Abstract

The CRX (cone-rod homeobox) gene is specifically expressed in developing and mature photoreceptors and encodes an otd/Otx-like paired homeodomain protein. Mutant alleles of the CRX gene have recently been associated with autosomal dominant cone-rod dystrophy (CORD) as well as dominant Leber congenital amaurosis (LCA). Since LCA is more commonly inherited in an autosomal recessive manner, we examined a cohort of recessive LCA patients for CRXmutations. A homozygous substitution of arginine (R) at codon 90 by tryptophan (W) was identified in the CRX homeodomain of one of the probands who was nearly blind from birth. A group of 48 control individuals and 190 previously characterized CORD probands did not reveal this sequence change. The mutant CRXR90W homeodomain demonstrated decreased binding to the previously identified cis sequence elements in the rhodopsin promoter. In transient transfection experiments, the mutant protein showed significantly reduced ability to transactivate the rhodopsin promoter, as well as lower synergistic activation with the bZIP transcription factor NRL. Heterozygosity of the mutant CRX (R90W) allele was detected in both parents and in an older sibling. Ophthalmologic examination and electroretinography revealed a subtle abnormality of cone function in both the parents. These data suggest that the R90W mutation results in a CRX protein with reduced DNA binding and transcriptional regulatory activity and that the subsequent changes in photoreceptor gene expression lead to the very early onset severe visual impairment in LCA.

Introduction

The mammalian retina is derived from neural ectoderm and consists of many distinct neurons that are organized in three cell layers to perform phototransduction and initial visual processing (1). Extensive studies have indicated that various retinal cell types arise from common progenitors (2). As with other developing systems (3–5), retinal differentiation and function require precise control of temporal and spatial patterns of gene expression. Two complementary strategies have been employed to gain insights into the transcriptional control of retinal genes. One is to dissect the cis-acting elements in the promoter-enhancer regions of photoreceptor-specific genes (6) and the other is to directly isolate transcription factor genes using molecular techniques (7,8). The cone-rod homeobox (CRX) gene was independently identified using these approaches and shown to be expressed predominantly in photoreceptors (9–11). It encodes a paired homeodomain protein of 299 amino acids with high homology to proteins of the otd/Otx gene family, members of which participate in regulating early neuronal development (12). The CRX protein binds to specific DNA sequence elements in vitro and transactivates expression from minimal promoters of several photoreceptor-specific genes, including rhodopsin (9,11). In transient transfection experiments, CRX acts synergistically with NRL, a transcription factor of the basic leucine zipper motif (bZIP) family (7).

Figure 1

(A) Sequence of the CRX exon 3 (antisense strand). The identity of the sequenced product is shown above the sequence. Circles and squares represent females and males, respectively. A filled circle indicates the proband in this autosomal recessive LCA family (UM D188). The arrow on the left indicates the mutation. The proband is homozygous whereas both the parents and an older sister carry a normal and a mutated allele. (B) Sequence of the normal and mutated CRX alleles, showing the altered amino acid (R90W). (C) Alignment of the human CRX homeodomain helix 3 with other homeodomain sequences (based on refs 9–11). The R90 codon is shown in bold.

Figure 1

(A) Sequence of the CRX exon 3 (antisense strand). The identity of the sequenced product is shown above the sequence. Circles and squares represent females and males, respectively. A filled circle indicates the proband in this autosomal recessive LCA family (UM D188). The arrow on the left indicates the mutation. The proband is homozygous whereas both the parents and an older sister carry a normal and a mutated allele. (B) Sequence of the normal and mutated CRX alleles, showing the altered amino acid (R90W). (C) Alignment of the human CRX homeodomain helix 3 with other homeodomain sequences (based on refs 9–11). The R90 codon is shown in bold.

We and others have previously identified CRX mutations in patients with autosomal dominant cone-rod dystrophy (CORD), a relatively early onset (often in the teens) disease involving degeneration of cone and rod photoreceptors (10,13). Since CRX is expressed early in development (11) and is functionally implicated in photoreceptor differentiation (9), we hypothesized that a homozygous mutation in the CRX gene would result in a congenital or early onset retinopathy. Leber congenital amaurosis (LCA) is a clinically and genetically heterogeneous disease, which is usually inherited in an autosomal recessive manner and is characterized by total blindness at birth or shortly thereafter (MIM 204000) (14). In a small number of LCA patients, mutations have been reported in genes for a retina-specific guanylate cyclase (15) and a retinal pigment epithelium-specific 65 kDa protein, RPE65 (16,17). In addition, two separate CRX mutations (E168Δ2bp and G217Δ1bp) have recently been described in LCA patients (18). Surprisingly, however, in each of these reported cases CRX sequence changes were identified in only one allele and the mutation appeared to originate de novo, as neither parent carried the mutant allele. Here, we demonstrate for the first time that a novel CRX mutation (R90W) can cause LCA in an autosomal recessive manner. We also present biochemical and clinical data that provide insights into the mechanism by which the mutation causes the disease.

Figure 2

Decreased DNA binding caused by the R90W mutation. (A) Protein gel, stained with Coomassie blue, demonstrating the purification of CRXHD-GST (WT) and CRXHDR90W-GST (R90W) fusion proteins. Lane 1 contains protein molecular weight markers (Bio-Rad); lanes 2 and 3 contain 100 ng of the indicated protein. The numbers on the left represent the apparent molecular weight in kDa. (B-D) EMSAs with CRXHD-GST (lanes 1–3) and CRXHDR90W-GST (lanes 4–6) fusion proteins. Within the rhodopsin promoter, Crx has been shown to bind to three separate sites (11); these are the Ret 1/PCE (29,30), Ret 4 (31) and BAT-1 elements (32). The 32P-labeled oligonucleotide probes used for EMSA are indicated at the bottom of each panel. The amount of fusion protein used for lanes 1 and 4, 2 and 5 and 3 and 6 were: 10, 2 and 0.4 ng, respectively, for (B); 2, 0.2 and 0.02 ng, respectively, for (C); 40, 20 and 10 ng, respectively, for (D).

Figure 2

Decreased DNA binding caused by the R90W mutation. (A) Protein gel, stained with Coomassie blue, demonstrating the purification of CRXHD-GST (WT) and CRXHDR90W-GST (R90W) fusion proteins. Lane 1 contains protein molecular weight markers (Bio-Rad); lanes 2 and 3 contain 100 ng of the indicated protein. The numbers on the left represent the apparent molecular weight in kDa. (B-D) EMSAs with CRXHD-GST (lanes 1–3) and CRXHDR90W-GST (lanes 4–6) fusion proteins. Within the rhodopsin promoter, Crx has been shown to bind to three separate sites (11); these are the Ret 1/PCE (29,30), Ret 4 (31) and BAT-1 elements (32). The 32P-labeled oligonucleotide probes used for EMSA are indicated at the bottom of each panel. The amount of fusion protein used for lanes 1 and 4, 2 and 5 and 3 and 6 were: 10, 2 and 0.4 ng, respectively, for (B); 2, 0.2 and 0.02 ng, respectively, for (C); 40, 20 and 10 ng, respectively, for (D).

Results

A homozygous CRX-R90W mutation in LCA

The three CRX exons and their flanking regions were examined in nine probands diagnosed with LCA by direct sequencing of amplified products. This analysis revealed a C→T nucleotide transition in the CRX exon 3 of the proband from family UM D188 (Fig. 1A, showing a G→A sequence change in the antisense strand). Since only a T nucleotide was detected at this position, the sequence alteration was present in both CRX alleles of the proband. No other nucleotide change was observed. Both the parents and an older full sister of the affected girl demonstrated heterozygosity, i.e. carried both a C and a T nucleotide (Fig. 1A). The C→T change had not been detected in our previous analysis of the CRX gene from 170 CORD probands (13) or in 20 additional CORD patients screened later (data not shown). Since this nucleotide change creates a new BsrI restriction site, we digested PCR-amplified products of CRX exon 3 from 48 control individuals with this restriction enzyme. The C→T nucleotide change was not detected in any control sample (data not shown), further confirming that it is not a common polymorphic variant in the population.

The C→T transition results in the substitution of a tryptophan (W) residue for arginine (R) at codon 90, which is in helix 3 of the CRX homeodomain (Fig. 1B). R90 is conserved in the CRX protein from different species, in all members of the otd/Otx family and in many other homeodomains (Fig. 1C).

Figure 3

Effect of the R90W mutation on CRX-mediated transactivation of the rhodopsin promoter, both alone and in combination with NRL. (A) Ability of the indicated amounts (µg) of wild-type (CRX/pcDNA3.1) and CRXR90W/pcDNA3.1 mutant constructs to transactivate expression of the bovine rhodopsin promoter (−130 to +70 bp)-reporter construct. (B) Same experiment as in (A), but in the absence or presence of 1 µg of NRL expression construct.

Figure 3

Effect of the R90W mutation on CRX-mediated transactivation of the rhodopsin promoter, both alone and in combination with NRL. (A) Ability of the indicated amounts (µg) of wild-type (CRX/pcDNA3.1) and CRXR90W/pcDNA3.1 mutant constructs to transactivate expression of the bovine rhodopsin promoter (−130 to +70 bp)-reporter construct. (B) Same experiment as in (A), but in the absence or presence of 1 µg of NRL expression construct.

The CRXR90W protein shows reduced binding to DNA sequence elements

To examine the effect of the mutation, wild-type and mutated CRX homeodomains (CRXHD and CRXHDR90W, respectively) were expressed in bacteria as GST fusion proteins, purified and tested for DNA binding activity (Fig. 2). SDS-PAGE analysis demonstrated that an equivalent amount of the wild-type and mutant fusion protein was used for the binding experiments (Fig. 2A). Electrophoretic mobility shift assays (EMSAs) were performed with each of the rhodopsin promoter elements that had been previously shown to bind to Crx; Ret 1, BAT-1 and Ret 4 (Fig. 2B-D). In all cases, the mutant homeodomain (CRXHDR90W) showed reduced binding activity compared with the wild-type (CRXHD). The maximum decrease in binding was noted with the Ret 1 and Ret 4 sites. With the Ret 4 site, CRXHDR90W also demonstrated a slightly different mobility shift compared with the wild-type protein (Fig. 2D).

The R90W mutation reduces CRX-mediated transactivation of the rhodopsin promoter

To further assess the functional consequence of the R90W mutation, we performed transient transfection studies using a bovine rhodopsin promoter (-130 to +70 bp)-luciferase reporter assay with human 293 cells. Compared with the wild-type, the mutant CRXR90W protein demonstrated minimal, if any, ability to transactivate expression of the reporter gene (Fig. 3A). Additionally, in the presence of bZIP transcription factor NRL, the CRXR90W protein significantly reduced synergistic transactivation of the rhodopsin promoter (Fig. 3B). Taken together, these results suggest that the R90W mutation reduces but does not abolish the transcriptional regulatory activity of CRX.

Clinical characteristics of affected individuals

The proband (II-1) homozygous for the CRX-R90W mutation had severe and nearly complete vision loss from birth, with ‘counting fingers’ visual acuity and nearly global loss of visual fields with no ability to detect light presented other than directly ahead of her. Her ocular fundus showed extensive pigmentary retinopathy and electroretinogram (ERG) responses had >98% amplitude loss of rod and cone components (Fig. 4). This constellation of clinical features is termed Leber congenital amaurosis (http://www.ncbi.nlm.nih.gov/Omim/)(14). No systemic abnormalities were noted. Normal developmental milestones were attained and intelligence was normal.

The heterozygous parents retained normal visual acuity and were relatively asymptomatic clinically, except for being photo-aversive to bright lights and preferring not to drive at or after dusk (Table 1 and Fig. 4). The mother (I-1) retained normal color discrimination on the Farnsworth D-15 test (which, like visual acuity, probes only the central-most cone function); however, she missed six of 12 Ishihara plates, indicating that her color vision was grossly deficient across the central 5–10° of vision. This is evidence of a functional deficit of macular cones outside the central fovea, mirroring the punctate retinopathy that was observed at the edges of her macula, in which the retinal pigment epithelium (RPE) shows early atrophy in a 20–40° band in the rod-rich region of the retina. Both parents had photopic cone and 30 Hz flicker ERG abnormalities, which were more advanced in the mother, and both had impaired rod threshold sensitivities centrally in the macula but not in the peripheral retina. These changes indicate a mild form of disease, clinically termed cone-rod dystrophy. When examined at age 15, the sister of the proband (II-2) did not have apparent fundus abnormalities by direct and indirect ophthalmoscopy.

Table 1

Clinical characteristics (CRX-R90W, UM D188)

Table 1

Clinical characteristics (CRX-R90W, UM D188)

Discussion

The structure and function of photoreceptors appear to be under strict genetic control since mutations in a large number of genes (or genetic loci, >40 at this stage) can lead to retinal and macular dystrophies (19) (http://www.sph.uth.tmc.edu/www/utsph/RetNet/disease.htm). Most of the identified ‘disease’ genes encode photoreceptor-specific proteins that are involved in phototransduction or are structural proteins. It has, therefore, been expected that mutations in transcription factors that control the expression of photoreceptor-specific genes (e.g. rhodopsin) would result in retinopathies. The bZIP transcription factor NRL and the homeodomain protein CRX have been implicated in rhodopsin regulation and probably act in a synergistic manner (11,20,21). Although initial screening did not reveal causative NRL mutations in a cohort of 53 retinal dystrophy patients (22), mutations in the CRX gene were recently reported in families with autosomal dominant CORD and LCA (10,13,18). This is the first report of a homozygous mutation in CRX resulting in LCA.

The R90W substitution shows a classical autosomal recessive pattern of inheritance with one mutated allele provided by each parent. This change was not observed in 48 control individuals or in 190 CORD probands. Although the parents are unaware of consanguinity in the ancestry, both families originated from a small community near Bombay, India. In an otherwise Hindu region, this community was converted to Christianity by Portuguese missionaries some 450 years ago, possibly leading to a sequestered population with an ancestral CRX-R90W allele, which converged in the proband and resulted in LCA. The arginine codon 90 is a highly conserved residue in recognition helix 3 of the homeodomain. It seemed likely that its substitution with tryptophan would alter the DNA-binding and transcriptional regulatory potential of CRX. This hypothesis was confirmed by the finding that in vitro the mutation was associated with both reduced DNA binding and decreased transcriptional activity. It should be noted that another mutation in the homeodomain (R41W) has previously been shown to decrease the DNA-binding activity of CRX protein in vitro (13). Further evidence for R90W being a causative mutation in this LCA family is provided by ophthalmologic and physiological studies. Both of the parents are heterozygous for the CRXR90W mutation and showed clinical and ERG characteristics of mild cone-rod disease and macular involvement. We had previously reported a CORD family (UM H0992) with autosomal dominant disease resulting from an R41W mutation in the CRX homeodomain that caused maculopathy from cone-rod disease (13). Overall, the disease features in that previous R41W family are concordant with the R90W parents in this LCA family. In both families, the heterozygous individuals show punctuate pigmentary maculopathy and early mild RPE atrophy that extends into the nasal retina and surrounds the macula in a band extending from 20 to 40° in the rod-rich mid-peripheral retina. However, amongst the patients examined, the R41W mutation in the heterozygous state caused a more severe disease phenotype than did the R90W mutation. This is consistent with the finding that in vitro the R41W mutation affects DNA binding more severely than does the R90W mutation (13). Based on these findings, we would predict that an R41W homozygote or an R90W/R41W compound heterozygote would also exhibit an LCA phenotype.

Both the mother and the father in this Leber family have the same CRX gene mutation, yet the mother, who is younger by 7 years, has more pronounced disease. A similar degree of phenotype variability was observed in our previous CORD family (UM H0992), in which the younger siblings were more severely affected (13). Compared with the older brother (III-I) in that family, the mother in this Leber family had quite a similar disease; both retained normal acuity but had abnormal color discrimination, relative visual field loss centrally, punctuate RPE pigmentary maculopathy and ERG changes. Both the previous CRX cone-rod disease family (UM H0992) and the current LCA family showed electronegative scotopic and photopic ERG responses that suggest impaired signal transfer from both rod and cone photoreceptors to the bipolar second-order retinal neurons (23). In both families, the heterozygous state can be described as having macular degeneration as a component of a more generalized ‘cone-rod dystrophy’ (24). Since the parents in this Leber family are relatively asymptomatic, we do not know exactly when the disease condition became manifest, although based on our previous CRX study of CORD (13) and on ophthalmic examination of the carrier daughter (II-2) we presume that it was not congenital and that it may be progressive to some degree for these heterozygous individuals. Consistent with these findings, CRX mutations in heterozygote individuals are reported to result in varying degrees of photoreceptor degeneration (25,26).

Figure 4

Clinical characterization of individuals from the LCA pedigree UM D118. (A) Fundus photograph of the left eye of an 11 -year-old female (proband) with Leber's congenital amaurosis, shows central macular atrophy with extensive pigmentary disruption and early mottled atrophy of the RPE into the periphery. The arterioles are narrowed. (B) Fluorescein angiogram of the right eye superior to the macula of the 38-year-old mother of and heterozygous for the R90W mutation, shows tiny, punctate pigmentary retinopathy and marked thinning of the RPE causing a ‘window defect’ through which the white choroidal fluorescence is evident. This band of early RPE atrophy extends along the macular arcade vessels (curving along the bottom of this photograph), 20–40° from the fovea in the rod-dense region of the retina. (C) Retinal function testing on the CRX-R90W family. ERG responses from the proband shown here at age 2 years, are >98% reduced for both rod and cone test conditions. Both parents with the heterozygous R90W mutation show ERG abnormalities: responses from rods and rod pathway neurons to the scotopic white flash (3.6 cd s/m2, condition) are ‘electronegative’ from reduction of the positive b-wave. A blue scotopic flash (0.014 cd s/m2, dark-adapted, normally producing the maximal rod system b-wave) gives normal amplitude for I-2 but is sub-normal for I-1 (Table 1). For I-1, the cone system response is reduced and electronegative (arrow) with the photopic flash (8.5 cd s/m2 flash on a light-adapting 43 cd/m2 background) and has sub-normal amplitude to 30 Hz flicker.

Figure 4

Clinical characterization of individuals from the LCA pedigree UM D118. (A) Fundus photograph of the left eye of an 11 -year-old female (proband) with Leber's congenital amaurosis, shows central macular atrophy with extensive pigmentary disruption and early mottled atrophy of the RPE into the periphery. The arterioles are narrowed. (B) Fluorescein angiogram of the right eye superior to the macula of the 38-year-old mother of and heterozygous for the R90W mutation, shows tiny, punctate pigmentary retinopathy and marked thinning of the RPE causing a ‘window defect’ through which the white choroidal fluorescence is evident. This band of early RPE atrophy extends along the macular arcade vessels (curving along the bottom of this photograph), 20–40° from the fovea in the rod-dense region of the retina. (C) Retinal function testing on the CRX-R90W family. ERG responses from the proband shown here at age 2 years, are >98% reduced for both rod and cone test conditions. Both parents with the heterozygous R90W mutation show ERG abnormalities: responses from rods and rod pathway neurons to the scotopic white flash (3.6 cd s/m2, condition) are ‘electronegative’ from reduction of the positive b-wave. A blue scotopic flash (0.014 cd s/m2, dark-adapted, normally producing the maximal rod system b-wave) gives normal amplitude for I-2 but is sub-normal for I-1 (Table 1). For I-1, the cone system response is reduced and electronegative (arrow) with the photopic flash (8.5 cd s/m2 flash on a light-adapting 43 cd/m2 background) and has sub-normal amplitude to 30 Hz flicker.

Identification of a homozygous mutation in the LCA child provides evidence for the involvement of CRX in early differentiation of cones and rods. Her visual function was quite severely compromised from the youngest age and apparently from birth. In addition, the molecular and physiological data reported here on the heterozygous parents support a role for the CRX protein in maintaining normal function even in differentiated photorecep-tors. Together with the previous clinical findings in a CORD family (13), our results of cone dysfunction in the heterozygous carrier parents indicate that different mutations within the CRX homeodomain can result in varying degrees of severity, which sometimes may not be recognized clinically until later in life. It is tempting to speculate that certain CRX mutations (in particular those in less conserved functional domains), alone or in combination with other genes [e.g. ABCR (27)], may result in progressive yet slow loss of cone function, as observed in elderly patients with age-related macular degeneration.

Materials and Methods

Mutation analysis

Blood samples were collected from participants in the study after obtaining informed consent. Standard methods were used for genomic DNA preparation. The procedures for mutation analysis have been described earlier (13,28). Briefly, oligonucleotide primers flanking the CRX exons (see ref. 13 for primer sequences) were used for PCR amplification of genomic DNA and the products were directly sequenced using the Sequenase kit (Amersham Life Science). When indicated, PCR products were digested with BsrI restriction enzyme (New England Biolabs), as per the manufacturer's instructions.

DNA binding studies

CRXHDR90W-GST was generated as previously described for CRXHD-GST (11), except that the CRXR90W/pcDNA3.1/HisC vector was used as template DNA for the PCR reaction. Recombinant CRXHD-GST and CRXHDR90W-GST proteins were expressed, purified, analyzed by SDS-PAGE and immunoblot and tested by EMSA, as described (11).

Transient transfection studies

A mammalian expression construct for the CRXR90W mutant was generated from a human CRX/pcDNA3.1/HisC vector (11) using the QuickChange site-directed mutagenesis kit according to the manufacturer's instructions (Stratagene). The primers used for the mutagenesis were CAGGTTTGGTTCAAGAACTGGAGGGCTAAATGCAGGC and GCCTGCATTTAGCCCTCCAGTTCTTGAACCAAACCTG. The mutation was confirmed by sequencing. Transient transfection assays were performed and analyzed as previously described (11), except that the total amount of DNA was kept constant in each transfection by the addition of an appropriate amount of ‘empty’ pcDNA3.1/His C plasmid (Invitrogen).

Visual function analysis

Clinical evaluation and retinal function testing, including visual fields measurement by Goldmann perimetry, dark-adapted absolute threshold sensitivity by Goldmann-Weekers determination and color vision testing with Ishihara plates and Farnsworth's dichromate (D-15) panel were performed in standard fashion; retinal function testing by ERG recordings are described elsewhere (23).

Acknowledgements

We thank Ms Dorothy Giebel for assistance in preparing the manuscript. This research was supported by grants from the National Institutes of Health (EY06094, EY07003, EY09769 and EY11115), the Foundation Fighting Blindness (Hunt Valley, MD), the Rebecca P. Moon, Charles M. Moon Jr and Dr P. Thomas Manchester Research Fund and the Lois Duffey AMD Research Fund. Q.W. is the recipient of a Knights Templar Foundation fellowship and S.C. a grant-in-aid from Fight for Sight. A.S. is the recipient of a Lew R.Wasserman Merit Award, D.J.Z. and S.C. career development awards and P.A.S. a Senior Scientific Investigator Award, from Research to Prevent Blindness Inc.

References

1
Dowling
J.E.
The Retina—An Approachable Part of the Brain
 , 
1987
Cambridge, MA
Harvard University Press
2
Cepko
C.L.
Austin
C.P.
Yang
X.
Alexiades
M.
Ezzeddine
D.
Cell fate determination in the vertebrate retina
Proc. Natl Acad. Sci. USA
 , 
1996
, vol. 
93
 (pg. 
589
-
595
)
3
He
X.
Rosenfeld
M.G.
Mechanisms of complex transcriptional regulation: implications for brain development
Neuron
 , 
1991
, vol. 
7
 (pg. 
183
-
196
)
4
Struhl
K.
Mechanisms for diversity in gene expression patterns
Neuron
 , 
1991
, vol. 
7
 (pg. 
177
-
181
)
5
Blau
H.M.
Differentiation requires continuous active control
Annu. Rev. Biochem.
 , 
1992
, vol. 
61
 (pg. 
1213
-
1230
)
6
Kumar
R.
Zack
D.J.
Wiggs
J.L.
Regulation of visual pigment gene expression
Molecular Genetics of Ocular Disease
 , 
1994
New York, NY
Wiley-Liss
(pg. 
139
-
160
)
7
Swaroop
A.
Xu
J.
Pawar
H.
Jackson
A.
Skolnick
C.
Agarwal
N.
A conserved retina-specific gene encodes a basic motif/leucine zipper domain
Proc. Natl Acad. Sci. USA
 , 
1992
, vol. 
89
 (pg. 
266
-
270
)
8
Freund
C.
Horsford
D.J.
McInnes
R.R.
Transcription factor genes and the developing eye: a genetic perspective
Hum. Mol. Genet.
 , 
1996
, vol. 
5
 (pg. 
1471
-
1488
)
9
Furukawa
T.
Morrow
E.M.
Cepko
C.L.
Crx, a novel otx-like homeobox gene shows photoreceptor-specific expression and regulates photoreceptor differentiation
Cell
 , 
1997
, vol. 
91
 (pg. 
531
-
541
)
10
Freund
C.L.
Gregory-Evans
C.Y.
Furukawa
T.
Papaioannou
M.
Looser
J.
Ploder
L.
Bellingham
J.
Ng
D.
Herbrick
J.-A.S.
Duncan
A.
Scherer
S.W.
Tsui
L.-C.
Loutradis-Anagnostou
A.
Jacobson
S.G.
Cepko
C.L.
Bhattacharya
S.
McInnes
R.R.
Cone-rod dystrophy due to mutations in novel photoreceptor-specific homeobox gene (CRX) essential for maintenance of the photoreceptor
Cell
 , 
1997
, vol. 
91
 (pg. 
543
-
553
)
11
Chen
S.
Wang
Q.-L.
Nie
Z.
Sun
H.
Lennon
G.
Copeland
N.G.
Gilbert
D.J.
Jenkins
N.A.
Zack
D.J.
Crx, a novel Otx-like paired-homeodomain protein, binds to and transactivates photoreceptor cell-specific genes
Neuron
 , 
1997
, vol. 
19
 (pg. 
1017
-
1030
)
12
Finkelstein
R.
Boncinelli
E.
From fly head to mammalian forebrain: the story of otd and Otx
Trends Genet.
 , 
1994
, vol. 
10
 (pg. 
310
-
315
)
13
Swain
P.K.
Chen
S.
Wang
Q.-L
Affatigato
L.M.
Coats
C.L.
Brady
K.D.
Fishman
G.A.
Jacobson
S.G.
Swaroop
A.
Stone
E.
Sieving
P.A.
Zack
D.J.
Mutations in the cone-rod homeobox gene are associated with the cone-rod dystrophy photoreceptor degeneration
Neuron
 , 
1997
, vol. 
19
 (pg. 
1329
-
1336
)
14
Schroeder
R.
Mets
M.B.
Maumenee
I.H.
Leber's congenital amaurosis
Arch. Ophthalmol.
 , 
1987
, vol. 
105
 (pg. 
356
-
359
)
15
Perrault
I.
Rozet
J.M.
Calvas
P.
Gerber
S.
Camuzat
A.
Dollfus
H.
Chatelin
S.
Souied
E.
Ghazi
I.
Leowski
C.
Bonnemaison
M.
Pralier
D.L.
Frezal
J.
Dufier
J.-L.
Ipttler
S.
Munnich
A.
Kaplan
J.
Retinal-specific guanylate cyclase gene mutations in Leber's congenital amaurosis
Nature Genet.
 , 
1996
, vol. 
14
 (pg. 
461
-
464
)
16
Marlhens
F
Bareil
C.
Griffoin
J.-M
Zrenner
E
Amalric
P.
Eliaou Liu
S.-Y.
Harris
E.
Redmond
T.M.
Arnaud
B.
Claustres
M.
Hamel
C.P
Mutations in RPE65 cause Leber's congenital amaurosis
Nature Genet
 , 
1997
, vol. 
17
 (pg. 
139
-
141
)
17
Morimura
H.
Fishman
G.A.
Grover
S.A.
Fulton
A.B.
Berson
E.L.
Dryja
T.P.
Mutations in the RPE65 gene in patients with autosomal recessive retinitis pigmentosa or Leber congenital amaurosis
Proc. Natl Acad. Sci. USA
 , 
1998
, vol. 
95
 (pg. 
3088
-
3093
)
18
Freund
C.L.
Wang
Q.-L.
Chen
S.
Muskat
B.L.
Wiles
C.D.
Sheffield
V.C.
Jacobson
S.G.
McInnes
R.R.
Zack
D.J.
Stone
E.M.
De novo mutations in the CRX homeobox gene associated with Leber congenital amaurosis
Nature Genet.
 , 
1998
, vol. 
18
 (pg. 
311
-
312
)
19
Farber
D.B.
Danciger
M.
Identification of genes causing photoreceptor degenerations leading to blindness
Curr. Opin. Neurobiol.
 , 
1997
, vol. 
7
 (pg. 
666
-
673
)
20
Rehemtulla
A.
Warwar
R.
Kumar
R.
Ji
X.
Zack
D.J.
Swaroop
A.
The basic motif-leucine zipper transcription factor Nrl can positively regulate rhodopsin gene expression
Proc. Natl Acad. Sci. USA
 , 
1996
, vol. 
93
 (pg. 
191
-
195
)
21
Kumar
R.
Chen
S.
Scheurer
D.
Wang
Q.L.
Duh
E.
Sung
C.H.
Rehemtulla
A.
Swaroop
A.
Adler
R.
Zack
D.J.
The bZIP transcription factor Nrl stimulates rhodopsin promoter activity in primary retinal cell cultures
J. Biol. Chem.
 , 
1996
, vol. 
271
 (pg. 
29612
-
29618
)
22
Farjo
Q.
Jackson
A.
Pieke-Dahl
S.
Scott
K.
Kimberling
W.J.
Sieving
P.A.
Richards
J.R.
Swaroop
A.
Human bZIP transcription factor gene NRL: structure, genomic sequence, fine linkage mapping at 14q11.2 and negative mutation analysis in patients with retinal degeneration
Genomics
 , 
1997
, vol. 
45
 (pg. 
395
-
401
)
23
Sieving
P.A.
Photopic ON- and OFF-pathway abnormalities in retinal dystrophies
Trans. Am. Ophthalmol. Soc.
 , 
1993
, vol. 
91
 (pg. 
701
-
773
)
24
Sieving
P.A.
Gorin
M.
Diagnostic issues with inherited retinal and macular dystrophies
Seminars in Ophthalmology
 , 
1995
Philadelphia, PA
W.B.Saunders
(pg. 
279
-
294
)
25
Jacobson
S.G.
Cideciyan
A.V.
Huang
Y.
Hanna
D.B.
Freund
C.L.
Affatigato
L.M.
Carr
R.E.
Zack
D.J.
Stone
E.M.
McInnes
R.R.
Retinal degenerations with truncation mutations in the Cone-Rod Homeobox (CRX) gene
Invest. Ophthalmol. Vis. Sci.
 , 
1998
, vol. 
39
 (pg. 
2417
-
2426
)
26
Sohocki
M.M.
Sullivan
L.S.
Mintz-Hittner
H.A.
Birch
D.
Heckenlively
J.R.
Freund
C.L.
McInnes
R.R.
Daiger
S.P.
A range of clinical phenotypes associated with mutations in CRX, a photoreceptor transcription-factor gene
Am. J. Hum. Genet.
 , 
1998
, vol. 
63
 (pg. 
1307
-
1315
)
27
Allikmets
R.
Shroyer
N.F
Singh
N.
Seddon
J.M.
Lewis
R.A.
Bernstein
P.S.
Peiffer
A.
Zabriskie
N.A.
Li
Y.
Hutchinson
A.
Dean
M.
Lupski
J.R.
Leppert
M.
Mutation of the Stargardt disease gene (ABCR) in age-related macular degeneration
Science
 , 
1997
, vol. 
277
 (pg. 
1805
-
1807
)
28
Fujita
R.
Buraczynska
M.
Gieser
L.
Wu
W.
Forsythe
P.
Abrahamson
M.
Jacobson
S.G.
Andreasson
S.
Sieving
P.A.
Swaroop
A.
Analysis of the RPGR gene in 11 families with the RP3 genotype: paucity of mutations in the coding region, but splice defects in two families
Am. J. Hum. Genet
 , 
1997
, vol. 
61
 (pg. 
571
-
580
)
29
Morabito
M.A.
Yu
X.
Barnstable
C.J.
Characterization of developmentally regulated and retina-specific nuclear protein binding to a site in the upstream region of the rat opsin gene
J. Biol. Chem.
 , 
1991
, vol. 
266
 (pg. 
9667
-
9672
)
30
Kikuchi
T.
Raju
K.
Breitman
M.L.
Shinohara
T.
The proximal promoter of the mouse arrestin gene directs gene expression in photoreceptor cells and contains an evolutionarily conserved retinal factor-binding site
Mol. Cell. Biol.
 , 
1993
, vol. 
13
 (pg. 
4400
-
4408
)
31
Chen
S.
Zack
D.J.
Ret 4, a positive acting rhodopsin regulatory element identified using a bovine retina in vitro transcription system
J. Biol. Chem.
 , 
1996
, vol. 
271
 (pg. 
28549
-
28557
)
32
DesJardin
L.E.
Hauswirth
W.W.
Developmentally important DNA elements within the bovine opsin upstream region
Invest. Ophthalmol. Vis. Sci.
 , 
1996
, vol. 
37
 (pg. 
154
-
165
)