Abstract

Osteoporosis is one of the most common degenerative diseases. It is characterized by reduced bone mineral density (BMD) with an increased risk for bone fractures. There is a substantial genetic contribution to BMD, although the genetic factors involved in the pathogenesis of human osteoporosis are largely unknown. Mice with a targeted deletion of either the cannabinoid receptor type 1 (Cnr1) or type 2 (Cnr2) gene show an alteration of bone mass, and pharmacological modification of both receptors can regulate osteoclast activity and BMD. We therefore analyzed both genes in a systematic genetic association study in a human sample of postmenopausal osteoporosis patients and matched female controls. We found a significant association of single polymorphisms (P=0.0014) and haplotypes (P=0.0001) encompassing the CNR2 gene on human chromosome 1p36, whereas we found no convincing association for CNR1. These results demonstrate a role for the peripherally expressed CB2 receptor in the etiology of osteoporosis and provide an interesting novel therapeutical target for this severe and common disease.

INTRODUCTION

A significant decrease in bone mineral density (BMD) leads to an enhanced liability to bone fractures and is a major denominator of human osteoporosis. Osteoporosis is one of the most common degenerative disorders in developed countries. Although it affects both sexes and all racial groups, postmenopausal women are at the highest risk. The etiology of osteoporosis is heterogeneous; the main predictors are age, gender and a positive family history. The inheritance pattern is complex, and numerous families and twin studies have demonstrated a pronounced genetic contribution to osteoporosis and BMD with average heritability estimates in the range of 60–80% (1). Although the molecular regulation of BMD is largely unknown, variants in a few genes, including the collagen 1A1-gene (2), the vitamin D receptor gene (3) and the low density lipoprotein receptor-related protein 5 gene (4), have repeatedly been shown to be associated with bone mass. Moreover, the bone morphogenetic protein 2 gene (5) has been identified as a human osteoporosis susceptibility gene by a positional cloning approach. In addition, a few chromosomal loci including human chromosome 1p36 have been replicated in independent genome-wide linkage studies; however, the underlying susceptibility genes are unknown (68).

Very recently, an unexpected role of the endocannabinoid system in the regulation of bone mass has been demonstrated in mice (9,10). To date, two cannabinoid receptors, CB1 and CB2, have been identified. Both proteins are highly homologous and belong to the family of G-protein coupled seven-transmembrane domain receptors, which bind and are activated by endocannabinoids. CNR1 is predominantly expressed in the brain and peripheral neurons and is responsible for the psychotropic action of cannabinoids (11,12), whereas CNR2 is absent in the brain but is mainly expressed in immune cells (13). The neuronal CB1 receptor is encoded by the CNR1 gene on human chromosome 6q15, whereas the non-neuronal CB2 receptor is encoded by the CNR2 gene on 1p36. Mice with a targeted deletion of Cnr1 have an increased bone mass (10), whereas we could recently show that Cnr2 knockout mice have a decreased bone mass reminiscent of human osteoporosis (9). Both studies demonstrated that the pharmacological modulation of CB receptors affects bone mass in vivo, although the pharmacological results were contradictory.

Because these mouse genetic data suggest a role for the endocannabinoid system in the regulation of bone mass and because the chromosomal region 1p36, which contains the CNR2 gene, has been implicated in osteoporosis (68), we have therefore studied the involvement of CNR1 and/or CNR2 in the pathogenesis of complex inherited human osteoporosis by pursuing a systematic genetic case–control association study.

RESULTS

Around the human CNR1 gene, we genotyped four single nucleotide polymorphisms (SNPs) (rs806365, rs1049353, rs806377 and rs806380), for which genotyping assays were available (Table 1), covering a region of nearly 20 kb and encompassing the single coding exon of CNR1. The genotype distributions of the two samples did not deviate significantly (P≥0.05) from those expected from the Hardy–Weinberg equilibrium (HWE), as tested by the exact test. The distribution of genotypes of the four CNR1 polymorphisms is shown in Table 1. To compare the frequencies of individual SNPs between cases and controls, we applied a standard χ2 test (df=1) for allelic association with the disease phenotype. No statistically significant differences of allele or genotype distributions were found between patients and controls, but SNP rs806380 showed a borderline significant P-value of 0.057. In conclusion, our data do not support a major role of CNR1 in our sample.

The human CNR2 gene and its mouse ortholog are located on chromosomes 1p36 and 4QD3, respectively. These two genomic regions have been linked to osteoporosis and BMD by several independent genome-wide linkage analyses (68,14,15); however, the CNR2 gene has not been investigated as a positional candidate gene up to now. CB2 is encoded by a single exon (exon 2) with a non-coding exon 1 ∼37 kb upstream. We initially tested six SNPs (Table 2) for which genotyping assays were available in a region spanning ∼120 kb (Fig. 1A) and harboring both CNR2 exons. Again, there was no deviation of genotype distributions from the HWE, but we found a significant difference of allele frequencies between cases and controls for several SNPs (Table 3 and Fig. 1B). In contrast, seven unrelated control SNPs (intergenic and not in the vicinity of the CNR genes) from different chromosomes did not show an association with the phenotype (Table 4). Therefore, these results suggest an involvement of the CNR2 locus in human osteoporosis.

Both SNPs located within exon 2 of CNR2, i.e. rs4649124 and rs2501431, showed most significant P-values for allele (0.0026 and 0.0014, respectively) and genotype (0.0023 and 0.00073, respectively) distributions (Table 3 and Fig. 1B). These two SNPs are in tight linkage disequilibrium (LD) (D′=0.99 and r2=0.96), which is also true for most of the other SNPs within exon 2 (Fig. 1C). For rs4649124, the allele frequencies differed by 11% (allele 1: controls 52% and patients 63%). The other four SNPs, located 10 kb/30 kb 3′ and 80 kb/93 kb 5′ of CNR2, showed P-values for allelic association between 0.0042 (rs4649119, which is in strong LD to SNPs in exon 2; D′=0.98) and 0.2275 (hCV395615, which just shows a weak LD to SNPs in exon 2; D′=0.55) (Table 3 and Fig. 1B). In order to correct for multiple testing, we repeated the analysis 100 000 times with a randomly permuted assignment of the affection status. The obtained P-value (P=0.0056) of the most strongly associated SNP (rs2501431) remains significant, if we further perform a Bonferroni correction for the two investigated gene loci.

As there may be a skeletal site-specific genetic predisposition to osteoporosis [e.g. at the lumbar spine or femoral neck (FN)], we also used subsamples of our patients for further analysis. When restricting the patient sample to those with a T-score less than −2.5 at the lumbar spine (86% of the full patient sample), we still observe highly significant associations for both SNPs within the coding exon (e.g. for SNP rs4649124, P=0.005). The small size of a patient sample defined by a T-score less than −2.5 only at the FN does not allow for a valid statistical analysis. We next analyzed BMD at the lumbar spine as a quantitative trait. To this end, we tested the normal distribution of the quantitative data using the Kolmogorov–Smirnov test and the homogeneity variances with Levene's test. Congruent with the association results in the dichotomized sample, we found a highly significant difference in bone density between individuals displaying different genotypes (e.g. for SNP rs4649124, P=0.004, one-way analysis of variance) (data not shown).

To investigate the extended locus and its genetic variability more systematically, we sequenced the coding region of CNR2 in all individuals (n=388) to obtain complete information about all sequence variants. As the CNR2 coding sequence includes only a small fraction of the genomic region where significantly associated SNPs were located, we further determined the LD structure using genotypes from the Perlegen data set (16) (because of a gap in the NCBI 34 genome assembly, the current phase 1 public HapMap does not contain the CNR2 locus) (Fig. 1C). We partitioned the locus into haplotype blocks using the program hapblock (17) (http://www.cmb.usc.edu/msms/hapblock/). Block partitioning required that at least 90% of the total haplotype diversity within each block was covered by common haplotypes (>5% population frequency). We selected SNPs necessary for common haplotype discrimination as tagging SNPs, altogether we genotyped additional 20 SNPs in the 300 kb extended region (Fig. 1A and B and Tables 2 and 3). The genotype data of this comprehensive set of SNPs confirmed the positive association with most significant values within a LD block including exon 2 and the 3′-untranslated region (UTR) of CNR2. The most significant association remained to be found for rs2501431 in exon 2 (Fig. 1B and Table 3). SNPs telomeric and centromeric were less or not significant.

In order to devise the genomic region containing putative disease mutations, we tested the global haplotype frequency distribution for all possible three-marker haplotypes. The smallest P-value (P=0.0001) was found for the SNP combination rs2229583–rs2501431–rs16828926 (Fig. 1B). This haplotype spans exon 2 and a small part of intron 1 of CNR2. Its P-value is an order of magnitude less than the global P-value (P=0.005) for the SNP combination rs4649124–rs3003336–rs2501431, which is located directly under the SNP association peak within the CNR2 locus. The reason for this decreased P-value became clearer when we looked at the frequency of the major haplotype in the case and the control samples (Supplementary Material, Table S1). As indicated by the strong LD between the associated SNPs, a major risk haplotype is enriched among patients. Under the SNP association peak, the major haplotype G-T-A comprising the three SNPs rs4649124–rs3003336–rs2501431 displayed an enrichment among cases comparable with the associated individual SNPs (62.1 versus 51.1%, χ2=9.63, P=0.002). When increasing the size of the genomic window towards both sides, a stronger fragmentation of the risk haplotype was observed among the controls than among cases. This fragmentation comes in parallel with the decreased P-value and makes the respective genomic region most likely to harbor the unknown disease causing mutations. The major haplotype comprising the alleles T-A-G of the SNPs rs2229583–rs2501431–rs16828926 displays a frequency of 59.3% among patients and 46.0% among controls (χ2=13.12, P=0.0003) (Supplementary Material, Table S1). This gives an odds ratio (OR) of 1.716 and an estimated etiological fraction of 24.7% for this haplotype. Further increase in the size of the genomic region led to the fragmentation of the major haplotype also in the case sample, resulting in less significant frequency differences between the two samples. Thus, the haplotype analysis confirmed and even strengthened our positive association results with the single markers and provides further evidence for a causative role of the CNR2 gene in human postmenopausal osteoporosis.

DISCUSSION

Chromosome 1p36 first emerged as susceptibility locus for low hip BMD in a genome-wide linkage study in seven extended pedigrees (6). In non-parametric analyses, the maximum Z-score for this locus was 3.51 at marker D1S450. This marker is ∼14 Mb telomeric from CNR2 (UCSC-Genome Browser), but as loci in complex genetics are in general rather broad and the borders are not exactly defined, CNR2 has to be regarded as a good candidate gene for this locus. The same locus has been confirmed in an extended study with 42 families, with a maximum multipoint LOD score of 3.53 for FN BMD (7). Also in mice, there is very good evidence from several genome-wide linkage studies that the chromosomal region around Cnr2 is implicated in the regulation of BMD. The Cnr2 gene is located on mouse chromosome 4 at 134.3 Mb very close to the marker D4Mit134 at 134.1 Mb, for which genetic localization is at 62 cM. A major quantitative trait locus (QTL, named Bmd7) for both femoral and lumbar vertebral BMD in C57BL/6 and C3H/HeJ mice strains has been mapped close to this locus. The maximum LOD score was 16.3 for femoral and 14.8 for vertebral BMD at D4Mit124 (57.4 cM), which accounts for 6.7 and 6.5% of F2 variance in femoral and vertebral BMD, respectively (14). A similar highly significant finding has been obtained in a screen for loci affecting peak bone mass in 24 recombinant inbred mouse strains with a maximum LOD score of 12.3 for D4Mit312 at 69.8 cM (15).

In contrast, the CNR1 locus on chromosome 6q14 does not seem to be a major QTL for BMD, which is in accordance with our association results. As the genomic region covering CNR1 is small (∼5.5 kb) and shows a rather high LD, the testing of four SNPs covering most of the genetic variance is probably sufficient to exclude a major role of CNR1 in our sample.

Although the physiological role of endocannabinoids and CB1 receptors in the regulation of neuronal signaling has been well studied, relatively little is known about the functions of CB2 receptors or the involvement of cannabinoid receptors in human disease processes. Indeed, our results provide the first evidence for an involvement of CB2 receptors in a human disorder. In a recent study, we have demonstrated that CB2 activation can ameliorate the development of atherosclerotic plaques in mice (18). Very interestingly, atherosclerosis, also a common and late-onset disorder, is inversely and independently correlated with BMD as shown, e.g. by a systematic population-based study in over 5200 Norwegian individuals (19). Thus, it is tempting to speculate that CNR2 polymorphisms contribute to the etiology of both disorders, thus providing one explanation for the association of atherosclerosis with osteoporosis.

Among the large number of associated polymorphisms in CNR2 are two missense variants (the double SNP rs2502992–rs2501432 and Gln63Arg; rs2229579 and His316Tyr; both amino acid exchanges are in non-conserved regions) and several SNPs within conserved regions in the 3′-UTR. These alone or in combination with other linked polymorphisms, still to be identified, may be responsible for the observed association by altering protein function and/or gene expression. On the basis of the Cnr2 knockout phenotype, and our pharmacological results (9), we would expect a decreased CB2 function in the disease-associated allele, which would also be expected to provide a protective function in atherosclerosis. Obviously, further studies will be necessary to address the functional role of CB2 receptors in these common disorders. Eventually, these studies may open novel therapeutic strategies.

MATERIALS AND METHODS

Clinical data

All 388 women were recruited and investigated at a single clinical center (Hôpital Lariboisière, Paris, France). The patients were referred for suspicion of osteoporosis. The controls were women addressed to have a BMD measurement (Viggos cohort) to evaluate their bone status. They were not referred for suspicion of osteoporosis. They were all postmenopausal Caucasian of French origin and >50 years old. All participants signed an informed consent, and the study was approved by the hospital Internal Ethical Review Board. All women underwent a routine clinical and biochemical assessment to exclude secondary causes of osteoporosis. Subjects who had plasma hormone abnormalities [thyroid stimulating hormone and parathyroid hormone (PTH)] or had received treatment known to affect BMD for more than a month were also excluded. The patients and controls underwent BMD measurements of the lumbar spine (L2–L4) or FN, determined by dual energy X-ray absorptiometry (DEXA) (LUNAR DPX-L, Madison, WI, USA). T-scores were based on a French population reference provided by the manufacturer. X-ray of the spine was performed in all women to evaluate semi-quantitatively the prevalence of vertebral osteoporotic fractures. Women were defined as having osteoporosis on the basis of a BMD T-score less than −2.5 at lumbar spine (L2–L4) or FN. Some women of the Viggos study (∼10%) had a T-score less than −2.5 and were thus classified as having osteoporosis. Therefore, our sample consisted of 168 postmenopausal osteoporotic women and 220 ethnically, age- and sex-matched controls. In the osteoporotic women, the prevalence of vertebral fractures was 46%. The control women had BMD T-score of ≥−2.5 and had no previous FN or vertebral lumbar fractures. Further details of the patient and control clinical data are given in Table 5.

Molecular genetic studies and statistical analyses

Genomic DNA was extracted by standard procedures from EDTA-blood samples, and SNPs were genotyped by polymerase chain reaction (PCR) amplification using the ABI Assays-On-Demand/Design™ SNP Genotyping Products or assessed by direct sequencing (Table 2). As means of quality control, we (i) always included negative controls as well as individuals who are known to have the three different genotypes in the ABI assays, (ii) typed SNP rs4649119 in duplicate and (iii) typed SNPs rs2229586, rs4649124 and rs2501431 by two independent methods (ABI assays and direct sequencing). The discrepancies between both methods were <0.4% of tested chromosomes.

Global haplotype comparison was performed using the package cocaphase (http://www.mrc-bsu.cam.ac.uk/personal/frank/software/unphased/). This software performs likelihood ratio tests under a log-linear model of the probability that a haplotype belongs to the case or the control group, using a standard unconditional logistic regression. The expectation-maximization (EM) algorithm was used to estimate haplotype frequencies and resolve missing genotypes. Maximum-likelihood haplotype frequencies were further estimated from individual genotypes using the program snphap (http://archimedes.well.ox.ac.uk/pise/snphap.html), which implements an EM algorithm. Haplotypes were then tested against all other haplotypes for disease association by a χ2 test (df=1). Frequency estimates of the two programs were in good agreement both for common and for rare haplotypes.

ELECTRONIC DATABASE INFORMATION

HapMap, http://www.hapmap.org/

Perlegen homepage, http://www.perlegen.com/

SUPPLEMENTARY MATERIAL

Supplementary Material is available at HMG Online.

ACKNOWLEDGEMENTS

We thank the patients for thier cooperation. This work was supported by an ISF grant to IB (4007/02-Bikura), NGFN and DFG grants to A.Z., SFB 645 to M.K. and A.Z., and a PHRC grant (AOR01049) to M.-C.V.

Conflict of Interest statement. All authors have no conflict of interest.

Figure 1. Schematic representation of the extended CNR2 locus. (A) Location of known genes in a region of ∼300 kb on human chromosome 1p36.11 including the position of 26 typed SNPs. FUCA1, alpha-l fucosidase; CNR2, cannabinoid receptor type 2; PNRC2, proline-rich nuclear receptor co-activator 2; FUSIP1, FUS interacting protein (serine–arginine rich) 1. (B) Results of the association analyses of SNPs in the CNR2 region. The −log 10 P-values (y-axis) of the genotypic association are plotted against the typed SNPs (x-axis). The red lines indicate the global P-values of three-marker haplotypes rs4649124–rs3003336–rs2501431, rs2229583–rs2501431–rs16828926 and rs4649119–rs2501431–rs7530595. The dotted black line shows the significance level of P=0.05. A shaded box delineates the region harboring the CNR2 gene with two arrows showing the size of the CNR2 gene. (C) Representation of LD structure in the CNR2 region. Pairwise r2-values between markers are shown as calculated by the program haploview (20) (http://www.broad.mit.edu/mpg/haploview/) (black denotes complete LD with r2=1; white denotes no LD with r2=0; gray denotes r2 between 0 and 1 with intermediate LD). Note the presence of a region of strong LD between SNPs rs4237 and rs2501432 including the CNR2 coding region.

Figure 1. Schematic representation of the extended CNR2 locus. (A) Location of known genes in a region of ∼300 kb on human chromosome 1p36.11 including the position of 26 typed SNPs. FUCA1, alpha-l fucosidase; CNR2, cannabinoid receptor type 2; PNRC2, proline-rich nuclear receptor co-activator 2; FUSIP1, FUS interacting protein (serine–arginine rich) 1. (B) Results of the association analyses of SNPs in the CNR2 region. The −log 10 P-values (y-axis) of the genotypic association are plotted against the typed SNPs (x-axis). The red lines indicate the global P-values of three-marker haplotypes rs4649124–rs3003336–rs2501431, rs2229583–rs2501431–rs16828926 and rs4649119–rs2501431–rs7530595. The dotted black line shows the significance level of P=0.05. A shaded box delineates the region harboring the CNR2 gene with two arrows showing the size of the CNR2 gene. (C) Representation of LD structure in the CNR2 region. Pairwise r2-values between markers are shown as calculated by the program haploview (20) (http://www.broad.mit.edu/mpg/haploview/) (black denotes complete LD with r2=1; white denotes no LD with r2=0; gray denotes r2 between 0 and 1 with intermediate LD). Note the presence of a region of strong LD between SNPs rs4237 and rs2501432 including the CNR2 coding region.

Table 1.

Summary of association analyses in an osteoporosis case–control sample at the CNR1 locus in humans

SNP ID Genotypes controls (nGenotypes cases (nAllele 1 versus 2 Genotype 11 versus 22 
 11 12 22 Sum 11 12 22 Sum P-value OR (95% CI) P-value OR (95% CI) 
rs806365 65 105 33 203 38 92 29 159 0.175 1.23 (0.91–1.65) 0.211 1.50 (0.79–2.85) 
rs1049353 108 80 13 201 94 62 7 163 0.344 1.18 (0.84–1.65) 0.323 1.62 (0.62–4.22) 
rs806377 68 89 46 203 38 76 41 155 0.090 1.29 (0.96–1.74) 0.113 1.60 (0.89–2.85) 
rs806380 83 93 30 206 78 64 16 158 0.057 1.35 (0.99–1.85) 0.101 1.76 (0.89–3.48) 
SNP ID Genotypes controls (nGenotypes cases (nAllele 1 versus 2 Genotype 11 versus 22 
 11 12 22 Sum 11 12 22 Sum P-value OR (95% CI) P-value OR (95% CI) 
rs806365 65 105 33 203 38 92 29 159 0.175 1.23 (0.91–1.65) 0.211 1.50 (0.79–2.85) 
rs1049353 108 80 13 201 94 62 7 163 0.344 1.18 (0.84–1.65) 0.323 1.62 (0.62–4.22) 
rs806377 68 89 46 203 38 76 41 155 0.090 1.29 (0.96–1.74) 0.113 1.60 (0.89–2.85) 
rs806380 83 93 30 206 78 64 16 158 0.057 1.35 (0.99–1.85) 0.101 1.76 (0.89–3.48) 

For the cannabinoid receptor type 1 (CNR1) locus, four-typed single SNPs are shown. Reference numbers (rs-numbers) from dbSNP are provided. Individual counts (n) for each genotype (11/12/22) are separately listed in controls and cases. The polymorphism located in the CNR1 coding exon is highlighted in bold type. P-value, OR and 95% confidence interval (CI) of OR are given for allelic and genotypic association.

Table 2.

Context sequences of typed SNPs

rs Number / Celera ID ABI Assay ID Chromosome Genomic position (NCBI Build 35.1) Chromosomal strand Context sequence Allele 1 (on plus strand) 
rs806365 hCV1652594 88902668 TCATAGCTAGCTCTTACTTTGTCTT[C/T]AGTGCTCTATTCAAGCATCACCTCT 
rs1049353 hCV1652590 88910354 CCGCAGAAAGCTGCATCAAGAGCAC[A/G]GTCAAGATTGCCAAGGTAACCATGT 
rs806377 hCV1652585 88915442 GCTTCTGAACCAGTTCTGCACACCT[C/T]TCCTGCAACTGTCATAGAATAAAGC 
rs806380 hCV1652583 88921372 TAACAGAGAACATACAAAGTTTTCA[A/G]TTAAGTAAAAGCCATGGCCATATTC 
rs10917411 Assay-On-Design 23750771 GCTAATTTTAGAGCTGGGCTAAAGA[G/T]GCTGCCAACATAAATCTTGCAATGT 
rs3753270 Assay-On-Design 23763530 −1 CTTTTCCCAGGCTAACCACAGAGAT[A/G]AAGACGAGGAAGAGAGGCGCATTTG 
rs10917414 Assay-On-Design 23772524 TGCTTTATTTTTTGCTTTAAAGATC[A/G]GTTCTGTTCAAACATGACATGGCGT 
rs622770 Assay-On-Design 23785572 −1 CAGTGGCAGGTACTTTGAAAGACTG[A/G]ACCAGGATACTAGATTAACTATCTC 
rs4237 Assay-On-Design 23859435 −1 ACATTAACTGGAAAAGCAAGTGTTA[C/T]CCATGACTGCCAGATGCCACCCAGC 
rs4649119 hCV79667 23916849 AAGCTATAAGCAGTATAAGTTGAAA[C/G]TAGGAAAAGAAAGCTATACCATGTT 
hCV11546265 hCV11546265 23937026 TTGGGTATCCTTCATCTAACCAGAC[A/G]TGGCCATGAACTTCTGTAACGGTGT 
rs3003328 Assay-On-Design 23939132 GTTCTCAGAGAGAGTCAGACCCTTC[C/T]TGGACACTTCCTACGTAAAAGGGAT 
rs2229586 Assay-On-Design 23946209 −1 GTCCCAGRCACCTAGACACGGACCC[G/C]TTTTTGCTGATGAGTGTTGGGACTG 
rs2229585  23946227 −1 CTCTTCTTACTTAAACCAGTCCCAG[A/G]CACCTAGACACGGACCCSTTTTTGC 
rs2229584  23946275 −1 GTCAGAAATCARTTCACTCCCTGGA[A/G]GAGAGAGAGGGGTCTTGGCACTCTC 
rs2229583  23946289 −1 TTTAAASAACTCAAGTCAGAAATCA[A/G]TTCACTCCCTGGARGAGAGAGAGGG 
rs2229581  23946400 −1 AAGAAGCCCCRAGATCCTCAGTCAC[G/C]GAGACAGAGGCTGATGGGAAAATCA 
rs2229580  23946415 −1 GGTCAGAGGCAAAAGAAGAAGCCCC[A/G]AGATCCTCAGTCACSGAGACAGAGG 
rs2229579  23946468 −1 CTCCTCTGCCCATCACTGCCTGGCT[C/T]ACTGGAAGAAGTGTGTGAGGGGCCT 
rs2502993  23946568 −1 GTGACCAGGTCAAGAAGGCCTTTGC[C/T]TTCTGCTCCATGCTGTGCCTCATCA 
rs4649124 hCV515481 23946663 AACCAACAGATGAGGAGCACAGCCA[A/G]CACTAGCCCTAGGGTCTTGGCCAAC 
rs3003336  23946754 TGTCCTGGTGGCCAGACAAGCTGGC[C/T]ACATGCTGATGGGCCTTCCAGAGAA 
rs2501431 hCV515482 23946949 CTAGTGCTGAGAGGACCCACATGAT[A/G]CCCAGGGTCACCAGTGCCCTTCCAC 
rs2502992  23947225 −1 TCTATCTGATCCTGTCCTCCCACCR[A/G]CTCCGCCGGAAGCCCTCATACCTGT 
rs2501432  23947226 CAGGTATGAGGGCTTCCGGCGGAGY[T/C]GGTGGGAGGACAGGATCAGATAGAG 
rs16828926 Assay-On-Design 23960436 ACAGATGTAAGAGTAAAAGAGAAGC[A/G]GGAGTCTTTCTGAACCTATTCTGGG 
rs9424339 Assay-On-Design 23983268 GGACCCAGGAGCCTCCCTCACGCTT[A/T]TGTTCTGTGTGTCCTCTGGGTCAAT 
rs7530595 hCV310335 24026412 GGTCTTACATGTAAATAGATGGCTC[C/T]GATATACCATTATTTTGGGGGGAGT 
rs17338135 Assay-On-Design 24032203 GACATTTTTATATATTTAAGATGGG[C/T]TTAGACTGTTAGGGCTTGTGAGAAC 
hCV395615 hCV395615 24039933 CACCCAAAACTAACATAAAACACTA[C/T]GTAAAGATCCTCATCAAGTATCAGT 
rs Number / Celera ID ABI Assay ID Chromosome Genomic position (NCBI Build 35.1) Chromosomal strand Context sequence Allele 1 (on plus strand) 
rs806365 hCV1652594 88902668 TCATAGCTAGCTCTTACTTTGTCTT[C/T]AGTGCTCTATTCAAGCATCACCTCT 
rs1049353 hCV1652590 88910354 CCGCAGAAAGCTGCATCAAGAGCAC[A/G]GTCAAGATTGCCAAGGTAACCATGT 
rs806377 hCV1652585 88915442 GCTTCTGAACCAGTTCTGCACACCT[C/T]TCCTGCAACTGTCATAGAATAAAGC 
rs806380 hCV1652583 88921372 TAACAGAGAACATACAAAGTTTTCA[A/G]TTAAGTAAAAGCCATGGCCATATTC 
rs10917411 Assay-On-Design 23750771 GCTAATTTTAGAGCTGGGCTAAAGA[G/T]GCTGCCAACATAAATCTTGCAATGT 
rs3753270 Assay-On-Design 23763530 −1 CTTTTCCCAGGCTAACCACAGAGAT[A/G]AAGACGAGGAAGAGAGGCGCATTTG 
rs10917414 Assay-On-Design 23772524 TGCTTTATTTTTTGCTTTAAAGATC[A/G]GTTCTGTTCAAACATGACATGGCGT 
rs622770 Assay-On-Design 23785572 −1 CAGTGGCAGGTACTTTGAAAGACTG[A/G]ACCAGGATACTAGATTAACTATCTC 
rs4237 Assay-On-Design 23859435 −1 ACATTAACTGGAAAAGCAAGTGTTA[C/T]CCATGACTGCCAGATGCCACCCAGC 
rs4649119 hCV79667 23916849 AAGCTATAAGCAGTATAAGTTGAAA[C/G]TAGGAAAAGAAAGCTATACCATGTT 
hCV11546265 hCV11546265 23937026 TTGGGTATCCTTCATCTAACCAGAC[A/G]TGGCCATGAACTTCTGTAACGGTGT 
rs3003328 Assay-On-Design 23939132 GTTCTCAGAGAGAGTCAGACCCTTC[C/T]TGGACACTTCCTACGTAAAAGGGAT 
rs2229586 Assay-On-Design 23946209 −1 GTCCCAGRCACCTAGACACGGACCC[G/C]TTTTTGCTGATGAGTGTTGGGACTG 
rs2229585  23946227 −1 CTCTTCTTACTTAAACCAGTCCCAG[A/G]CACCTAGACACGGACCCSTTTTTGC 
rs2229584  23946275 −1 GTCAGAAATCARTTCACTCCCTGGA[A/G]GAGAGAGAGGGGTCTTGGCACTCTC 
rs2229583  23946289 −1 TTTAAASAACTCAAGTCAGAAATCA[A/G]TTCACTCCCTGGARGAGAGAGAGGG 
rs2229581  23946400 −1 AAGAAGCCCCRAGATCCTCAGTCAC[G/C]GAGACAGAGGCTGATGGGAAAATCA 
rs2229580  23946415 −1 GGTCAGAGGCAAAAGAAGAAGCCCC[A/G]AGATCCTCAGTCACSGAGACAGAGG 
rs2229579  23946468 −1 CTCCTCTGCCCATCACTGCCTGGCT[C/T]ACTGGAAGAAGTGTGTGAGGGGCCT 
rs2502993  23946568 −1 GTGACCAGGTCAAGAAGGCCTTTGC[C/T]TTCTGCTCCATGCTGTGCCTCATCA 
rs4649124 hCV515481 23946663 AACCAACAGATGAGGAGCACAGCCA[A/G]CACTAGCCCTAGGGTCTTGGCCAAC 
rs3003336  23946754 TGTCCTGGTGGCCAGACAAGCTGGC[C/T]ACATGCTGATGGGCCTTCCAGAGAA 
rs2501431 hCV515482 23946949 CTAGTGCTGAGAGGACCCACATGAT[A/G]CCCAGGGTCACCAGTGCCCTTCCAC 
rs2502992  23947225 −1 TCTATCTGATCCTGTCCTCCCACCR[A/G]CTCCGCCGGAAGCCCTCATACCTGT 
rs2501432  23947226 CAGGTATGAGGGCTTCCGGCGGAGY[T/C]GGTGGGAGGACAGGATCAGATAGAG 
rs16828926 Assay-On-Design 23960436 ACAGATGTAAGAGTAAAAGAGAAGC[A/G]GGAGTCTTTCTGAACCTATTCTGGG 
rs9424339 Assay-On-Design 23983268 GGACCCAGGAGCCTCCCTCACGCTT[A/T]TGTTCTGTGTGTCCTCTGGGTCAAT 
rs7530595 hCV310335 24026412 GGTCTTACATGTAAATAGATGGCTC[C/T]GATATACCATTATTTTGGGGGGAGT 
rs17338135 Assay-On-Design 24032203 GACATTTTTATATATTTAAGATGGG[C/T]TTAGACTGTTAGGGCTTGTGAGAAC 
hCV395615 hCV395615 24039933 CACCCAAAACTAACATAAAACACTA[C/T]GTAAAGATCCTCATCAAGTATCAGT 

SNPs and their context sequences are presented along with the NCBI reference number or Celera ID and the position of the polymorphic nucleotide on the genomic sequence of chromosome 1 (cannabinoid receptor type 2 locus) and chromosome 6 (cannabinoid receptor type 1 locus) [NCBI Build 35.1 (http://ncbi.nih.gov/)]. The polymorphic nucleotide of each SNP is presented in square brackets. The allele 1 is defined as displayed by the NCBI35 assembly plus strand. SNPs typed in the first round are given in bold letters. If not indicated, genotyping was performed by direct sequencing, otherwise ABI Assays-On-Demand number is given. Ten SNPs were typed by ABI Assays-On-Design.

Table 3.

Summary of association analyses in an osteoporosis case–control sample at the CNR2 locus in humans

SNP ID Genotypes controls (nGenotypes cases (nAllele 1 versus 2 Genotype 11 versus 22 
 11 12 22 Sum 11 12 22 Sum P-value OR (95% CI) P-value OR (95% CI) 
rs10917411 76 116 28 220 80 63 21 164 0.043 1.36 (1.05-1.84)a 0.303 1.40 (0.74–2.68)a 
rs3753270 161 53 218 117 42 164 0.473 1.16 (0.76–1.73) 0.421 1.72 (0.45–6.54) 
rs10917414 75 121 23 219 76 68 20 164 0.138 1.26 (0.93–1.70)a 0.659 1.17 (0.59–2.30)a 
rs622770 48 115 56 219 34 79 52 165 0.319 1.16 (0.87–1.52) 0.360 1.08 (0.66–1.77) 
rs4237 52 102 65 219 24 75 64 163 0.010 1.46 (1.09–1.96) 0.012 1.80 (1.06–3.07) 
rs4649119 61 105 54 220 60 82 21 163 0.004 1.53 (1.14–2.05)a 0.003 2.53 (1.36–4.69)a 
hCV11546265 87 80 34 201 78 65 15 158 0.058 1.36 (0.99–1.86) 0.039 2.03 (1.03–4.01) 
rs3003328 174 41 220 139 26 165 0.089 1.53 (0.93–2.52)a 0.047 8.79 (0.48–160.40)a 
rs2229586 52 105 63 220 22 83 60 165 0.013 1.45 (1.08–1.93) 0.009 2.25 (1.22–4.15) 
rs2229585 51 97 64 212 19 81 60 160 0.008 1.49 (1.11–2.01) 0.004 2.52 (1.34–4.74) 
rs2229584 48 98 61 207 21 75 61 157 0.009 1.49 (1.10–2.00) 0.009 2.29 (1.23–4.26) 
rs2229583 53 92 71 216 20 76 66 162 0.007 1.50 (1.12–2.02) 0.004 2.42 (1.31–4.47) 
rs2229581 51 103 62 216 21 79 62 162 0.006 1.52 (1.13–2.03) 0.004 2.43 (1.31–4.51) 
rs2229580 61 101 49 211 62 78 21 161 0.007 1.50 (1.12–2.02)a 0.006 2.37 (1.27–4.42)a 
rs2229579 175 37 5 217 141 21 0 162 0.038 1.75 (1.03–3.00)a 0.046 8.87 (0.49–161.75)a 
rs2502993 63 97 58 218 60 78 26 164 0.011 1.46 (1.09–1.95)a 0.011 2.13 (1.19–3.80)a 
rs4649124 54 103 62 219 22 79 64 165 0.003 1.56 (1.17–2.09) 0.002 2.53 (1.38–4.65) 
rs3003336 54 101 63 218 21 79 62 162 0.004 1.55 (1.15–2.07) 0.003 2.53 (1.37–4.68) 
rs2501431 59 99 51 209 62 81 18 161 0.001 1.62 (1.21–2.19)a 0.0007 2.98 (1.56–5.67)a 
rs2502992 49 104 64 217 21 82 61 164 0.016 1.43 (1.07–1.92) 0.011 2.22 (1.20–3.47) 
rs2501432 49 104 64 217 21 82 61 164 0.016 1.43 (1.07–1.92) 0.011 2.22 (1.20–3.47) 
rs16828926 155 59 220 126 36 162 0.048 1.54 (1.00–2.37)a 0.029 10.58 (0.59–189.53)a 
rs9424339 140 69 218 106 56 164 0.565 1.11 (0.77–1.61)a 0.754 3.41 (0.72–16.10)a 
rs7530595 60 104 36 200 63 73 20 156 0.036 1.38 (1.02–1.88) 0.054 1.89 (0.83–2.70) 
rs17338135 75 104 38 217 49 86 29 164 0.502 1.10 (0.83–1.48) 0.613 1.24 (0.80–1.92) 
hCV395615 34 112 52 198 38 82 38 158 0.228 1.20 (0.89–1.61) 0.181 1.53 (0.82–2.85) 
SNP ID Genotypes controls (nGenotypes cases (nAllele 1 versus 2 Genotype 11 versus 22 
 11 12 22 Sum 11 12 22 Sum P-value OR (95% CI) P-value OR (95% CI) 
rs10917411 76 116 28 220 80 63 21 164 0.043 1.36 (1.05-1.84)a 0.303 1.40 (0.74–2.68)a 
rs3753270 161 53 218 117 42 164 0.473 1.16 (0.76–1.73) 0.421 1.72 (0.45–6.54) 
rs10917414 75 121 23 219 76 68 20 164 0.138 1.26 (0.93–1.70)a 0.659 1.17 (0.59–2.30)a 
rs622770 48 115 56 219 34 79 52 165 0.319 1.16 (0.87–1.52) 0.360 1.08 (0.66–1.77) 
rs4237 52 102 65 219 24 75 64 163 0.010 1.46 (1.09–1.96) 0.012 1.80 (1.06–3.07) 
rs4649119 61 105 54 220 60 82 21 163 0.004 1.53 (1.14–2.05)a 0.003 2.53 (1.36–4.69)a 
hCV11546265 87 80 34 201 78 65 15 158 0.058 1.36 (0.99–1.86) 0.039 2.03 (1.03–4.01) 
rs3003328 174 41 220 139 26 165 0.089 1.53 (0.93–2.52)a 0.047 8.79 (0.48–160.40)a 
rs2229586 52 105 63 220 22 83 60 165 0.013 1.45 (1.08–1.93) 0.009 2.25 (1.22–4.15) 
rs2229585 51 97 64 212 19 81 60 160 0.008 1.49 (1.11–2.01) 0.004 2.52 (1.34–4.74) 
rs2229584 48 98 61 207 21 75 61 157 0.009 1.49 (1.10–2.00) 0.009 2.29 (1.23–4.26) 
rs2229583 53 92 71 216 20 76 66 162 0.007 1.50 (1.12–2.02) 0.004 2.42 (1.31–4.47) 
rs2229581 51 103 62 216 21 79 62 162 0.006 1.52 (1.13–2.03) 0.004 2.43 (1.31–4.51) 
rs2229580 61 101 49 211 62 78 21 161 0.007 1.50 (1.12–2.02)a 0.006 2.37 (1.27–4.42)a 
rs2229579 175 37 5 217 141 21 0 162 0.038 1.75 (1.03–3.00)a 0.046 8.87 (0.49–161.75)a 
rs2502993 63 97 58 218 60 78 26 164 0.011 1.46 (1.09–1.95)a 0.011 2.13 (1.19–3.80)a 
rs4649124 54 103 62 219 22 79 64 165 0.003 1.56 (1.17–2.09) 0.002 2.53 (1.38–4.65) 
rs3003336 54 101 63 218 21 79 62 162 0.004 1.55 (1.15–2.07) 0.003 2.53 (1.37–4.68) 
rs2501431 59 99 51 209 62 81 18 161 0.001 1.62 (1.21–2.19)a 0.0007 2.98 (1.56–5.67)a 
rs2502992 49 104 64 217 21 82 61 164 0.016 1.43 (1.07–1.92) 0.011 2.22 (1.20–3.47) 
rs2501432 49 104 64 217 21 82 61 164 0.016 1.43 (1.07–1.92) 0.011 2.22 (1.20–3.47) 
rs16828926 155 59 220 126 36 162 0.048 1.54 (1.00–2.37)a 0.029 10.58 (0.59–189.53)a 
rs9424339 140 69 218 106 56 164 0.565 1.11 (0.77–1.61)a 0.754 3.41 (0.72–16.10)a 
rs7530595 60 104 36 200 63 73 20 156 0.036 1.38 (1.02–1.88) 0.054 1.89 (0.83–2.70) 
rs17338135 75 104 38 217 49 86 29 164 0.502 1.10 (0.83–1.48) 0.613 1.24 (0.80–1.92) 
hCV395615 34 112 52 198 38 82 38 158 0.228 1.20 (0.89–1.61) 0.181 1.53 (0.82–2.85) 

For the cannabinoid receptor type 2 (CNR2) locus, 26 typed SNPs are shown. If present, rs numbers are given, otherwise Celera ID is provided. Individual numbers (n) for each genotype (11/12/22) are separately listed in controls and cases. P-value, OR and 95% confidence interval (CI) of OR are given for allelic and genotypic association. Polymorphisms located in the CNR2 coding exon are highlighted in bold type.

aIndicates the inverted OR (1/OR). In these cases, the reference is allele 2.

Table 4.

Summary of association results for seven unrelated control SNPs

Cytogenetic band SNP ID Genotypes controls (nGenotypes cases (nAllele 1 versus 2 Genotype 11 versus 22 
  11 12 22 Sum 11 12 22 Sum P-value OR (95% CI) P-value OR (95% CI) 
3p24 hCV170697 57 138 42 237 44 68 30 142 0.637 0.93 (0.69–1.25) 0.804 0.93 (0.50–1.70) 
6p25 hCV3136443 12 94 134 240 46 91 143 0.171 1.28 (0.90–1.83) 0.553 1.36 (0.49–3.75) 
9p11 hCV790013 31 86 113 230 21 63 60 144 0.228 0.83 (0.61–1.13) 0.453 0.78 (0.42–1.48) 
11p15 hCV1189670 25 86 113 227 13 64 65 142 0.704 0.94 (0.68–1.30) 0.788 1.11 (0.53–2.31) 
13q11 hCV2901474 37 105 85 227 23 72 49 144 0.676 0.94 (0.69–1.27) 0.814 0.93 (0.50–1.74) 
18q11 hCV1866490 12 91 117 220 25 43 75 0.974 1.01 (0.66–1.54) 0.360 0.63 (0.23–1.71) 
22q11 hCV11159648 63 118 46 227 30 74 40 144 0.055 1.34 (0.99–1.80) 0.051 1.83 (1.00–3.35) 
Cytogenetic band SNP ID Genotypes controls (nGenotypes cases (nAllele 1 versus 2 Genotype 11 versus 22 
  11 12 22 Sum 11 12 22 Sum P-value OR (95% CI) P-value OR (95% CI) 
3p24 hCV170697 57 138 42 237 44 68 30 142 0.637 0.93 (0.69–1.25) 0.804 0.93 (0.50–1.70) 
6p25 hCV3136443 12 94 134 240 46 91 143 0.171 1.28 (0.90–1.83) 0.553 1.36 (0.49–3.75) 
9p11 hCV790013 31 86 113 230 21 63 60 144 0.228 0.83 (0.61–1.13) 0.453 0.78 (0.42–1.48) 
11p15 hCV1189670 25 86 113 227 13 64 65 142 0.704 0.94 (0.68–1.30) 0.788 1.11 (0.53–2.31) 
13q11 hCV2901474 37 105 85 227 23 72 49 144 0.676 0.94 (0.69–1.27) 0.814 0.93 (0.50–1.74) 
18q11 hCV1866490 12 91 117 220 25 43 75 0.974 1.01 (0.66–1.54) 0.360 0.63 (0.23–1.71) 
22q11 hCV11159648 63 118 46 227 30 74 40 144 0.055 1.34 (0.99–1.80) 0.051 1.83 (1.00–3.35) 

In order to analyze the possibility of a population stratification effect, the distribution of intergenic unrelated markers was evaluated. Genomic DNAs from patients and controls were subjected to PCR amplification using the Assays-On-Demand SNP Genotyping Products (hCV170697, hCV3136443, hCV790013, hCV1189670, hCV2901474, hCV1866490 and hCV11159648; Applied Biosystems). None of these markers showed a significant association with the disease.

Table 5.

Clinical data for control and osteoporotic postmenopausal women

 n Age (years) Years after menopause Height (cm) Weight (kg) BMI (kg/m2T-score (L2–L4) T-score (FN) 
Controls 220 63.4±6.2 14.5±7.3 159.4±5.7 63.1±9.6 24.8±3.7 −0.666±1.245 −1.23±0.895 
Patients 168 63.3±9.4 16.2±10.0 156.8±5.9 56.7±7.4 23.1±2.9 −3.062±0.799 −2.675±0.67 
 n Age (years) Years after menopause Height (cm) Weight (kg) BMI (kg/m2T-score (L2–L4) T-score (FN) 
Controls 220 63.4±6.2 14.5±7.3 159.4±5.7 63.1±9.6 24.8±3.7 −0.666±1.245 −1.23±0.895 
Patients 168 63.3±9.4 16.2±10.0 156.8±5.9 56.7±7.4 23.1±2.9 −3.062±0.799 −2.675±0.67 

Data are expressed as mean±SD. BMD measurements were made at the lumbar spine (L2–L4) and at the FN determined by DEXA (LUNAR DPX-L). T-score, number of SDs a patient's BMD deviates from a French reference population of normal young adults provided by the manufacturer. BMI, body mass index.

References

1
Foroud, T., Econs, M.J. and Johnston, C.C. (
2002
) Genetics of osteoporosis. In King, R.A., Rotter, J.I. and Motulsky, A.G. (eds),
The Genetic Basis of Common Diseases
 , 2nd edn. Oxford University Press, Oxford, pp.
510
–517.
2
Grant, S.F., Reid, D.M., Blake, G., Herd, R., Fogelman, I. and Ralston, S.H. (
1996
) Reduced bone density and osteoporosis associated with a polymorphic Sp1 binding site in the collagen type I alpha 1 gene.
Nat. Genet.
 ,
14
,
203
–205.
3
Morrison, N.A., Qi, J.C., Tokita, A., Kelly, P.J., Crofts, L., Nguyen, T.V., Sambrook, P.N. and Eisman, J.A. (
1994
) Prediction of bone density from vitamin D receptor alleles.
Nature
 ,
367
,
284
–287.
4
Gong, Y., Slee, R.B., Fukai, N., Rawadi, G., Roman-Roman, S., Reginato, A.M., Wang, H., Cundy, T., Glorieux, F.H., Lev, D. et al. (
2001
) LDL receptor-related protein 5 (LRP5) affects bone accrual and eye development.
Cell
 ,
107
,
513
–523.
5
Styrkarsdottir, U., Cazier, J.B., Kong, A., Rolfsson, O., Larsen, H., Bjarnadottir, E., Johannsdottir, V.D., Sigurdardottir, M.S., Bagger, Y., Christiansen, C. et al. (
2003
) Linkage of osteoporosis to chromosome 20p12 and association to BMP2.
PLoS Biol.
 ,
1
,
E69
.
6
Devoto, M., Shimoya, K., Caminis, J., Ott, J., Tenenhouse, A., Whyte, M.P., Sereda, L., Hall, S., Considine, E., Williams, C.J. et al. (
1998
) First-stage autosomal genome screen in extended pedigrees suggests genes predisposing to low bone mineral density on chromosomes 1p, 2p and 4q.
Eur. J. Hum. Genet.
 ,
6
,
151
–157.
7
Devoto, M., Specchia, C., Li, H.H., Caminis, J., Tenenhouse, A., Rodriguez, H. and Spotila, L.D. (
2001
) Variance component linkage analysis indicates a QTL for femoral neck bone mineral density on chromosome 1p36.
Hum. Mol. Genet.
 ,
10
,
2447
–2452.
8
Devoto, M., Spotila, L.D., Stabley, D.L., Wharton, G.N., Rydbeck, H., Korkko, J., Kosich, R., Prockop, D., Tenenhouse, A. and Sol-Church, K. (
2005
) Univariate and bivariate variance component linkage analysis of a whole-genome scan for loci contributing to bone mineral density.
Eur. J. Hum. Genet.
 ,
13
,
781
–788.
9
Karsak, M., Ofek, O., Fogel, M., Wright, K., Tam, J., Gabet, Y., Birenboim, R., Attar-Namdar, M., Müller, R., Cohen-Solal, M. et al. (
2004
) The cannabinoid CB2 receptor: a potential target for the treatment of osteoporosis.
J. Bone Miner. Res.
 ,
19
,
S383
.
10
Idris, A.I., van't Hof, R.J., Greig, I.R., Ridge, S.A., Baker, D., Ross, R.A. and Ralston, S.H. (
2005
) Regulation of bone mass, bone loss and osteoclast activity by cannabinoid receptors.
Nat. Med
 .,
11
,
774
–779.
11
Herkenham, M., Lynn, A.B., Little, M.D., Johnson, M.R., Melvin, L.S., de Costa, B.R. and Rice, K.C. (
1990
) Cannabinoid receptor localization in brain.
Proc. Natl Acad. Sci. USA
 ,
87
,
1932
–1936.
12
Zimmer, A., Zimmer, A.M., Hohmann, A.G., Herkenham, M. and Bonner, T.I. (
1999
) Increased mortality, hypoactivity, and hypoalgesia in cannabinoid CB1 receptor knockout mice.
Proc. Natl Acad. Sci. USA
 ,
96
,
5780
–5785.
13
Munro, S., Thomas, K.L. and Abu-Shaar, M. (
1993
) Molecular characterization of a peripheral receptor for cannabinoids.
Nature
 ,
365
,
61
–65.
14
Beamer, W.G., Shultz, K.L., Donahue, L.R., Churchill, G.A., Sen, S., Wergedal, J.R., Baylink, D.J. and Rosen, C.J. (
2001
) Quantitative trait loci for femoral and lumbar vertebral bone mineral density in C57BL/6J and C3H/HeJ inbred strains of mice.
J. Bone Miner. Res.
 ,
16
,
1195
–1206.
15
Klein, R.F., Shea, M., Gunness, M.E., Pelz, G.B., Belknap, J.K. and Orwoll, E.S. (
2001
) Phenotypic characterization of mice bred for high and low peak bone mass.
J. Bone Miner. Res.
 ,
16
,
63
–71.
16
Hinds, D.A., Stuve, L.L., Nilsen, G.B., Halperin, E., Eskin, E., Ballinger, D.G., Frazer, K.A. and Cox, D.R. (
2005
) Whole-genome patterns of common DNA variation in three human populations.
Science
 ,
307
,
1072
–1079.
17
Zhang, K., Qin, Z., Chen, T., Liu, J.S., Waterman, M.S. and Sun, F. (
2005
) HapBlock: haplotype block partitioning and tag SNP selection software using a set of dynamic programming algorithms.
Bioinformatics
 ,
21
,
131
–134.
18
Steffens, S., Veillard, N.R., Arnaud, C., Pelli, G., Burger, F., Staub, C., Karsak, M., Zimmer, A., Frossard, J.L. and Mach, F. (
2005
) Low dose oral cannabinoid therapy reduces progression of atherosclerosis in mice.
Nature
 ,
434
,
782
–786.
19
Jorgensen, L., Joakimsen, O., Rosvold Berntsen, G.K., Heuch, I. and Jacobsen, B.K. (
2004
) Low bone mineral density is related to echogenic carotid artery plaques: a population-based study.
Am. J. Epidemiol.
 ,
160
,
549
–556.
20
Barrett, J.C., Fry, B., Maller, J. and Daly, M.J. (
2005
) Haploview: analysis and visualization of LD and haplotype maps.
Bioinformatics
 ,
21
,
263
–265.