Abstract

Activation and suppression of gene transcription is tightly controlled by epigenetic modifications. The imprinted Gnas1 gene region contains closely juxtaposed maternally expressed (Nesp) and paternally expressed (Nespas, Gnasxl, Exon 1A) transcripts, providing a unique opportunity to study how epigenetic modifications change in nucleosomes from active to silenced promoters. Using 30 polymorphic sites across the Gnas1 gene region in (C57BL/6J×Mus spretus) F1 mice and chromatin immunoprecipitation (ChIP) assays we identified two allelic switch regions (ASRs) that mark boundaries of epigenetic information. We show that activating signals (histone acetylation and methylation of H3 Lys4) and silencing signals (histone methylation of H3 Lys9 and DNA methylation) segregate independently across the ASRs and suggest that these ASRs allow the transcriptional elongation to proceed through the silenced domain of nearby imprinted promoters. We discuss these findings in light of recent progress in the conceptualization of nucleosome remodeling during transcriptional elongation and in the development of histone code.

INTRODUCTION

Genomic imprinting, the preferential silencing of one parental allele, is an epigenetic event transmitted independently of DNA sequence. Epigenetic information is often conveyed through alterations in nucleosome structure, including DNA methylation and histone methylation and acetylation. These alterations exert considerable control over transcription, with local modifications forming domains of active or silenced chromatin. Several imprinted genes (Igf2r, PEG1 and Gnas1) are associated with reciprocally imprinted antisense transcripts that are transcribed from the parental allele opposite to that of the sense transcript. Thus, a single chromatin region can be silenced on one parental allele, yet transcriptionally active on the other, and transcription can proceed through a silenced domain, a phenomenon not explained by current concepts of heterochromatin and euchromatin.

Both the mouse Gnas1 and human GNAS1 gene regions contain several promoters driving reciprocally imprinted sense and antisense transcripts over 11 kb of DNA (15). On the maternal chromosome, the active Nesp is transcribed and elongated through three suppressed domains: Nespas, Gnasxl and Exon 1A. Conversely, on the paternal chromosome, the active antisense Nespas is elongated through the suppressed Nesp domain (Fig. 1A). Since switching from an active to a suppressed domain on each parental chromosome is thought to be epigenetically defined by boundaries of histone and DNA modifications, we expected that for each histone modification, a ‘switch’ region where active and suppressed domains are separated could be identified.

By chromatin immunoprecipitation (ChIP) assay, we have studied how these epigenetic modifications change in steps of one or several nucleosomes across these boundaries in the imprinted Gnas1 gene, and have identified two separate allelic switch regions (ASR), an activating ASR and a silencing ASR. We show that ‘activating’ and ‘silencing’ signals segregate independently across the ASRs and discuss these findings in light of recent progress in nucleosome remodeling during transcriptional elongation (69) and in the development of the histone code.

RESULTS

A sharp increase of histone acetylation and H3 Lys4 methylation marks the border of active and silenced domains in the Nesp–Nespas region

We performed multiplex ChIP–PCR (see Table 1 for primers) using antisera against modified lysine residues in the conserved N-terminal tail of histones H3 and H4, as these modifications have been correlated with gene activation and gene silencing in nearly all organisms including yeast, plants, Drosophila and mammals (1012). We observed consistent data showing a sharp increase of acetylated histones (H3, H4) and methylated H3 Lys4 (dimethyl and trimethyl Lys4), and unchanging levels of dimethyl and trimethyl Lys9 over the Nesp–Nespas region (Fig. 1B and C). This sharp increase of acetylation and H3 Lys4 methylation may serve to separate active and silenced domains, similar to the boundaries reported in the chicken β-globin gene (13).

An acetylated histone H3 ‘allelic switch region’, ASR1, is located 2–5 kb downstream of the Nesp transcription site

To examine the boundaries in each parental allele separately we studied C57BL/6J ♀×Mus spretus ♂ skin fibroblast cells. These primary cultured F1 cells are homogeneous and have been shown to maintain Igf2-H19, Igf2r and Gnas1 imprinting faithfully in culture at three to 10 passages (14) (unpublished data). We sequenced M. spretus genomic DNA encompassing Gnas1, selected 30 informative polymorphic sites, and mapped histone modifications in steps of one or several nucleosomes using extensively sonicated formalin-fixed nuclei. The average chromatin fragment size was verified on an agarose gel as 200–400 bp DNA fragments (data not shown). Oligonucleotide primer pairs encompassing the selected polymorphic sites were designed to amplify ∼100 bp DNA fragment at ∼500 bp intervals across the Gnas1 gene region, which allowed us to map epigenetic modification in steps of one or several nucleosomes (Fig. 2A and Table 2). This fine resolution revealed differential histone acetylation modification in nucleosomes within a 1 kb region of the Nesp promoter (Fig. 2B and C sites 1–3). After verifying our allele-specific PCR using the C57BL/6J and M. spretus DNAs, we amplified target DNA fragments from input control chromatin (data not shown) and from chromatin preparations after ChIP (top panels in sections B–F of Fig. 2). We quantified the allelic histone modifications as enrichment of one allele compared with both alleles. The data after calibration with those from input control were plotted along the Nesp–Nespas–Gnaxl–Exon1A–Gnas regions (see diagrams at bottom panels of sections B–F in Fig. 2).

We observed allelic enrichment of histone H3 acetylation (Lys9 and Lys9+14) in the active promoters (maternal Nesp, and paternal Nespas–Gnasxl–Exon1A promoters; Fig. 2B and C).The interval Gnasxl–Exon1A region (sites 23–26) and Gnas region (sites 29–30) showed essentially equal allelic modifications. Within the Nesp–Nespas region, we identified ASR1, an acetylated histone H3 ‘switch region’ located 2–5 kb downstream of the Nesp transcription site (Fig. 2A). Acetylated histone H4 (Lys5–16), however, was dominant (>50%) on the paternal chromosome, even at the Nesp promoter where the paternal allele was silenced (Fig. 2D). This supports the notion that for imprinted genes, the acetylation status of H3, but not of H4, correlates specifically with DNA methylation and imprinted allelic expression (15).

ASR1 and ASR2 mark methyl Lys4 and methyl Lys9 switch regions, respectively

Methylation of histone H3 is associated with both active and suppressed chromosome domains. In fission yeast, Drosophila and mammals, methyl Lys4 marks the active domain, while methyl Lys9 marks the suppressed domain (reviewed in 11,12). Scanning allelic Lys4 tri-methylation across the Gnas1 gene revealed a pattern virtually identical to that of histone H3 acetylation including an ASR1 switch region at a similar location (Fig. 2E). Although the antisera directed against tri-methyl Lys4 was primarily specific for the tri-methyl lysine with a weak reactivity to di-methyl Lys4, the antisera raised to di-methyl Lys4 was specific for di-methyl Lys4 and did not cross-react to mono- or tri-methyl lysines. The ChIP assay using the highly specific antisera to di-methyl Lys4 yielded a pattern similar to that of tri-methyl Lys4 (data not shown). It has been reported that di-methylated H3 Lys4 is found in the coding region of active genes in budding yeast (16), while others have reported that tri-methylated H3 Lys4, and not its di-methylated counterpart, is consistently associated with active yeast euchromatin genes (17). However, we observed no significant differences in the allelic distribution of Lys4 di- and tri-methylation across the Nesp–Nespas region on each separate parental chromosome or on both chromosomes (Fig. 1C).

Amplified signals from di-methylated Lys9 ChIP were too weak for a reliable analysis but amplified products from tri-methylated Lys9 ChIP were robust (Fig. 2F). Since antisera to tri-methyl Lys9 of histone H3 was specific for tri-methyl Lys9 but had a slight cross-reactivity to tri-methyl Lys27, the data obtained with tri-methyl Lys9 antisera may reflect to some extent Lys27 tri-methylation. It is clear that tri-methylated Lys9 (and potentially some Lys27, which is not mentioned hereafter) was enriched in the silenced Nesp promoter of the paternal chromosome, and in the silenced Nespas–Gnasxl and Exon1A regions of the maternal chromosome (Fig. 2F). Within the allelic-expression switch region of Nesp–Nespas, we observed the Lys9-methylation ASR2 (sites 9–13), 5–7 kb downstream of Nesp, in a DNA region adjacent to the ASR1.

DNA methylation associates with Lys9 methylation in the allelic switch regions

To probe for correlations between histone modifications and DNA methylation, we quantified levels of DNA methylation at individual CpG sites on each parental chromosome by using parental allele-specific discrimination after PCR amplification and bisulfite-treated genomic DNA (18) (see Table 3 for allele-specific primers). As shown in Fig. 2G, in the differentially methylated regions (DMR1, 2 and 3), the silenced parental DNA was extensively methylated, while outside the DMRs, CpG dinucleotides can be hypo- or hyper-methylated but similar levels of methylation occur on both parental DNAs. Biallelic methylation upstream of the DMR2 (sites 14–16, primer sets h–j) was also observed by Southern blot analysis (19). Overall, on the maternal chromosome the pattern of CpG methylation across the region paralleled that of Lys9 methylation (Fig. 2F and G, compare the red lines). On the paternal chromosome, increased DNA methylation near the DMR1 matched the enrichment of paternal-specific Lys9 methylation (Fig. 2F and G, blue lines). However, CpG hyper-methylation at sites 14–16 on the paternal chromosome was associated with an absence of paternal H3 Lys9 methylation.

DISCUSSION

The epigenetic code of the nucleosomes across the 50 kb Gnas1 gene is summarized in Figure 3. Nucleosomes in the promoter region of Nesp, Nespas and Gnasxl exhibit a uniform histone code seen in other imprinted genes (14,2025). Histone acetylation, Lys4 methylation and the absence of DNA methylation in these nucleosomes constitute an ‘activating, ON’ signal. Conversely, the absence of these modifications (H3 acetylation and H3 Lys4 methylation) along with DNA methylation and H3 Lys9 methylation result in a ‘silencing, OFF’ response (Fig. 3, nucleosomes 3, 17–22 and 27–28). Weak or basal Lys9 (and Lys27) methylation present in some nucleosomes does not block the ‘ON’ signal (Fig. 3, nucleosomes 29–30). Since individual nucleosomes were not studied, our model may represent the epigenetic code of a group of nucleosomes situated at defined locations on different chromosomes of the same parental origin.

In the Nesp–Nespas region, there are two distinct switch regions, activating ASR1 and silencing ASR2. A group of nucleosomes in the ASRs may harbor either a silencing signal (paternal nucleosomes 5–8), or a composite of activating and silencing signals (nucleosomes 9–13). The presence of antagonistic activating and silencing signals has not previously been noted in the promoter region of a gene although both acetylation and methylation of H3 Lys9 can occur in pericentric heterochromatin (26) and in some active genomic locations (11,12). The mixed signals in the ASRs of the Gnas1 gene may derive from independent regulation of the activating and silencing modifications.

It has been proposed that some specialized DNA elements, or boundary elements, mark the borders between adjacent chromatin domains of heterochromatin and euchromatin, and serve as barriers against silencing effects from heterochromatin (27). While such DNA elements have not been previously reported in Gnas1, we have identified sharp increases of histone acetylation and H3 Lys4 methylation 7 kb downstream of Nesp, at the border of the ASR2 (Fig. 1C). These histone modifications are restricted to the paternal chromosome, as shown by parental allele-specific discrimination after PCR amplification (Fig. 2B–E). These paternal modifications may act as an allele-specific boundary, selectively protecting antisense transcription from silencing signals located at the adjacent suppressed Nesp promoter. Similar histone acetylation and methylation gradients have been shown to serve as boundary elements in telomeric silencing in budding yeast (28,29) and in the developmental expression of the chicken β-globin gene (13).

It is not clear whether the machinery for reading the histone code (10,11) operates only at promoter regions, making histone modifications at nucleosomes outside of the promoter region irrelevant, or if the relevant histone code resides over larger portions of the gene or even the entire chromosome domain. However, persistently active transcription must consist of accurate initiation and effective transcriptional elongation. Recent discoveries in yeast (6) and Drosophila (7) have linked the elongation process with the nucleosome remodeling process that consists of disassembling of histones before and reassembling of histones on nucleosomes after the RNA polymerase II (RNA-PII) complex has passed through. While disassembling of core histones occurs with hyper-acetylated histones, the reassembling process involves deacetylated histones, consistent with reports that both acetylation and deacetylation of histones are important for active transcription (30). Thus, histone deacetylation in the coding region (or elsewhere along the transcript) may serve as a transcriptional activation signal instead of a silencing signal. This formulation suggests a revision of the histone code that allows for linking covalent histone modification with transcription elongation (9).

On the maternal chromosome, transcription from Nesp must elongate through the three repressed (silenced) chromatin domains (Nespas, Gnasxl and Exon 1A) of Gnas (Fig. 1A). Similarly, on the paternal chromosome, the Nespas transcript must proceed through the repressed paternal Nesp domain. In the human GNAS1 gene and in other sense/antisense reciprocally-imprinted loci, such as the mouse Igf2r-Air (31) or the human PEG1-PEG1AS (18,32), sense and antisense transcripts must also elongate through repressed chromatin domains. We suggest that, in imprinted genes, ASRs are present and function as priming agents, which allow the transcriptional elongation machinery to adapt gradually to the silenced domain before completely overcoming the suppressed chromatin structure of nearby imprinted promoters. Thus, silencing signals in the imprinted promoter region act locally to suppress local transcription initiation. Our model would suggest that deletion of an ASR would bring the suppressed promoter in close proximity to the active promoter resulting in the latter's inactivation; gene deletion studies will be needed to verify this prediction.

In conclusion, despite the intricacy of multiple epigenetic codes and the complex transcription initiation and elongation processes, we suggest that in the Gnas1 as well as in other imprinted genes, silencing signals (DNA methylation and H3 Lys9 methylation) operate at imprinted promoters to lock out transcriptional initiation. These domains are independently regulated in ASRs that may define boundary elements in the Gnas1 region, and, possibly, in other regions of the epigenome.

MATERIALS AND METHODS

F1 skin fibroblast cells

We used interspecific mice (C57BL/6J female×M. spretus male). All animal procedures and housing were performed according to protocols approved by the Institutional Care and Use Committee at the Veterans Affairs Palo Alto Health Care System. Fresh skin of newborn F1 mice was removed, minced and cultured as described previously (33). Skin fibroblast cells at passages 3–6 were used in this study.

Antisera against modified histones

Antisera specific for histone H4 acetylation (acetyl Lys5, 8, 12, and 16; catalog no. 06-866), and H3 acetylation (di-acetyl Lys9 and Lys14; catalog no. 06-599) were obtained from Upstate Biotechnology (Waltham, MA, USA). Antiserum specific for H3 Lys9 acetylation (catalog no. 9617) was from Cell Signaling Technology (Beverly, MA, USA). Antisera specific for H3-di-methyl Lys4 (catalog no. ab7766), H3-di-methyl Lys9 (catalog no. ab7312), H3 tri-methyl Lys4 (catalog no. ab8580) and H3 tri-methyl Lys9 (catalog no. ab8898) were obtained from Abcam (Cambridge, UK). These antisera have been used in numerous studies (data from the suppliers) and in our previous studies (25).

Gnas1 polymorphisms and DNA sequencing

We sequenced the M. spretus Gnas1 gene by conventional PCR cloning sequencing. The amplified PCR products were verified by agarose gel electrophoresis and cloned by TOPO-TA cloning kit (Invitrogen, CA, USA). DNA sequencing was performed on an ABI 377 sequencer using Big-Dye terminator chemistry (Perkin Elmer). Polymorphic sites (between M. spretus and C57BL/6J) that allowed discrimination of parental alleles due to insertion/deletion of DNA or alterations in restriction enzyme sites were selected for this study.

Chromatin immunoprecipitation

We performed ChIP assay as previously described (25). Briefly, about 5 million cells were fixed with 1% formaldehyde, and were then sonicated for 180 s (10 s on and 5 s off) on ice by a Branson sonicator with a 2 mm microtip and setting of 40% for output control and 90% for duty cycle. The sonicated chromatin (0.9 ml) was clarified by centrifugation, aliquoted and snap frozen in liquid nitrogen. To perform ChIP, sonicated chromatin (150 µl) was diluted 10-fold, cleared with salmon sperm DNA/protein A-agarose (80 µl), and purified with specific antiserum (2–5 µl) and protein A-agarose (60 µl). The DNA from the bound chromatin after cross-linking reversal and proteinase K treatment was precipitated and diluted in 100 µl of low-TE buffer (1 mM Tris, 0.1 mM EDTA).

ChIP–PCR and restriction enzyme digestion

Duplicate PCR reactions (3 µl under liquid wax) contained 1 µl ChIP (or input) DNA, 0.1 µM appropriate primer pairs (Tables 1 and 2), 50 µM deoxynucleotide triphosphate, and 0.2 units KlenTaq I (Ab Peptides, St Louis, MO, USA). Standard PCR conditions were 95°C for 60 s, followed by 30 cycles of 95°C for 10 s and 65°C annealing (and extension) temperature for 90 s, and finally 72°C for 10 min. All primer sets were tested for the absence of primer–dimer products. To avoid heteroduplex complication that may interfere with restriction enzyme digestion, one primer of each primer pair was end-labeled with γ32P ATP (Table 2). The γ32P-labeled primer was added in 1×PCR mixture (1 µl) at the last cycle of amplification. PCR products were digested with appropriate enzymes (New England Biolabs, MA, USA, 1 unit) listed in Table 2 in a total volume of 6 µl for 6–12 h under liquid wax. The digested products were separated on a 5% polyacrylamide–urea gel and quantified by a PhosphoImager (Molecular Dynamics, Sunnyvale, CA, USA). The relative enrichment of modified histones at each specific site was determined as described previously (34) using L7 ribosomal protein gene as an internal control. The allelic levels of modified histones in one parental allele (percentage of both alleles) at each specific site were calibrated with those from input DNA (DNA before ChIP).

Allele-specific methylation-restriction PCR

The methylation status of individual CpGs on each parental allele was assessed by allele-specific (AS) amplification of bisulfite treated DNA and digestion with a restriction enzyme specific for the unchanged CpG sequence (methylation and restriction, MR) (18,35). DNA from F1 skin cells (input DNA) was treated with bisulfite as described previously (18). We designed PCR primer sets to amplify paternal or maternal allele (based on SNPs between C57BL/6J and M. spretus) of bisulfite-treated DNA (C to T conversion, except CpG site). Each allele-specific primer set consists of a paternal/maternal specific primer and a paternal-and-maternal common primer (Table 3). The PCR amplified product encompasses a CpG restriction site. Bisulfite-treated F1 DNA was amplified for 33 cycles by a standard PCR protocol at optimal annealing temperatures determined by an Eppendorff gradient-thermal cycler (Table 3). The PCR products were verified on agarose gel, diluted 10-fold and re-amplified for 10 cycles using a primer set containing γ32P end-labeled primer. 32P-labeled PCR products were digested with appropriate enzymes and analyzed by a PhosphoImager. The ratio of digested band/(digested+undigested band) represents the percent of cytosine methylation at a specific CpG site.

ACKNOWLEDGEMENTS

This work was supported by NIH Grant DK36054 and the Medical Research Service of the Department of Veterans Affairs.

The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors.

Figure 1. (A) Map of maternal and paternal transcripts in Gnas1. On the maternal chromosome Nesp is transcribed (‘ON’) while Nespas, Gnasxl and Exon 1A are silenced (‘OFF’). Conversely, on the paternal chromosome, Nesp is ‘OFF’ while Nespas, Gnasxl, and Exon 1A are ‘ON’. The Nesp, Gnasxl and Exon 1A transcripts are spliced to exon 2 while Nespas is an antisense transcript. Nesp and Nespas are transcribed and elongated through the suppressed OFF chromatin domains (transcription paths shown by shaded bold lines). The Nesp–Nespas region is drawn to scale (GenBank accession no. AL593857) showing location of the ChIP–PCR sites (1–15 in italic, Table 1). (B) ChIP-PCR assay across Nesp–Nespas (see Table 1 for primers). PCR was performed in duplicate using F1 skin cells and antisera against acetylated (H3 Lys9+14, H3 Lys9, and H4 Lys5+8+12+16) and methylated (H3 Lys4 and H3 Lys9) histones. Input DNA was DNA control before immunoprecipitation. Each PCR yielded a specific target product and a control product from ribosomal L7 protein gene. Arrows with asterisks mark the location of a sharp increase in histone acetylation and H3 Lys4 methylation. Doublet bands (marked in panel ChIP 14) were too closed and were not quantified in (C). (C) PhosphoImager scanning data from (B). Relative enrichments (fold) of histone modification across Nesp–Nespas, which were calculated as described previously using L7 internal control and input DNA (25), were plotted along Nesp–Nespas DNA. Data were mean values of duplicate assays with variation range shown by a vertical line.

Figure 1. (A) Map of maternal and paternal transcripts in Gnas1. On the maternal chromosome Nesp is transcribed (‘ON’) while Nespas, Gnasxl and Exon 1A are silenced (‘OFF’). Conversely, on the paternal chromosome, Nesp is ‘OFF’ while Nespas, Gnasxl, and Exon 1A are ‘ON’. The Nesp, Gnasxl and Exon 1A transcripts are spliced to exon 2 while Nespas is an antisense transcript. Nesp and Nespas are transcribed and elongated through the suppressed OFF chromatin domains (transcription paths shown by shaded bold lines). The Nesp–Nespas region is drawn to scale (GenBank accession no. AL593857) showing location of the ChIP–PCR sites (1–15 in italic, Table 1). (B) ChIP-PCR assay across Nesp–Nespas (see Table 1 for primers). PCR was performed in duplicate using F1 skin cells and antisera against acetylated (H3 Lys9+14, H3 Lys9, and H4 Lys5+8+12+16) and methylated (H3 Lys4 and H3 Lys9) histones. Input DNA was DNA control before immunoprecipitation. Each PCR yielded a specific target product and a control product from ribosomal L7 protein gene. Arrows with asterisks mark the location of a sharp increase in histone acetylation and H3 Lys4 methylation. Doublet bands (marked in panel ChIP 14) were too closed and were not quantified in (C). (C) PhosphoImager scanning data from (B). Relative enrichments (fold) of histone modification across Nesp–Nespas, which were calculated as described previously using L7 internal control and input DNA (25), were plotted along Nesp–Nespas DNA. Data were mean values of duplicate assays with variation range shown by a vertical line.

Figure 2. Allele-specific histone modifications across Gnas1. (A) The Gnas1 map and the sites of the 30 ChIP–PCR assays across Gnas1 where the two parental alleles could be distinguished (Table 2). Arrows with asterisks mark the location of a sharp increase in histone acetylation and H3 Lys4 methylation. Duplicate ChIP–PCR was performed using F1 skin cells and antisera against acetylated H3 at Lys9+14 (B), acetylated H3 at Lys9 (C), acetylated H4 at Lys5+8+12+16 (D), tri-methylated H3 Lys4 (E), and tri-methylated H3 Lys9 (F). Maternal (red square) or paternal (blue diamond) PCR products are identified by restriction enzyme digestion (Table 2). Relative enrichment of histone modifications in each parental allele (as percentage of the two alleles) is calibrated against input DNA (not shown). The red line indicates maternal allele, and the blue line paternal allele. Mean values from duplicate PCRs are plotted along Gnas1 gene. (G) Relative levels of DNA methylation at particular CpG sites by ASMR-PCR. Average values from three experiments of duplicate PCR (PCR primer sets in Table 3) are shown. The CpG sites (primer set a–p, on top) were marked relative to the ChIP-PCR sites (site 1–30, at the bottom). Red line and blue line represent maternal and paternal allele, respectively.

Figure 2. Allele-specific histone modifications across Gnas1. (A) The Gnas1 map and the sites of the 30 ChIP–PCR assays across Gnas1 where the two parental alleles could be distinguished (Table 2). Arrows with asterisks mark the location of a sharp increase in histone acetylation and H3 Lys4 methylation. Duplicate ChIP–PCR was performed using F1 skin cells and antisera against acetylated H3 at Lys9+14 (B), acetylated H3 at Lys9 (C), acetylated H4 at Lys5+8+12+16 (D), tri-methylated H3 Lys4 (E), and tri-methylated H3 Lys9 (F). Maternal (red square) or paternal (blue diamond) PCR products are identified by restriction enzyme digestion (Table 2). Relative enrichment of histone modifications in each parental allele (as percentage of the two alleles) is calibrated against input DNA (not shown). The red line indicates maternal allele, and the blue line paternal allele. Mean values from duplicate PCRs are plotted along Gnas1 gene. (G) Relative levels of DNA methylation at particular CpG sites by ASMR-PCR. Average values from three experiments of duplicate PCR (PCR primer sets in Table 3) are shown. The CpG sites (primer set a–p, on top) were marked relative to the ChIP-PCR sites (site 1–30, at the bottom). Red line and blue line represent maternal and paternal allele, respectively.

Figure 3. Schematic representation of histone code of nucleosomes across Gnas1. Representation of nucleosomes across Gnas1 shows the status of specific histone modifications and DNA methylation. A nucleosome model (bottom left) shows DNA wrapping two turns around a histone octamer (unmethylated DNA, white; methylated DNA, black) with N-termini tails of H3 (three lysines 4, 9 and 14; top) and H4 (four lysines 5, 8, 12 and 16; bottom) spread out. Two groups of activating and silencing signals segregate independently across the ASR1 and ASR2, which generate uniform signals in the promoter regions (white flags and white lollipops=ON; black lollipops and black DNA=OFF), but ‘mixed signals’ of activating and silencing are present in the ASRs.

Figure 3. Schematic representation of histone code of nucleosomes across Gnas1. Representation of nucleosomes across Gnas1 shows the status of specific histone modifications and DNA methylation. A nucleosome model (bottom left) shows DNA wrapping two turns around a histone octamer (unmethylated DNA, white; methylated DNA, black) with N-termini tails of H3 (three lysines 4, 9 and 14; top) and H4 (four lysines 5, 8, 12 and 16; bottom) spread out. Two groups of activating and silencing signals segregate independently across the ASR1 and ASR2, which generate uniform signals in the promoter regions (white flags and white lollipops=ON; black lollipops and black DNA=OFF), but ‘mixed signals’ of activating and silencing are present in the ASRs.

Table 1.

PCR primer sets for ChIP-PCR scanning in Nesp–Nespas region

Primer set (italic) Prime no. Sequence (5′ to 3′) Nucleotide locationa PCR product (bp) 
1 1607 
TCAGTGGAGGCACCTCTCGGAGTC
 
2047 127 
 1608 
CGCCTCAGCTTGTGGCTGTAAGTA
 
2173  
2 320 
TTCAGACCCCAGCTTCTCTCCT
 
2247 128 
 324 
CCATTCTCTTAGGTGCTCACCGA
 
2274  
3 343 
ATCCCCATCCGGCGTCACTAATGGG
 
3112 174 
 341 
TGCATTTCGGGCTGATTAATGGGCA
 
3285  
4 1632 
GATAGTGCTTGGAGGACACTCAGTG
 
3941 120 
 332 
TGCCTAACCAGCTGCGCGATAC
 
4060  
5 360 
CTGCGGCTAATTGCGACTTTGGTCA
 
4753 130 
 1633 
GTCTCACTTAGGCAATTTCACGCT
 
4882  
6 1634 
CTTGCACTGTCTACCTGAGTCACAG
 
5462 117 
 1635 
TACCTGGAGTCAGGATGGCGCTAG
 
5578  
7 1636 
AGGGCCAGAGACCAGTGATGTC
 
6447 121 
 1637 
CCTCATGTGGAGCACGGGATCA
 
6567  
8 370 
CACACACGTATCAAACACATGCAC
 
7299 130 
 1638 
GAGTAGGTGCATGTGTCGGGTATG
 
7428  
9 1639 
CATGTTACACACTAGCAAGGGGATG
 
8301 145 
 1640 
GTGCTTTTGTGCACCCATGAAATGT
 
8445  
10 366 
CATGTGGACACCTTGTGCAGGCAC
 
9196 170 
 362 
TGAATACAGCTGGTCAACTCTGGATG
 
9365  
11 1141 
GAAGCAGTTACTTGGGGTATCTGG
 
9954 147 
 1642 
CCCTGGGCTGGGTGCTTGTTTACA
 
10 100  
12 1643 
CGTGCGCGCATACACTCACCCGAGC
 
10 676 128 
 388 
CTGGGGCCTTACCCTACTAGGAGTGA
 
10 803  
13 367 
CAGCTTTTCCAGCCAGGGGCAACTCTGTA
 
11 194 149 
 363 
ACTGTCCTGTGTGAGGCAGGATA
 
11 342  
14 371 
GACTCACGGCGACCGTGGCCTTCTA
 
13 045 76 
 376 
TTGGTGGGTTGGTTGGAAGCGGTT
 
13 120  
15 368 
CCCAGTTGGCCTATTCGGTGTATGT
 
13 293 129 
 364 
GAACACACTGCATGCCGGACACTT
 
13 421  
Control L7 1290 
GAAAGGCAAGGAGGAAGCTCATCT
 
224 80 
 1291 
AATCTCAGTGCGGTACATCTGCCT
 
303  
Primer set (italic) Prime no. Sequence (5′ to 3′) Nucleotide locationa PCR product (bp) 
1 1607 
TCAGTGGAGGCACCTCTCGGAGTC
 
2047 127 
 1608 
CGCCTCAGCTTGTGGCTGTAAGTA
 
2173  
2 320 
TTCAGACCCCAGCTTCTCTCCT
 
2247 128 
 324 
CCATTCTCTTAGGTGCTCACCGA
 
2274  
3 343 
ATCCCCATCCGGCGTCACTAATGGG
 
3112 174 
 341 
TGCATTTCGGGCTGATTAATGGGCA
 
3285  
4 1632 
GATAGTGCTTGGAGGACACTCAGTG
 
3941 120 
 332 
TGCCTAACCAGCTGCGCGATAC
 
4060  
5 360 
CTGCGGCTAATTGCGACTTTGGTCA
 
4753 130 
 1633 
GTCTCACTTAGGCAATTTCACGCT
 
4882  
6 1634 
CTTGCACTGTCTACCTGAGTCACAG
 
5462 117 
 1635 
TACCTGGAGTCAGGATGGCGCTAG
 
5578  
7 1636 
AGGGCCAGAGACCAGTGATGTC
 
6447 121 
 1637 
CCTCATGTGGAGCACGGGATCA
 
6567  
8 370 
CACACACGTATCAAACACATGCAC
 
7299 130 
 1638 
GAGTAGGTGCATGTGTCGGGTATG
 
7428  
9 1639 
CATGTTACACACTAGCAAGGGGATG
 
8301 145 
 1640 
GTGCTTTTGTGCACCCATGAAATGT
 
8445  
10 366 
CATGTGGACACCTTGTGCAGGCAC
 
9196 170 
 362 
TGAATACAGCTGGTCAACTCTGGATG
 
9365  
11 1141 
GAAGCAGTTACTTGGGGTATCTGG
 
9954 147 
 1642 
CCCTGGGCTGGGTGCTTGTTTACA
 
10 100  
12 1643 
CGTGCGCGCATACACTCACCCGAGC
 
10 676 128 
 388 
CTGGGGCCTTACCCTACTAGGAGTGA
 
10 803  
13 367 
CAGCTTTTCCAGCCAGGGGCAACTCTGTA
 
11 194 149 
 363 
ACTGTCCTGTGTGAGGCAGGATA
 
11 342  
14 371 
GACTCACGGCGACCGTGGCCTTCTA
 
13 045 76 
 376 
TTGGTGGGTTGGTTGGAAGCGGTT
 
13 120  
15 368 
CCCAGTTGGCCTATTCGGTGTATGT
 
13 293 129 
 364 
GAACACACTGCATGCCGGACACTT
 
13 421  
Control L7 1290 
GAAAGGCAAGGAGGAAGCTCATCT
 
224 80 
 1291 
AATCTCAGTGCGGTACATCTGCCT
 
303  

aNucleotide location of Gnas 1 gene in GenBank no. AL593857: y=67991−x. Nucleotide location of control L7 gene in GenBank no. NM-011291.

Table 2.

PCR primers for allelic ChIP–PCR assay

Primer set Prime no. Sequence (5′ to 3′) Nucleotide locationa PCR (bp) Polymorphic site Allelic differentiation (bp) 
       C57BL Spretus 
Nsep 1592 *
TGGTCTTCCAGCACACCTCAGTGGA
 
1376 68 Alu42 68 
  1736 
TAGGRATTTGCAAGCCGACAGT
 
1444     
 341 *
ACGGATCCTCATTCCCCTGAATATTTA
 
1628 102 NlaIII 72 102 
  1606 
GGGGTTGTCCCCACTCCTCAACTT
 
1730     
 339 *
TTAAGGTAGGTACATCCCTTCTTTT
 
2201 174 Sau96I 91 118 
  324 
CCATTCTCTTAGGTGCTCACCGA
 
2374     
 1737 *
GACAGATGGGAGGCAAGGTG
 
3229 100 Msp60 100 
  1738 
GTGCCCTGGAGAGACTTGAAGA
 
3228     
 1739 
GAGTTGGCTTTAGGTAGAGC
 
3560 91 Bsr62 91 
  1678 *
TACTGTAGCTATGGCGCAGCAGTC
 
3650     
 1740 
CTGTTTTTGGAACCTGTAACCTG
 
4339 96 MnlIII 74 96 
  1741 *
GAAAGCATTCTAAGGTGCGTTA
 
4434     
 1634 
CTTGCACTGTCTACCTGAGTCACAG
 
5462 117 Alu65 117 
  1635 *
TACCTGGAGTCAGGATGGCGCTAG
 
5568     
 1684 *
CAGGGCTTTTCTAGCAGGTCCTCA
 
5724 88/82 Ins/del 88 82 
  1720 
TGCCAGTCCATTCAAATGCTAA
 
5811     
 1721 *
AGTGATGTCACCTTGTTAGCTCA
 
6462 106 Bsr106 74 
  1637 
TCCCTCATGTGGAGCACGGGATCA
 
6567     
 10 1686 *
TATGCTGCAAGGCCTGGTAATAGC
 
7244 90 AflIII 59 90 
  1722 
TGTATGAGTACGTGCATGTGT
 
7333     
 11 1687 
CTACAGAATGGAGTTCTCATAAGG
 
8665 136 AluI77 77 136 
  1724 *
AGGAATGGGAGCCTCAGAGGCTG
 
8799     
 12 1690 *
CAGCCTCTGAGGCTCCCATTCCTA
 
8777 114 ScrFI 88 78 
  1688 
GACACATAAGCCAGGAGAATCAGC
 
8890     
 13 1723 *
GGCAAGCTAAGGCACAATTTGGT
 
9235 131 NlaIII 131 99 
  362 
TGAATACAGCTGGTCAACTCTGGATG
 
9365     
 14 1691 *
TGTGACTTTCAAAAGGTCACCTG
 
10 178 132 Rsa132 105 
  1725 
TATTAGAAAGGACTGGTAAGGAG
 
10 309     
 15 1643 *
CGTGCGCGCATACACTCACCCGAGC
 
10 676 128 Sau96I 88 128 
  388 
CTGGGGCCTTACCCTACTAGGAGTGAG
 
10 803     
 16 1693 *
TGAAACCCAGTAAGGTGACTCCA
 
10 877 124 NlaIII 124 95 
  1694 
CAAGAGGGCCTGTAGCAGAAGGT
 
10 999     
 17 1695 *
CACAGGACAGTCACCATAACA
 
11 333 81/74 Ins/del 81 74 
  1696 
TGTGCATCATGGCTTCTTAGCCT
 
11 413     
 18 1699 *
CTGAACAAAGAGAACCTGAAACCAT
 
12 630 139 Fok53 71 
  1726 
AGGTCAGTAGACGCTGAGGTTG
 
12 768     
Nespas 19 1610 *
CTCTGGGGGTTCACTTTGTCTGCT
 
13 467 121 Pst121 88 
  1727 
ATTCTCTGAAGTCTAACATGTC
 
13 587     
Gnasxl 20 1595 
CAACGAGCCTGCCCAGGGAGACCATAG
 
16 065 150 Hha93 150 
  1611 *
CTGTAGTCTTCTCGGAAGCCAGCGT
 
16 214     
 21 1906 *
AGAAGCCATTGAGATGCGAGAGC
 
17 796 120 Rsa91 120 
  1907 
CATTACCTAGAAGCAGCAGGCGGT
 
17 920     
 22 1908 *
CGTGAGGTGAGCCCAGAACTGCTG
 
18 217 87 Msp48 87 
  336 
CTGTCTGAGTCGAAGCAGCCGTGC
 
18 351     
 23 1909 *
CACTAACTGTCTAGCTTCATTACG
 
20 624 123 AflIII 123 94 
  1910 
TAAAGCAACAGATGACTGTGGA
 
20 746     
 24 1913 *
TGAGGTTGAGGGGAGCACAGGGTTG
 
32 169 117/98 Ins/del 117 98 
  1914 
TCACAGAAGGTTCCCTGTATGAGT
 
32 261     
 25 1915 *
ACCTTGGCAAAGAGCATGGGA
 
32 498 42/48 Ins/del 42 48 
  1916 
GGCTCATATGTATAGGAGACTA
 
32 543     
 26 1922 
GTCAATGCTAGGCCGAAACCGTAGAT
 
43 060 126 Hph126 89 
  1923 *
CTGAAACACAAGCTGCTTTGTGGTC
 
43 185     
Exon 1A 27 1597 *
CTCGCCTGCATAATGCTGCCTGCTTC
 
44 895 140 Alu107 140 
  1613 
CGGCGCGTGCTCGTGGATGTGGGTG
 
45 034     
 28 1614 *
TCTTGGGCGTGCCCGTACCCCTCAA
 
45 211 121 HaeIII 121 75 
  1615 
CTGAGGACGTGCTCAATGGGCTGC
 
45 331     
Gnas 29 338 *
GGCAAAGCACCATTGTGAAGCA
 
51 923 134 Sau96108 134 
  1919 
CAAACGTCCTGTCTCCTGCAGGC
 
52 056     
 30 1920 *
CTGCAGGTTTCACTGGAGTCAACTG
 
52 429 105 Mse105 75 
  1921 
TCGGCAAGGGTTGTGGATTCCAA
 
52 429     
Primer set Prime no. Sequence (5′ to 3′) Nucleotide locationa PCR (bp) Polymorphic site Allelic differentiation (bp) 
       C57BL Spretus 
Nsep 1592 *
TGGTCTTCCAGCACACCTCAGTGGA
 
1376 68 Alu42 68 
  1736 
TAGGRATTTGCAAGCCGACAGT
 
1444     
 341 *
ACGGATCCTCATTCCCCTGAATATTTA
 
1628 102 NlaIII 72 102 
  1606 
GGGGTTGTCCCCACTCCTCAACTT
 
1730     
 339 *
TTAAGGTAGGTACATCCCTTCTTTT
 
2201 174 Sau96I 91 118 
  324 
CCATTCTCTTAGGTGCTCACCGA
 
2374     
 1737 *
GACAGATGGGAGGCAAGGTG
 
3229 100 Msp60 100 
  1738 
GTGCCCTGGAGAGACTTGAAGA
 
3228     
 1739 
GAGTTGGCTTTAGGTAGAGC
 
3560 91 Bsr62 91 
  1678 *
TACTGTAGCTATGGCGCAGCAGTC
 
3650     
 1740 
CTGTTTTTGGAACCTGTAACCTG
 
4339 96 MnlIII 74 96 
  1741 *
GAAAGCATTCTAAGGTGCGTTA
 
4434     
 1634 
CTTGCACTGTCTACCTGAGTCACAG
 
5462 117 Alu65 117 
  1635 *
TACCTGGAGTCAGGATGGCGCTAG
 
5568     
 1684 *
CAGGGCTTTTCTAGCAGGTCCTCA
 
5724 88/82 Ins/del 88 82 
  1720 
TGCCAGTCCATTCAAATGCTAA
 
5811     
 1721 *
AGTGATGTCACCTTGTTAGCTCA
 
6462 106 Bsr106 74 
  1637 
TCCCTCATGTGGAGCACGGGATCA
 
6567     
 10 1686 *
TATGCTGCAAGGCCTGGTAATAGC
 
7244 90 AflIII 59 90 
  1722 
TGTATGAGTACGTGCATGTGT
 
7333     
 11 1687 
CTACAGAATGGAGTTCTCATAAGG
 
8665 136 AluI77 77 136 
  1724 *
AGGAATGGGAGCCTCAGAGGCTG
 
8799     
 12 1690 *
CAGCCTCTGAGGCTCCCATTCCTA
 
8777 114 ScrFI 88 78 
  1688 
GACACATAAGCCAGGAGAATCAGC
 
8890     
 13 1723 *
GGCAAGCTAAGGCACAATTTGGT
 
9235 131 NlaIII 131 99 
  362 
TGAATACAGCTGGTCAACTCTGGATG
 
9365     
 14 1691 *
TGTGACTTTCAAAAGGTCACCTG
 
10 178 132 Rsa132 105 
  1725 
TATTAGAAAGGACTGGTAAGGAG
 
10 309     
 15 1643 *
CGTGCGCGCATACACTCACCCGAGC
 
10 676 128 Sau96I 88 128 
  388 
CTGGGGCCTTACCCTACTAGGAGTGAG
 
10 803     
 16 1693 *
TGAAACCCAGTAAGGTGACTCCA
 
10 877 124 NlaIII 124 95 
  1694 
CAAGAGGGCCTGTAGCAGAAGGT
 
10 999     
 17 1695 *
CACAGGACAGTCACCATAACA
 
11 333 81/74 Ins/del 81 74 
  1696 
TGTGCATCATGGCTTCTTAGCCT
 
11 413     
 18 1699 *
CTGAACAAAGAGAACCTGAAACCAT
 
12 630 139 Fok53 71 
  1726 
AGGTCAGTAGACGCTGAGGTTG
 
12 768     
Nespas 19 1610 *
CTCTGGGGGTTCACTTTGTCTGCT
 
13 467 121 Pst121 88 
  1727 
ATTCTCTGAAGTCTAACATGTC
 
13 587     
Gnasxl 20 1595 
CAACGAGCCTGCCCAGGGAGACCATAG
 
16 065 150 Hha93 150 
  1611 *
CTGTAGTCTTCTCGGAAGCCAGCGT
 
16 214     
 21 1906 *
AGAAGCCATTGAGATGCGAGAGC
 
17 796 120 Rsa91 120 
  1907 
CATTACCTAGAAGCAGCAGGCGGT
 
17 920     
 22 1908 *
CGTGAGGTGAGCCCAGAACTGCTG
 
18 217 87 Msp48 87 
  336 
CTGTCTGAGTCGAAGCAGCCGTGC
 
18 351     
 23 1909 *
CACTAACTGTCTAGCTTCATTACG
 
20 624 123 AflIII 123 94 
  1910 
TAAAGCAACAGATGACTGTGGA
 
20 746     
 24 1913 *
TGAGGTTGAGGGGAGCACAGGGTTG
 
32 169 117/98 Ins/del 117 98 
  1914 
TCACAGAAGGTTCCCTGTATGAGT
 
32 261     
 25 1915 *
ACCTTGGCAAAGAGCATGGGA
 
32 498 42/48 Ins/del 42 48 
  1916 
GGCTCATATGTATAGGAGACTA
 
32 543     
 26 1922 
GTCAATGCTAGGCCGAAACCGTAGAT
 
43 060 126 Hph126 89 
  1923 *
CTGAAACACAAGCTGCTTTGTGGTC
 
43 185     
Exon 1A 27 1597 *
CTCGCCTGCATAATGCTGCCTGCTTC
 
44 895 140 Alu107 140 
  1613 
CGGCGCGTGCTCGTGGATGTGGGTG
 
45 034     
 28 1614 *
TCTTGGGCGTGCCCGTACCCCTCAA
 
45 211 121 HaeIII 121 75 
  1615 
CTGAGGACGTGCTCAATGGGCTGC
 
45 331     
Gnas 29 338 *
GGCAAAGCACCATTGTGAAGCA
 
51 923 134 Sau96108 134 
  1919 
CAAACGTCCTGTCTCCTGCAGGC
 
52 056     
 30 1920 *
CTGCAGGTTTCACTGGAGTCAACTG
 
52 429 105 Mse105 75 
  1921 
TCGGCAAGGGTTGTGGATTCCAA
 
52 429     

* End-labeled primers.

aNucleotide location in the GenBank no. AL593857: y=67991−x.

Table 3.

Allele-specific primer sets for methylation analysis of individual CpG of Gnas1 by ASMR–PCR

Allele-specific primers  Primer no. Sequence (5′ to 3′)a  Location of CpG site, xb Optimal Tm (°C)c Restrictiond enzyme Methylation 
        Unmethylated band (bp) Methylated band (bp) 
Nesp a 1804 
AATTATCCCCACTCCTCAACTTTTTCTCC
 
     
  1805 
AATTATCCCCACTCCTCAACTTTTTCTCT
 
1630 60 Rsa139 100 
  1806 *
AAGTATTTACGTTTTTCGGTTATTAATAT
 
     
 b 1802 
GTGGTTTTATTGCGTAAGGATTGTTGGG
 
     
  1801 
GTGGTTTTATTGCGTAAGGATTGTTGGA
 
2290 60 Taq112 81 
  1803 *
ATACATCCCTTCTTTTTACCCCRAAAC
 
     
 c 1815 
CAACRAAATTAACTTTAAATAAAACCCAC
 
     
  1816 
CAACRAAATTAACTTTAAATAAAACCCAT
 
3191 60 Taq165 130 
  1817 *
GTTACGTGCGATTTAGGTTTTAGAGTTG
 
     
 d 1822 
CTAAAAAAAAAAAAAAAAATTATACRAACC
 
     
  1823 
CTAAAAAAAAAAAAAAAAATTATACRAACR
 
5436 57 BstU I 131 100 
  1821 *
GGTTTATATTCGGGGTATTTAAATAGGA
 
     
 e 1825 
TAAAACRAAATTAACATTTAAATAAACC
 
     
  1824 
TAAAACRAAATTAACATTTAAATAAACT
 
5872 57 Taq128 92 
  1826 *
AAAGTTTTTGGAAGGTAGTTTAATTAG
 
     
 f 1827 
TAATATCACCTTATTAACTCAAATACTAC
 
     
  1828 
TAATATCACCTTATTAACTCAAATACCAA
 
6552 57 Rsa136 88 
  1829 *
ATTAGTGGTTAAATTTTATAATAGGATA
 
     
 g 1833 
GTTTAGAGTTTATAGGTTTTTTTTTTTYG
 
     
  1834 
GTTTAGAGTTTATAGGTTTTTTTTTTTTT
 
8993 60 Taq197 169 
  1879 *
TAAAAATTATAAACACCCAAAAACTTCGA
 
     
 h 1838 
TTCGTATTAGAAAGGATTGGTAAGGAGTG
 
     
  1839 
TTCGTATTAGAAAGGATTGGTAAGGAGTA
 
10 219 60 HpyCH4 IV 128 95 
  1840 *
TCAAAAAATCACCTAATTATTTCTAACTT
 
     
 i 1808 
CCCTACTAAAAATAAAATTTCTAATAATCC
 
     
  1789 
CCCTACTAAAAATAAAATTTCTAATAATCA
 
10 696 57 Taq170 98 
  1800 *
GATATTAGAATTAGTTTTAATAAGTTGT
 
     
 j 1841 
GATTTTTTAAGTTTTTTGGTTAGGTTATA
 
     
  1842 
GATTTTTTAAGTTTTTTGGTTAGGTTATG
 
11 096 57 Taq183 154 
  1843 *
ATAAATTCATACTAAAAAAAACAAAACTC
 
     
 k 1844 
AATTTGAAATTATTTTTTTTTTTTTTTGG
 
     
  1845 
AATTTGAAATTATTTTTTTTTTTTTTTGT
 
12 723 57 BstU I 114 83 
  1846 *
CTAAAATTAACGACCCAAAAAAACCRCCA
 
     
 l 1847G 
GTTTYGTTATTTTGAGTGTGTGTGTGTGG
 
     
  1847A 
GTTTYGTTATTTTGAGTGTGTGTGTGTGA
 
13 598 63 HpyCH4 IV 153 118 
  1848 *
AACCCCCAAAAAATACCTACRACCTACC
 
     
Nespas m 1849 
CAAAAAACTATAATATACCGAACCTAT
 
     
  1850 
CAAAAAACTATAATATACCGAACCTAC
 
13 343 57 BstU I 107 72 
  1851 *
AGATGGGTATATTGTAAGATGTATGTTG
 
     
Gnasxl n 1852 
AGTTTTTTTTGTAAGTTTTAGATTTTGYG
 
     
  1853 
AGTTTTTTTTGTAAGTTTTAGATTTTGTT
 
16 161 57 BstU I 137 69 
  1854 *
TTCTTCAAAAAAAAAACTATAATCTTCTC
 
     
Exon 1A o 1855 
CCCCATATAAAACATTACGATTAATTAAC
 
     
  1856 
CCCCATATAAAACATTACGATTAATTAAT
 
45 029 57 BstU I 128 57 
  1857 *
GYGTTTTTTTATTTTAGTTTTTTAGATAG
 
     
 p 1858 
ATTTATATTAGAGGTGTTYGYGTATTGGA
 
     
  1859 
ATTTATATTAGAGGTGTTYGYGTATTGGT
 
45 347 60 BstU I 134 91 
  1860 *
AAACCGACCCATAAACAATAACCCCTAT
 
     
Allele-specific primers  Primer no. Sequence (5′ to 3′)a  Location of CpG site, xb Optimal Tm (°C)c Restrictiond enzyme Methylation 
        Unmethylated band (bp) Methylated band (bp) 
Nesp a 1804 
AATTATCCCCACTCCTCAACTTTTTCTCC
 
     
  1805 
AATTATCCCCACTCCTCAACTTTTTCTCT
 
1630 60 Rsa139 100 
  1806 *
AAGTATTTACGTTTTTCGGTTATTAATAT
 
     
 b 1802 
GTGGTTTTATTGCGTAAGGATTGTTGGG
 
     
  1801 
GTGGTTTTATTGCGTAAGGATTGTTGGA
 
2290 60 Taq112 81 
  1803 *
ATACATCCCTTCTTTTTACCCCRAAAC
 
     
 c 1815 
CAACRAAATTAACTTTAAATAAAACCCAC
 
     
  1816 
CAACRAAATTAACTTTAAATAAAACCCAT
 
3191 60 Taq165 130 
  1817 *
GTTACGTGCGATTTAGGTTTTAGAGTTG
 
     
 d 1822 
CTAAAAAAAAAAAAAAAAATTATACRAACC
 
     
  1823 
CTAAAAAAAAAAAAAAAAATTATACRAACR
 
5436 57 BstU I 131 100 
  1821 *
GGTTTATATTCGGGGTATTTAAATAGGA
 
     
 e 1825 
TAAAACRAAATTAACATTTAAATAAACC
 
     
  1824 
TAAAACRAAATTAACATTTAAATAAACT
 
5872 57 Taq128 92 
  1826 *
AAAGTTTTTGGAAGGTAGTTTAATTAG
 
     
 f 1827 
TAATATCACCTTATTAACTCAAATACTAC
 
     
  1828 
TAATATCACCTTATTAACTCAAATACCAA
 
6552 57 Rsa136 88 
  1829 *
ATTAGTGGTTAAATTTTATAATAGGATA
 
     
 g 1833 
GTTTAGAGTTTATAGGTTTTTTTTTTTYG
 
     
  1834 
GTTTAGAGTTTATAGGTTTTTTTTTTTTT
 
8993 60 Taq197 169 
  1879 *
TAAAAATTATAAACACCCAAAAACTTCGA
 
     
 h 1838 
TTCGTATTAGAAAGGATTGGTAAGGAGTG
 
     
  1839 
TTCGTATTAGAAAGGATTGGTAAGGAGTA
 
10 219 60 HpyCH4 IV 128 95 
  1840 *
TCAAAAAATCACCTAATTATTTCTAACTT
 
     
 i 1808 
CCCTACTAAAAATAAAATTTCTAATAATCC
 
     
  1789 
CCCTACTAAAAATAAAATTTCTAATAATCA
 
10 696 57 Taq170 98 
  1800 *
GATATTAGAATTAGTTTTAATAAGTTGT
 
     
 j 1841 
GATTTTTTAAGTTTTTTGGTTAGGTTATA
 
     
  1842 
GATTTTTTAAGTTTTTTGGTTAGGTTATG
 
11 096 57 Taq183 154 
  1843 *
ATAAATTCATACTAAAAAAAACAAAACTC
 
     
 k 1844 
AATTTGAAATTATTTTTTTTTTTTTTTGG
 
     
  1845 
AATTTGAAATTATTTTTTTTTTTTTTTGT
 
12 723 57 BstU I 114 83 
  1846 *
CTAAAATTAACGACCCAAAAAAACCRCCA
 
     
 l 1847G 
GTTTYGTTATTTTGAGTGTGTGTGTGTGG
 
     
  1847A 
GTTTYGTTATTTTGAGTGTGTGTGTGTGA
 
13 598 63 HpyCH4 IV 153 118 
  1848 *
AACCCCCAAAAAATACCTACRACCTACC
 
     
Nespas m 1849 
CAAAAAACTATAATATACCGAACCTAT
 
     
  1850 
CAAAAAACTATAATATACCGAACCTAC
 
13 343 57 BstU I 107 72 
  1851 *
AGATGGGTATATTGTAAGATGTATGTTG
 
     
Gnasxl n 1852 
AGTTTTTTTTGTAAGTTTTAGATTTTGYG
 
     
  1853 
AGTTTTTTTTGTAAGTTTTAGATTTTGTT
 
16 161 57 BstU I 137 69 
  1854 *
TTCTTCAAAAAAAAAACTATAATCTTCTC
 
     
Exon 1A o 1855 
CCCCATATAAAACATTACGATTAATTAAC
 
     
  1856 
CCCCATATAAAACATTACGATTAATTAAT
 
45 029 57 BstU I 128 57 
  1857 *
GYGTTTTTTTATTTTAGTTTTTTAGATAG
 
     
 p 1858 
ATTTATATTAGAGGTGTTYGYGTATTGGA
 
     
  1859 
ATTTATATTAGAGGTGTTYGYGTATTGGT
 
45 347 60 BstU I 134 91 
  1860 *
AAACCGACCCATAAACAATAACCCCTAT
 
     

*End-labeled common primers.

aAllele-specific primers: M, Maternal allele; P, Paternal allele; C, Common primer. SNP nucleotides are in bold Mixed base, R=A or G; Y=C or T.

bNucleotide location in the GenBank no. AL593857: y=67991−x.

cOptimal annealing temperature for PCR amplification.

dRestriction site if CpG is methylated: RsaI, GTACg; TaqI, TCGA; BstUI, CGCG; HpyCH4 IV, ACGT.

References

1
Liu, J., Yu, S., Litman, D., Chen, W. and Weinstein, L.S. (
2000
) Identification of a methylation imprint mark within the mouse Gnas locus.
Mol. Cell. Biol.
 ,
20
,
5808
–5817.
2
Wroe, S.F., Kelsey, G., Skinner, J.A., Bodle, D., Ball, S.T., Beechey, C.V., Peters, J. and Williamson, C.M. (
2000
) An imprinted transcript, antisense to Nesp, adds complexity to the cluster of imprinted genes at the mouse Gnas locus.
Proc. Natl Acad. Sci., USA
 ,
97
,
3342
–3346.
3
Li, T., Vu, T.H., Zeng, Z.L., Nguyen, B.T., Hayward, B.E., Bonthron, D.T., Hu, J.F. and Hoffman, A.R. (
2000
) Tissue-specific expression of antisense and sense transcripts at the imprinted Gnas locus.
Genomics
 ,
69
,
295
–304.
4
Hayward, B.E., Moran, V., Strain, L. and Bonthron, D.T. (
1998
) Bidirectional imprinting of a single gene: GNAS1 encodes maternally, paternally, and biallelically derived proteins.
Proc. Natl Acad. Sci. USA
 ,
95
,
15 475
–15 480.
5
Peters, J., Wroe, S.F., Wells, C.A., Miller, H.J., Bodle, D., Beechey, C.V., Williamson, C.M. and Kelsey, G. (
1999
) A cluster of oppositely imprinted transcripts at the Gnas locus in the distal imprinting region of mouse chromosome 2.
Proc. Natl Acad. Sci. USA
 ,
96
,
3830
–3835.
6
Belotserkovskaya, R., Oh, S., Bondarenko, V.A., Orphanides, G., Studitsky, V.M. and Reinberg, D. (
2003
) FACT facilitates transcription-dependent nucleosome alteration.
Science
 ,
301
,
1090
–1093.
7
Saunders, A., Werner, J., Andrulis, E.D., Nakayama, T., Hirose, S., Reinberg, D. and Lis, J.T. (
2003
) Tracking FACT and the RNA polymerase II elongation complex through chromatin in vivo.
Science
 ,
301
,
1094
–1096.
8
Kaplan, C.D., Laprade, L. and Winston, F. (
2003
) Transcription elongation factors repress transcription initiation from cryptic sites.
Science
 ,
301
,
1096
–1099.
9
Svejstrup, J.Q. (
2003
) Transcription. Histones face the FACT.
Science
 ,
301
,
1053
–1055.
10
Jenuwein, T. and Allis, C.D. (
2001
) Translating the histone code.
Science
 ,
293
,
1074
–1080.
11
Spotswood, H.T. and Turner, B.M. (
2002
) An increasingly complex code.
J. Clin. Invest.
 ,
110
,
577
–582.
12
Grewal, S.I. and Moazed, D. (
2003
) Heterochromatin and epigenetic control of gene expression.
Science
 ,
301
,
798
–802.
13
Litt, M.D., Simpson, M., Gaszner, M., Allis, C.D. and Felsenfeld, G. (
2001
) Correlation between histone lysine methylation and developmental changes at the chicken beta-globin locus.
Science
 ,
293
,
2453
–2455.
14
Hu, J.F., Pham, J., Dey, I., Li, T., Vu, T.H. and Hoffman, A.R. (
2000
) Allele-specific histone acetylation accompanies genomic imprinting of the insulin-like growth factor II receptor gene.
Endocrinology
 ,
141
,
4428
–4435.
15
Gregory, R.I., Randall, T.E., Johnson, C.A., Khosla, S., Hatada, I., O'Neill, L.P., Turner, B.M. and Feil, R. (
2001
) DNA methylation is linked to deacetylation of histone H3, but not H4, on the imprinted genes Snrpn and U2af1-rs1.
Mol. Cell. Biol.
 ,
21
,
5426
–5436.
16
Bernstein, B.E., Humphrey, E.L., Erlich, R.L., Schneider, R., Bouman, P., Liu, J.S., Kouzarides, T. and Schreiber, S.L. (
2002
) Methylation of histone H3 Lys 4 in coding regions of active genes.
Proc. Natl Acad. Sci. USA
 ,
99
,
8695
–8700.
17
Santos-Rosa, H., Schneider, R., Bannister, A.J., Sherriff, J., Bernstein, B.E., Emre, N.C., Schreiber, S.L., Mellor, J. and Kouzarides, T. (
2002
) Active genes are tri-methylated at K4 of histone H3.
Nature
 ,
419
,
407
–411.
18
Li, T., Vu, T.H., Lee, K.O., Yang, Y., Nguyen, C.V., Bui, H.Q., Zeng, Z.L., Nguyen, B.T., Hu, J.F., Murphy, S.K. et al. (
2002
) An imprinted PEG1/MEST antisense expressed predominantly in human testis and in mature spermatozoa.
J. Biol. Chem.
 ,
277
,
13 518
–13 527.
19
Coombes, C., Arnaud, P., Gordon, E., Dean, W., Coar, E.A., Williamson, C.M., Feil, R., Peters, J. and Kelsey, G. (
2003
) Epigenetic properties and identification of an imprint mark in the Nesp–Gnasxl domain of the mouse Gnas imprinted locus.
Mol. Cell. Biol.
 ,
23
,
5475
–5488.
20
Pedone, P.V., Pikaart, M.J., Cerrato, F., Vernucci, M., Ungaro, P., Bruni, C.B. and Riccio, A. (
1999
) Role of histone acetylation and DNA methylation in the maintenance of the imprinted expression of the H19 and Igf2 genes.
FEBS Lett.
 ,
458
,
45
–50.
21
Grandjean, V., O'Neill, L., Sado, T., Turner, B. and Ferguson-Smith, A. (
2001
) Relationship between DNA methylation, histone H4 acetylation and gene expression in the mouse imprinted Igf2-H19 domain.
FEBS Lett.
 ,
488
,
165
–169.
22
Perk, J., Makedonski, K., Lande, L., Cedar, H., Razin, A. and Shemer, R. (
2002
) The imprinting mechanism of the Prader-Willi/Angelman regional control center.
EMBO J.
 ,
21
,
5807
–5814.
23
Fournier, C., Goto, Y., Ballestar, E., Delaval, K., Hever, A.M., Esteller, M. and Feil, R. (
2002
) Allele-specific histone lysine methylation marks regulatory regions at imprinted mouse genes.
EMBO J.
 ,
21
,
6560
–6570.
24
Xin, Z., Allis, C.D. and Wagstaff, J. (
2001
) Parent-specific complementary patterns of histone H3 lysine 9 and H3 lysine 4 methylation at the Prader–Willi syndrome imprinting center.
Am. J. Hum. Genet.
 ,
69
,
1389
–1394.
25
Yang, Y., Li, T., Vu, T.H., Ulaner, G.A., Hu, J.F. and Hoffman, A.R. (
2003
) The histone code regulating expression of the imprinted mouse Igf2r gene.
Endocrinology
 ,
144
,
5658
–5670.
26
Maison, C., Bailly, D., Peters, A.H., Quivy, J.P., Roche, D., Taddei, A., Lachner, M., Jenuwein, T. and Almouzni, G. (
2002
) Higher-order structure in pericentric heterochromatin involves a distinct pattern of histone modification and an RNA component.
Nat. Genet.
 ,
30
,
329
–334.
27
West, A.G., Gaszner, M. and Felsenfeld, G. (
2002
) Insulators: many functions, many mechanisms.
Genes Dev.
 ,
16
,
271
–288.
28
Kimura, A., Umehara, T. and Horikoshi, M. (
2002
) Chromosomal gradient of histone acetylation established by Sas2p and Sir2p functions as a shield against gene silencing.
Nat. Genet.
 ,
32
,
370
–377.
29
Suka, N., Luo, K. and Grunstein, M. (
2002
) Sir2p and Sas2p opposingly regulate acetylation of yeast histone H4 lysine16 and spreading of heterochromatin.
Nat. Genet.
 ,
32
,
378
–383.
30
Wang, A., Kurdistani, S.K. and Grunstein, M. (
2002
) Requirement of Hos2 histone deacetylase for gene activity in yeast.
Science
 ,
298
,
1412
–1414.
31
Wutz, A., Smrzka, O.W., Schweifer, N., Schellander, K., Wagner, E.F. and Barlow, D.P. (
1997
) Imprinted expression of the Igf2r gene depends on an intronic CpG island.
Nature
 ,
389
,
745
–749.
32
Nakabayashi, K., Bentley, L., Hitchins, M.P., Mitsuya, K., Meguro, M., Minagawa, S., Bamforth, J.S., Stanier, P., Preece, M., Weksberg, R. et al. (
2002
) Identification and characterization of an imprinted antisense RNA (MESTIT1) in the human MEST locus on chromosome 7q32.
Hum. Mol. Genet.
 ,
11
,
1743
–1756.
33
Hu, J.F., Vu, T.H. and Hoffman, A.R. (
1996
) Promoter-specific modulation of insulin-like growth factor II genomic imprinting by inhibitors of DNA methylation.
J. Biol. Chem.
 ,
271
,
18 253
–18 262.
34
Hall, I.M., Shankaranarayana, G.D., Noma, K., Ayoub, N., Cohen, A. and Grewal, S.I. (
2002
) Establishment and maintenance of a heterochromatin domain.
Science
 ,
297
,
2232
–2237.
35
Xiong, Z. and Laird, P.W. (
1997
) COBRA: a sensitive and quantitative DNA methylation assay.
Nucl. Acids Res.
 ,
25
,
2532
–2534.