTR1), siderophore transporter (ARN1 and 2) (Kim et al., 2005), ferroxidase (FET3) (Askwith et al., 1994) and siderophore uptake-related proteins (FIT1FIT3) (Protchenko et al., 2001). These results suggest that the acidic condition affects metal metabolism in yeast. AFT1 was found to be induced under acid shock and under acid adaptation by lactic acid. Moreover, we observed that GFP-fused Aft1p was localized to the nucleus in cells grown in media containing lactic acid, acetic acid and hydrochloric acid. The nuclear localization of Aft1p is important under acidic conditions just as in the iron-depleted condition. There are two explanations for why the expression of AFT1 and the genes regulated by Aft1p are changed and Aft1p is localized to the nucleus: (1) yeast is not able to import iron from the media, and (2) yeast needs iron more under the acidic condition. Strains of S. cerevisiae lacking an iron transporter gene cannot grow under alkali stress conditions (Serrano et al., 2004; Viladevall et al., 2004). Several genes whose absence results in reduced growth at mild alkaline pH include several key genes in iron and copper homeostasis, such as CCC2, AFT1, FET3, LYS7 and CTR1 (Dancis et al., 1994). Strains with increased copy numbers of FET4 and CTR1 have increased resistance to alkaline pH (Serrano et al., 2004). Therefore, the extracellular pH change, either acidic or mildly alkaline, affects iron metabolism, although none of the strains lacking iron metabolism genes showed resistance or sensitivity to acids. Recent studies have shown that activation of Aft1p is not a direct response to cytosolic iron, but activation of the iron regulon was controlled by the synthesis of Fe–S clusters, which in yeast are localized within mitochondria (Chen et al., 2004; Phadnis & Ayres Sia et al., 2004). The results of the present study suggest that the expression of Fe–S cluster proteins encoded by LEU1 and ACO1 (Puig et al., 2005) decreased under acidic conditions (Fig. 1). Moreover, other studies have shown that Aft1p is involved in the diauxic shift (Haurie et al., 2003) and oxidative stress (Park et al., 2005). As the function of Aft1p is diverse, further studies are needed to understand why the expression of genes involved in metal metabolism is induced and why Aft1p is localized to the nucleus under acidic conditions just as under iron depletion.

The expression of SED1, which encodes a cell-wall mannoprotein that is highly expressed in the stationary phase (Shimoi et al., 1998), is also regulated by Aft1p (Park et al., 2005). Our study shows that the expression of SED1 is induced under the acidic conditions (Fig. 1), although the deletion of SED1 results in acid resistance (Table 1). These results suggest that the acidic condition affects cell-wall architecture. In fact, low pH has been found to induce alterations in yeast cell-wall architecture (Kapteyn et al., 2001). Moreover, a recent study has shown that Sed1p is involved in maintenance of the mitochondrial genome such that several modified forms of Sed1p are expressed and the largest of these forms interacts with the mitochondrial polymerase in vitro (Phadnis & Ayres Sia et al., 2004). Further investigation is required to resolve why expression of SED1 was induced under the acidic conditions and why the depletion of Sed1p caused acid resistance.

V-ATPase-depleting mutants exhibited sensitivity to the acids (Table 2), indicating that this enzyme is critically important for acid resistance. V-ATPase multisubunit complexes are present in all eukaryotic cells and are required for a range of cellular processes, including receptor-mediated endocytosis, renal acidification, bone reabsorption, neurotransmitter accumulation and activation of acid hydrolases (Holyoak et al., 1996; Graham et al., 2000). V-ATPase maintains the acidity of the vacuole and generates the electrogenic potential that is used to drive the accumulation of ions and small molecules, amino acids and metabolites. The sensitivity caused by V-ATPase depletion was observed with all acids used in this study. Moreover, mutants with defective V-ATPase were found to be markedly sorbate-sensitive (Mollapour et al., 2004). Therefore, the acid sensitivity caused by V-ATPase depletion under the acidic conditions is not due to sensitivity to a particular acid.

The deletion of genes in the HOG MAPK pathway, such as HOG1, PBS2, SSK1 and SSK2, results in sensitivity to acids, including hydrochloric acid (Table 2). The HOG MAPK pathway was found to have an important role in the regulation of adaptation to citric acid stress (Lawrence et al., 2004). These findings suggest that sensitivity to acids caused by the deletion of genes in the HOG MAPK pathway is due to the low pH, rather than to the chemical nature of the acid.

Jen1p is a known transporter of lactic acid and Ady2p is predicted to be an acetic acid transporter (Casal et al., 1996, 1999; Akita et al., 2000; Paiva et al., 2004). Acidic conditions induced the expression of JEN1 (Fig. 1) but not of ADY2. These gene deletion strains were not resistant or sensitive to acids in this study. MCH1-5 and YHL008C encode the monocarboxylate permeases, homologues to mammalian monocarboxylate permeases, which are not involved in the uptake or secretion of monocarboxylates (Makuc et al., 2001). That study showed that transcription of MCH5 was induced by lactic acid, just as our DNA microarray experiment showed 2.75-fold induction by lactic acid under acid adaptation. Pdr12p (which is not on the DNA microarray chip) is needed to develop resistance to some weak acids such as sorbic acid (Schuller et al., 2004). Our quantitative PCR analysis showed that expression of PDR12 increased 3.9-fold under the acid shock response with lactic acid and decreased 5.0-fold under the acid adaptation with hydrochloric acid, whereas the PDR12 deletion strain was not sensitive to acids in this study. In addition, several gene deletion strains lacking various vacuolar sorting proteins were sensitive to acids. The vacuolar sorting protein mutants exhibit general stress sensitivity (Shimoni & Schekman et al., 2002).

Finally, the expression analysis and the functional screening both suggested that the acidic condition affects cell-wall architecture. The expression analysis suggested that the acidic condition affects metal metabolism in yeast. The functional screening indicated that loss of the V-ATPase and HOG MAPK proteins caused acid sensitivity.

References

Akita
O
Nishimori
C
Shimamoto
T
Fujii
T
Iefuji
H
(
2000
)
Transport of pyruvate in Saccharomyces cerevisiae and cloning of the gene encoded pyruvate permease
.
Biosci Biotechnol Biochem
 
64
:
980
984
.
Askwith
C
Eide
D
Van Ho
A
Bernard
PS
Li
L
Davis-Kaplan
S
Sipe
DM
Kaplan
J
(
1994
)
The FET3 gene of S. cerevisiae encodes a multicopper oxidase required for ferrous iron uptake
.
Cell
 
76
:
403
410
.
Bauer
BE
Rossington
D
Mollapour
M
Mamnun
Y
Kuchler
K
Piper
PW
(
2003
)
Weak organic acid stress inhibits aromatic amino acid uptake by yeast, causing a strong influence of amino acid auxotrophies on the phenotypes of membrane transporter mutants
.
Eur J Biochem
 
270
:
3189
3195
.
Bayrock
DP
Ingledew
WM
(
2004
)
Inhibition of yeast by lactic acid bacteria in continuous culture: nutrient depletion and/or acid toxicity?
J Ind Microbiol Biotechnol
 
31
:
362
368
.
Blaiseau
PL
Lesuisse
E
Camadro
JM
(
2001
)
Aft2p, a novel iron-regulated transcription activator that modulates, with Aft1p, intracellular iron use and resistance to oxidative stress in yeast
.
J Biol Chem
 
276
:
34221
34226
.
Casal
M
Cardoso
H
Leao
C
(
1996
)
Mechanisms regulating the transport of acetic acid in Saccharomyces cerevisiae
.
Microbiology
 
142
:
1385
1390
.
Casal
M
Paiva
S
Andrade
RP
Gancedo
C
Leao
C
(
1999
)
The lactate-proton symport of Saccharomyces cerevisiae is encoded by JEN1
.
J Bacteriol
 
181
:
2620
2623
.
Chen
OS
Crisp
RJ
Valachovic
M
Bard
M
Winge
DR
Kaplan
J
(
2004
)
Transcription of the yeast iron regulon does not respond directly to iron but rather to iron–sulfur cluster biosynthesis
.
J Biol Chem
 
279
:
29513
29518
.
Dancis
A
Yuan
DS
Haile
D
Askwith
C
Eide
D
Moehle
C
Kaplan
J
Klausner
RD
(
1994
)
Molecular characterization of a copper transport protein in S. cerevisiae: an unexpected role for copper in iron transport
.
Cell
 
76
:
393
402
.
Flores
CL
Rodriguez
C
Petit
T
Gancedo
C
(
2000
)
Carbohydrate and energy-yielding metabolism in non-conventional yeasts
.
FEMS Microbiol Rev
 
24
:
507
529
.
Foschino
R
Gallina
S
Andrighetto
C
Rossetti
L
Galli
A
(
2004
)
Comparison of cultural methods for the identification and molecular investigation of yeasts from sourdoughs for Italian sweet baked products
.
FEMS Yeast Res
 
4
:
609
618
.
Georgatsou
E
Alexandraki
D
(
1999
)
Regulated expression of the Saccharomyces cerevisiae Fre1p/Fre2p Fe/Cu reductase related genes
.
Yeast
 
15
:
573
584
.
Graham
LA
Powell
B
Stevens
TH
(
2000
)
Composition and assembly of the yeast vacuolar H(+)-ATPase complex
.
J Exp Biol
 
203
:
61
70
.
Haurie
V
Boucherie
H
Sagliocco
F
(
2003
)
The Snf1 protein kinase controls the induction of genes of the iron uptake pathway at the diauxic shift in Saccharomyces cerevisiae
.
J Biol Chem
 
278
:
45391
45396
.
Holyoak
CD
Stratford
M
McMullin
Z
Cole
MB
Crimmins
K
Brown
AJ
Coote
PJ
(
1996
)
Activity of the plasma membrane H(+)-ATPase and optimal glycolytic flux are required for rapid adaptation and growth of Saccharomyces cerevisiae in the presence of the weak-acid preservative sorbic acid
.
Appl Environ Microbiol
 
62
:
3158
3164
.
Holyoak
CD
Bracey
D
Piper
PW
Kuchler
K
Coote
PJ
(
1999
)
The Saccharomyces cerevisiae weak-acid-inducible ABC transporter Pdr12 transports fluorescein and preservative anions from the cytosol by an energy-dependent mechanism
.
J Bacteriol
 
181
:
4644
4652
.
Kapteyn
JC
Ter Riet
B
Vink
E
Blad
S
De Nobel
H
Van Den Ende
H
Klis
FM
(
2001
)
Low external pH induces HOG1-dependent changes in the organization of the Saccharomyces cerevisiae cell wall
.
Mol Microbiol
 
39
:
469
479
.
Kim
Y
Lampert
SM
Philpott
CC
(
2005
)
A receptor domain controls the intracellular sorting of the ferrichrome transporter, ARN1
.
EMBO J
 
24
:
952
962
.
Kohrer
K
Domdey
H
(
1991
)
Preparation of high molecular weight RNA
.
Methods Enzymol
 
194
:
398
405
.
Lawrence
CL
Botting
CH
Antrobus
R
Coote
PJ
(
2004
)
Evidence of a new role for the high-osmolarity glycerol mitogen-activated protein kinase pathway in yeast: regulating adaptation to citric acid stress
.
Mol Cell Biol
 
24
:
3307
3323
.
Ludovico
P
Sousa
MJ
Silva
MT
Leao
C
Corte-Real
M
(
2001
)
Saccharomyces cerevisiae commits to a programmed cell death process in response to acetic acid
.
Microbiology
 
147
:
2409
2415
.
Makuc
J
Paiva
S
Schauen
M
Kramer
R
Andre
B
Casal
M
Leao
C
Boles
E
(
2001
)
The putative monocarboxylate permeases of the yeast Saccharomyces cerevisiae do not transport monocarboxylic acids across the plasma membrane
.
Yeast
 
18
:
1131
1143
.
Mollapour
M
Fong
D
Balakrishnan
K
Harris
N
Thompson
S
Schuller
C
Kuchler
K
Piper
PW
(
2004
)
Screening the yeast deletant mutant collection for hypersensitivity and hyper-resistance to sorbate, a weak organic acid food preservative
.
Yeast
 
21
:
927
946
.
Narendranath
NV
Thomas
KC
Ingledew
WM
(
2001
)
Effects of acetic acid and lactic acid on the growth of Saccharomyces cerevisiae in a minimal medium
.
J Ind Microbiol Biotechnol
 
26
:
171
177
.
Ng
H
(
1972
)
Factors affecting organic acid production by sourdough (San Francisco) bacteria
.
Appl Microbiol
 
23
:
1153
1159
.
Paiva
S
Devaux
F
Barbosa
S
Jacq
C
Casal
M
(
2004
)
Ady2p is essential for the acetate permease activity in the yeast Saccharomyces cerevisiae
.
Yeast
 
21
:
201
210
.
Park
YS
Jeong
HS
Sung
HC
Yun
CW
(
2005
)
Sed1p interacts with Arn3p physically and mediates ferrioxamine B uptake in Saccharomyces cerevisiae
.
Curr Genet
 
47
:
150
155
.
Phadnis
N
Ayres Sia
E
(
2004
)
Role of the putative structural protein Sed1p in mitochondrial genome maintenance
.
J Mol Biol
 
342
:
1115
1129
.
Piper
P
Mahe
Y
Thompson
S
Pandjaitan
R
Holyoak
C
Egner
R
Muhlbauer
M
Coote
P
Kuchler
K
(
1998
)
The pdr12 ABC transporter is required for the development of weak organic acid resistance in yeast
.
EMBO J
 
17
:
4257
4265
.
Piper
P
Calderon
CO
Hatzixanthis
K
Mollapour
M
(
2001
)
Weak acid adaptation: the stress response that confers yeasts with resistance to organic acid food preservatives
.
Microbiology
 
147
:
2635
2642
.
Protchenko
O
Ferea
T
Rashford
J
Tiedeman
J
Brown
PO
Botstein
D
Philpott
CC
(
2001
)
Three cell wall mannoproteins facilitate the uptake of iron in Saccharomyces cerevisiae
.
J Biol Chem
 
276
:
49244
49250
.
Puig
S
Askeland
E
Thiele
DJ
(
2005
)
Coordinated remodeling of cellular metabolism during iron deficiency through targeted mRNA degradation
.
Cell
 
120
:
99
110
.
Rutherford
JC
Jaron
S
Winge
DR
(
2003
)
Aft1p and Aft2p mediate iron-responsive gene expression in yeast through related promoter elements
.
J Biol Chem
 
278
:
27636
27643
.
Schuller
C
Mamnun
YM
Mollapour
M
Krapf
G
Schuster
M
Bauer
BE
Piper
PW
Kuchler
K
(
2004
)
Global phenotypic analysis and transcriptional profiling defines the weak acid stress response regulon in Saccharomyces cerevisiae
.
Mol Biol Cell
 
15
:
706
720
.
Serrano
R
Bernal
D
Simon
E
Arino
J
(
2004
)
Copper and iron are the limiting factors for growth of the yeast Saccharomyces cerevisiae in an alkaline environment
.
J Biol Chem
 
279
:
19698
19704
.
Shimoni
Y
Schekman
R
(
2002
)
Vesicle budding from endoplasmic reticulum
.
Methods Enzymol
 
351
:
258
278
.
Shimoi
H
Kitagaki
H
Ohmori
H
Iimura
Y
Ito
K
(
1998
)
Sed1p is a major cell wall protein of Saccharomyces cerevisiae in the stationary phase and is involved in lytic enzyme resistance
.
J Bacteriol
 
180
:
3381
3387
.
Thomas
KC
Hynes
SH
Ingledew
WM
(
2002
)
Influence of medium buffering capacity on inhibition of Saccharomyces cerevisiae growth by acetic and lactic acids
.
Appl Environ Microbiol
 
68
:
1616
1623
.
Tucker
DL
Tucker
N
Conway
T
(
2002
)
Gene expression profiling of the pH response in Escherichia coli
.
J Bacteriol
 
184
:
6551
6558
.
Viladevall
L
Serrano
R
Ruiz
A
Domenech
G
Giraldo
J
Barcelo
A
Arino
J
(
2004
)
Characterization of the calcium-mediated response to alkaline stress in Saccharomyces cerevisiae
.
J Biol Chem
 
279
:
43614
43624
.
Wen
Y
Marcus
EA
Matrubutham
U
Gleeson
MA
Scott
DR
Sachs
G
(
2003
)
Acid-adaptive genes of Helicobacter pylori
.
Infect Immun
 
71
:
5921
5939
.
Yamaguchi-Iwai
Y
Stearman
R
Dancis
A
Klausner
RD
(
1996
)
Iron-regulated DNA binding by the AFT1 protein controls the iron regulon in yeast
.
EMBO J
 
15
:
3377
3384
.
Yamaguchi-Iwai
Y
Ueta
R
Fukunaka
A
Sasaki
R
(
2002
)
Subcellular localization of Aft1 transcription factor responds to iron status in Saccharomyces cerevisiae
.
J Biol Chem
 
277
:
18914
18918
.

Supplementary material

Author notes

Editor: Lex Scheffers