Abstract
Recent studies suggest that assisted reproductive technologies (ART), which involve the isolation, handling and culture of gametes and early embryos, are associated with an increased incidence of rare imprinting disorders. Major epigenetic events take place during this time and the process of ART may expose the epigenome to external influences, preventing the proper establishment and maintenance of genomic imprints. However, the risks of ART cannot be simply evaluated because the patients who receive ART may differ both demographically and genetically from the general population at reproductive age. In this study, we examined the DNA methylation status of seven imprinted genes using a combined bisulphite-PCR restriction analysis and sequencing technique on sperm DNA obtained from 97 infertile men. We found an abnormal paternal methylation imprint in 14 patients (14.4%) and abnormal maternal imprint in 20 patients (20.6%). The majority of these doubly defective samples were in men with moderate or severe oligospermia. These abnormalities were specific to imprinted loci as we found that global DNA methylation was normal in these samples. The outcome of ART with sperm shown to have an abnormal DNA methylation pattern was generally poor. However, one sample of sperm with both paternal and maternal methylation errors used in ICSI produced a child of normal appearance without any abnormalities in their imprinted methylation pattern. Our data suggest that sperm from infertile patients, especially those with oligospermia, may carry a higher risk of transmitting incorrect primary imprints to their offspring, highlighting the need for more research into ART.
INTRODUCTION
Human-assisted reproductive technologies (ART) are important treatments for infertile people of reproductive age, by which the eggs and/or sperm are manipulated in the laboratory. However, a number of studies published over the last few years have suggested an excess occurrence of major malformation, low birth weight and other perinatal complications in babies conceived by ART ( 1–3 ). Furthermore, some studies have suggested that there is an increased incidence of rare imprinting disorders, including cases of Beckwith–Wiedemann syndrome (BWS; NIM130650) and Angelman syndrome (AS; NIM105830), associated with human ART ( 2–10 ).
Genomic imprinting, i.e. the allele-specific expression of certain genes, accounts for the requirement for both maternal and paternal genomes in normal development and plays important roles in regulating embryonic growth, placental function and neurobehavioural processes ( 11 , 12 ). This monoallelic expression relies on epigenetic mechanisms. DNA methylation of CpG dinucleotides at differentially methylated regions (DMRs) is the best-studied epigenetic mark. Imprint resetting involves erasure of imprints in the primordial germ cells and the acquisition of new sex specific imprints. Although oocytes are arrested at prophase I and during the transition from primordial to antral follicles in the post-natal growth phase (post-pachytene), methylation is acquired asynchronously in a gene-specific manner in the mouse female germ line ( 13 , 14 ). In the human oocyte, we previously reported that the maternal methylation of these genes has already been initiated to some extent in adult non-growing human oocytes, but not in neonatal oocytes ( 15 ). In contrast, in males, H19 , Rasgrf1 and Gtl2 methylation imprints are initiated pre-natally during embryonic germ cell development and are completed by the pachytene phase of post-natal spermatogenesis in mice ( 16–19 ). The imprints of gametes are maintained stably in the early embryo, despite overall epigenetic reprogramming ( 20 ). The aberrant expression of several imprinted genes has been linked to a number of diseases, developmental abnormalities and malignant tumours in humans ( 21 ).
In humans, limited information is available on the methylation status of imprinted genes during gametogenesis and embryogenesis, but the available data suggest some conservation of the timing of DNA methylation acquisition and maintenance dynamics described in mice. During normal spermatogenesis, the erasure of methylation marks of the maternally imprinted gene SNRPN ( 22 ) and the resetting of the paternally imprinted gene H19 ( 23 , 24 ) have been reported to be completed before germ cells enter meiosis. Marques et al . ( 24 ) reported that there was abnormal imprinting of only H19 in oligospermic patients and in a small number of the normospermic patients. In contrast, appropriate genomic imprinting was reported in spermatozoa from some infertile men ( 25 ). However, those studies were restricted to one specific imprinted domain.
ART involve the isolation, handling and culture of gametes and early embryos, generally after hormone stimulation protocols. Major epigenetic events take place during this time and the process of ART may expose the epigenome to external influences, preventing the proper establishment and maintenance of genomic imprints ( 6 , 8 ). One of the issues with ART concerns the artificial induction of ovulation with high doses of gonadotrophins. We and others have demonstrated that superovulation affects the methylation at certain imprinted loci ( 15 , 26 , 27 ). The second issue is related to the culture conditions. Some studies have shown that exposure of mouse embryos to different culture conditions can alter the expression and imprinting of various genes, which could result in abnormal development ( 6–8 ). The third issue is the potential effect of embryo cryopreservation ( 28 , 29 ). Experimentally, embryo freezing has been shown to have deleterious effects on DNA, embryonic gene expression, telomeres and plasma and nuclear membranes. The timing of embryo transfer may also present issues. Recent studies on monochorionic dizygotic and conjoined twins with BWS resulting from transfer of embryos at the blastocyst stage revealed demethylation of LIT1 ( KCNQ1OT1 ) ( 30 , 31 ), suggesting that this demethylation occurs at a critical stage of pre-implantation development. Furthermore, there may be other serious issues causing yet unknown risks of ART. However, such a risk of ART treatment cannot be simply evaluated, because the patients who receive ART may differ both demographically and genetically from the general population at reproductive age. Usually, patients requesting ART have a low fertility rate, an increased reproductive loss rate and are of advanced age, all of which are associated with various fetal and neonatal abnormalities.
All these confounding factors make it difficult to evaluate and estimate the risk of ART procedures, especially ICSI. It is also difficult to dissect out the role of imprinting errors in any abnormality reported after ART. To partly address these difficulties, we determined the DNA methylation status of the DMRs of seven imprinted genes (paternally methylated genes: H19 and GTL2 ; maternally methylated genes: PEG1 , LIT1 , ZAC , PEG3 and SNRPN ) directly in sperm DNA using a combined bisulphite-PCR restriction analysis (COBRA) and sequencing technique. The COBRA technique gives a basic read-out for the degree of DNA methylation at a given sequence and also acts as a control for the bisulphite sequencing technique by confirming a lack of bias in the cloning of the PCR product. The bisulphite technique is more sensitive than COBRA because every potential methylation site in a target sequence is examined. We applied the techniques to sperm DNA obtained from infertile men. Our data showed the occurrence of methylation errors in maternal and paternal imprinted genes that were specific to infertile men. In addition, we found one sperm sample that contained errors in both the paternal and the maternal methylation patterns. This sperm sample was used in an ART procedure that led to a successful and normal pregnancy and birth. This gave an opportunity to examine the DNA methylation status of the seven imprinted genes in the baby.
RESULTS
Analysis of the paternal methylation imprint on the sperm of infertile couples
We analysed the primary DNA methylation pattern of seven imprinted loci in 97 sperm DNA samples from male patients who were within couples reporting fertility problems. We examined a total of 18 CpG sites in a 220 bp fragment of H19 and 15 CpG sites in a 259 bp fragment of GTL2 (Fig. 1 Aa and b). These two genes are normally expressed only from the maternal allele and are linked to paternally methylated DMRs.
Methylation status of imprinted genes in genomic DNA prepared from ejaculated human sperm. ( A ) Genomic structures of the human DMRs of H19 (a) , GTL2 (b) , PEG1 (c), LIT1 (d), ZAC (e) , PEG3 (f) and SNRPN (g) and the repetitive sequence non-imprinted genes LINE1 (h) and Alu (i). The extent of the regions analysed in this study and the GenBank accession numbers are shown under the line. Filled boxes and horizontal arrows indicate the genes and orientation, respectively. Open boxes represent the DMRs of the genes. Arrowheads above the CpGs indicate which of these sites are contained within a repeat. The horizontal arrows represent the primers. Vertical arrows indicate the unique bisulphite-PCR restriction enzyme sites analysed in ( B ) T, Taq I; Ml, Mlu I; N, Nru I; Mb, Mbo I and H, Hha I. The vertical bars represent a CpG site. (B) Methylation imprint errors in the sperm from ART male patients. Overall methylation status of the DMRs (by COBRA) in the adult sperm DNA and in the control leukocyte DNA. The same bisulphite-treated DNA amplified by PCR and used for (A) was digested with restriction enzymes that cut only if the site was methylated at the positions indicated in (A). Sizes of digested fragments are indicated on the right. For H19 (a), case 26 showed the unmethylated band and for PEG1 (b), cases 62, 63 and 66 showed the methylated band. ( C ) Bisulphite-PCR sequencing for PEG1 cases 62, 63, 64 and 66. Closed and open circles represent methylated and unmethylated CpGs, respectively. The results are summarized in Table 1 .
COBRA and bisulphite-PCR analyses of methylation profiles of seven imprinted and two non-imprinted genes in infertile sperm sample sequences
| Case (age) | Microscopic examination | H19 | GTL2 | PEG1 | LIT1 | ZAC | PEG3 | SNRPN | LINE-1 | Alu |
|---|---|---|---|---|---|---|---|---|---|---|
| 30 (36) | Normal | + | 43.5 (51.2) | 17.9 (12.7) | − | − | − | − | 44.9 | 22.7 |
| 32 (33) | Normal | + | + | 19.8 (21.9) | − | − | − | − | 43.7 | 22.7 |
| 37 (34) | Normal | + | 91.8 | 17.2 (18.4) | − | − | − | − | 56.0 | 20.2 |
| 39 (31) | Normal | + | + | − | − | − | 12.3 | − | 47.3 | 20.1 |
| 49 (38) | Normal | + | 88.9 | − | − | − | − | − | 46.7 | 24.3 |
| 52 (31) | Normal | + | + | − | 10.5 (3.0) | − | − | − | 45.3 | 22.8 |
| 54 (32) | Normal | + | 88.4 | 8.0 | − | − | 13.1 (4.5) | − | 46.7 | 22.2 |
| 56 (34) | Normal | + | 89.5 | − | − | − | − | − | 55.9 | 24.0 |
| 59 (33) | Normal | + | + | 10.6 | 10.2 (1.8) | − | − | − | 50.3 | 20.5 |
| 66 (34) | Normal | + | + | 18.8 (42.1) | 8.1 | − | − | − | 46.9 | 22.1 |
| 79 (30) | Normal | + | + | − | − | − | 11.9 | − | 46.8 | 19.4 |
| 85 (34) | Normal | + | + | 17.0 (21.2) | − | − | − | − | 44.1 | 22.9 |
| 87 (32) | Normal | + | + | − | − | − | 12.1 | − | 46.6 | 19.7 |
| 90 (38) | Normal | + | + | − | − | − | − | 8.3 | 53.7 | 20.8 |
| 7 (46) | Moderate | 23.7 (11.4) | + | 33.4 (43.4) | − | − | − | 13.3 (5.0) | 48.0 | 19.8 |
| 29 (34) | Moderate | + | + | − | − | − | − | 8.9 | 49.1 | 21.9 |
| 31 (40) | Moderate | + | 75.4 | − | − | − | − | − | 54.1 | 20.9 |
| 62 (40) | Moderate | + | 88.1 | 9.6 (8.7) | − | − | 12.8 | − | 44.3 | 21.7 |
| 16 (34) | Severe | + | 52.1 (75.8) | − | − | − | − | − | 56.1 | 22.6 |
| 26 (38) | Severe | 10.7 (10.6) | + | 52.3 (60.5) | − | 21.9 (19.5) | − | − | 52.8 | 21.3 |
| 63 (27) | Severe | 59.0 (55.6) | 89.2 | 17.8 (20.8) | 13.2 (19.0) | − | − | − | 53.0 | 20.0 |
| 67 (37) | Severe | 89.4 (80.7) | + | 16.7 (37.3) | − | − | − | − | 52.4 | 19.6 |
| 82 (37) | Severe | + | 82.0 | − | − | 12.9 (13.7) | − | − | 50.7 | 18.9 |
| 83 (32) | Severe | + | 78.1 | − | − | 16.6 (14.3) | − | 8.4 | 46.9 | 21.0 |
| Case (age) | Microscopic examination | H19 | GTL2 | PEG1 | LIT1 | ZAC | PEG3 | SNRPN | LINE-1 | Alu |
|---|---|---|---|---|---|---|---|---|---|---|
| 30 (36) | Normal | + | 43.5 (51.2) | 17.9 (12.7) | − | − | − | − | 44.9 | 22.7 |
| 32 (33) | Normal | + | + | 19.8 (21.9) | − | − | − | − | 43.7 | 22.7 |
| 37 (34) | Normal | + | 91.8 | 17.2 (18.4) | − | − | − | − | 56.0 | 20.2 |
| 39 (31) | Normal | + | + | − | − | − | 12.3 | − | 47.3 | 20.1 |
| 49 (38) | Normal | + | 88.9 | − | − | − | − | − | 46.7 | 24.3 |
| 52 (31) | Normal | + | + | − | 10.5 (3.0) | − | − | − | 45.3 | 22.8 |
| 54 (32) | Normal | + | 88.4 | 8.0 | − | − | 13.1 (4.5) | − | 46.7 | 22.2 |
| 56 (34) | Normal | + | 89.5 | − | − | − | − | − | 55.9 | 24.0 |
| 59 (33) | Normal | + | + | 10.6 | 10.2 (1.8) | − | − | − | 50.3 | 20.5 |
| 66 (34) | Normal | + | + | 18.8 (42.1) | 8.1 | − | − | − | 46.9 | 22.1 |
| 79 (30) | Normal | + | + | − | − | − | 11.9 | − | 46.8 | 19.4 |
| 85 (34) | Normal | + | + | 17.0 (21.2) | − | − | − | − | 44.1 | 22.9 |
| 87 (32) | Normal | + | + | − | − | − | 12.1 | − | 46.6 | 19.7 |
| 90 (38) | Normal | + | + | − | − | − | − | 8.3 | 53.7 | 20.8 |
| 7 (46) | Moderate | 23.7 (11.4) | + | 33.4 (43.4) | − | − | − | 13.3 (5.0) | 48.0 | 19.8 |
| 29 (34) | Moderate | + | + | − | − | − | − | 8.9 | 49.1 | 21.9 |
| 31 (40) | Moderate | + | 75.4 | − | − | − | − | − | 54.1 | 20.9 |
| 62 (40) | Moderate | + | 88.1 | 9.6 (8.7) | − | − | 12.8 | − | 44.3 | 21.7 |
| 16 (34) | Severe | + | 52.1 (75.8) | − | − | − | − | − | 56.1 | 22.6 |
| 26 (38) | Severe | 10.7 (10.6) | + | 52.3 (60.5) | − | 21.9 (19.5) | − | − | 52.8 | 21.3 |
| 63 (27) | Severe | 59.0 (55.6) | 89.2 | 17.8 (20.8) | 13.2 (19.0) | − | − | − | 53.0 | 20.0 |
| 67 (37) | Severe | 89.4 (80.7) | + | 16.7 (37.3) | − | − | − | − | 52.4 | 19.6 |
| 82 (37) | Severe | + | 82.0 | − | − | 12.9 (13.7) | − | − | 50.7 | 18.9 |
| 83 (32) | Severe | + | 78.1 | − | − | 16.6 (14.3) | − | 8.4 | 46.9 | 21.0 |
Methylation results: +, almost fully methylated; −, almost fully unmethylated. Number represents percent methylated with bisulphite result given in brackets. Moderate: moderate oligospermia (sperm count 5–20 × 10 6 /ml), severe: severe oligospermia (<5 × 10 6 /ml), normal: normal spermia (≥20 × 10 6 /ml). The results of all cases were shown in detail in Supplementary Material, Table S2.
COBRA and bisulphite-PCR analyses of methylation profiles of seven imprinted and two non-imprinted genes in infertile sperm sample sequences
| Case (age) | Microscopic examination | H19 | GTL2 | PEG1 | LIT1 | ZAC | PEG3 | SNRPN | LINE-1 | Alu |
|---|---|---|---|---|---|---|---|---|---|---|
| 30 (36) | Normal | + | 43.5 (51.2) | 17.9 (12.7) | − | − | − | − | 44.9 | 22.7 |
| 32 (33) | Normal | + | + | 19.8 (21.9) | − | − | − | − | 43.7 | 22.7 |
| 37 (34) | Normal | + | 91.8 | 17.2 (18.4) | − | − | − | − | 56.0 | 20.2 |
| 39 (31) | Normal | + | + | − | − | − | 12.3 | − | 47.3 | 20.1 |
| 49 (38) | Normal | + | 88.9 | − | − | − | − | − | 46.7 | 24.3 |
| 52 (31) | Normal | + | + | − | 10.5 (3.0) | − | − | − | 45.3 | 22.8 |
| 54 (32) | Normal | + | 88.4 | 8.0 | − | − | 13.1 (4.5) | − | 46.7 | 22.2 |
| 56 (34) | Normal | + | 89.5 | − | − | − | − | − | 55.9 | 24.0 |
| 59 (33) | Normal | + | + | 10.6 | 10.2 (1.8) | − | − | − | 50.3 | 20.5 |
| 66 (34) | Normal | + | + | 18.8 (42.1) | 8.1 | − | − | − | 46.9 | 22.1 |
| 79 (30) | Normal | + | + | − | − | − | 11.9 | − | 46.8 | 19.4 |
| 85 (34) | Normal | + | + | 17.0 (21.2) | − | − | − | − | 44.1 | 22.9 |
| 87 (32) | Normal | + | + | − | − | − | 12.1 | − | 46.6 | 19.7 |
| 90 (38) | Normal | + | + | − | − | − | − | 8.3 | 53.7 | 20.8 |
| 7 (46) | Moderate | 23.7 (11.4) | + | 33.4 (43.4) | − | − | − | 13.3 (5.0) | 48.0 | 19.8 |
| 29 (34) | Moderate | + | + | − | − | − | − | 8.9 | 49.1 | 21.9 |
| 31 (40) | Moderate | + | 75.4 | − | − | − | − | − | 54.1 | 20.9 |
| 62 (40) | Moderate | + | 88.1 | 9.6 (8.7) | − | − | 12.8 | − | 44.3 | 21.7 |
| 16 (34) | Severe | + | 52.1 (75.8) | − | − | − | − | − | 56.1 | 22.6 |
| 26 (38) | Severe | 10.7 (10.6) | + | 52.3 (60.5) | − | 21.9 (19.5) | − | − | 52.8 | 21.3 |
| 63 (27) | Severe | 59.0 (55.6) | 89.2 | 17.8 (20.8) | 13.2 (19.0) | − | − | − | 53.0 | 20.0 |
| 67 (37) | Severe | 89.4 (80.7) | + | 16.7 (37.3) | − | − | − | − | 52.4 | 19.6 |
| 82 (37) | Severe | + | 82.0 | − | − | 12.9 (13.7) | − | − | 50.7 | 18.9 |
| 83 (32) | Severe | + | 78.1 | − | − | 16.6 (14.3) | − | 8.4 | 46.9 | 21.0 |
| Case (age) | Microscopic examination | H19 | GTL2 | PEG1 | LIT1 | ZAC | PEG3 | SNRPN | LINE-1 | Alu |
|---|---|---|---|---|---|---|---|---|---|---|
| 30 (36) | Normal | + | 43.5 (51.2) | 17.9 (12.7) | − | − | − | − | 44.9 | 22.7 |
| 32 (33) | Normal | + | + | 19.8 (21.9) | − | − | − | − | 43.7 | 22.7 |
| 37 (34) | Normal | + | 91.8 | 17.2 (18.4) | − | − | − | − | 56.0 | 20.2 |
| 39 (31) | Normal | + | + | − | − | − | 12.3 | − | 47.3 | 20.1 |
| 49 (38) | Normal | + | 88.9 | − | − | − | − | − | 46.7 | 24.3 |
| 52 (31) | Normal | + | + | − | 10.5 (3.0) | − | − | − | 45.3 | 22.8 |
| 54 (32) | Normal | + | 88.4 | 8.0 | − | − | 13.1 (4.5) | − | 46.7 | 22.2 |
| 56 (34) | Normal | + | 89.5 | − | − | − | − | − | 55.9 | 24.0 |
| 59 (33) | Normal | + | + | 10.6 | 10.2 (1.8) | − | − | − | 50.3 | 20.5 |
| 66 (34) | Normal | + | + | 18.8 (42.1) | 8.1 | − | − | − | 46.9 | 22.1 |
| 79 (30) | Normal | + | + | − | − | − | 11.9 | − | 46.8 | 19.4 |
| 85 (34) | Normal | + | + | 17.0 (21.2) | − | − | − | − | 44.1 | 22.9 |
| 87 (32) | Normal | + | + | − | − | − | 12.1 | − | 46.6 | 19.7 |
| 90 (38) | Normal | + | + | − | − | − | − | 8.3 | 53.7 | 20.8 |
| 7 (46) | Moderate | 23.7 (11.4) | + | 33.4 (43.4) | − | − | − | 13.3 (5.0) | 48.0 | 19.8 |
| 29 (34) | Moderate | + | + | − | − | − | − | 8.9 | 49.1 | 21.9 |
| 31 (40) | Moderate | + | 75.4 | − | − | − | − | − | 54.1 | 20.9 |
| 62 (40) | Moderate | + | 88.1 | 9.6 (8.7) | − | − | 12.8 | − | 44.3 | 21.7 |
| 16 (34) | Severe | + | 52.1 (75.8) | − | − | − | − | − | 56.1 | 22.6 |
| 26 (38) | Severe | 10.7 (10.6) | + | 52.3 (60.5) | − | 21.9 (19.5) | − | − | 52.8 | 21.3 |
| 63 (27) | Severe | 59.0 (55.6) | 89.2 | 17.8 (20.8) | 13.2 (19.0) | − | − | − | 53.0 | 20.0 |
| 67 (37) | Severe | 89.4 (80.7) | + | 16.7 (37.3) | − | − | − | − | 52.4 | 19.6 |
| 82 (37) | Severe | + | 82.0 | − | − | 12.9 (13.7) | − | − | 50.7 | 18.9 |
| 83 (32) | Severe | + | 78.1 | − | − | 16.6 (14.3) | − | 8.4 | 46.9 | 21.0 |
Methylation results: +, almost fully methylated; −, almost fully unmethylated. Number represents percent methylated with bisulphite result given in brackets. Moderate: moderate oligospermia (sperm count 5–20 × 10 6 /ml), severe: severe oligospermia (<5 × 10 6 /ml), normal: normal spermia (≥20 × 10 6 /ml). The results of all cases were shown in detail in Supplementary Material, Table S2.
To confirm that the sequencing results from the limited number of templates accurately reflected the overall methylation pattern of the amplified sequences from the isolated germ cell populations, we carried out restriction analysis (COBRA). Germ cell and somatic cell genomic DNA was cut with enzymes that could cleave only the methylated templates of the same bisulphite-treated PCR samples that were used for cloning and sequencing. PCR of these DMRs was followed by digestion with the enzymes Taq I and Mlu I for H19 and with Taq I and Nru I for GTL2 , so that the undigested and digested products indicated unmethylated and methylated templates, respectively. About half methylated and half unmethylated templates, representing paternal and maternal alleles, were obtained after the treatment of DNA from normal somatic leukocytes, indicating a lack of bias in the PCR (Fig. 1 Ba and b, control). On all DNA from sperm that had a normal count and were motile, H19 was shown to yield the digested methylated band using the method of COBRA, suggesting that the majority of the sample was methylated at this locus. However, in four cases of oligospermia (moderate oligospermia, one case and severe oligospermia, three cases), unmethylated bands were found. Their sequences were then determined and gave similar results to the COBRA (Figs 1 Ba and 2 Ba, sperm; Table 1 ). This result was similar to that of a previous report ( 24 ). We next performed the methylation analyses of GTL2 . The COBRA assay for GTL2 showed it to be methylated in almost all male germ lines. However, as was found for H19 , six sperm samples with oligospermia (moderate oligospermia, two cases and severe oligospermia, four cases) showed the unmethylated bands (Table 1 , data not shown). We also carried out the bisulphite-PCR sequencing of the CpG sites of H19 and GTL2 . When we examined the data for both H19 and GTL2 , we found one case that showed abnormal methylation of both the H19 and GTL2 DMRs. This individual had severe oligospermia. Surprisingly, there were five cases that appeared normal at the level of microscopic examination but showed an abnormal unmethylated pattern. Nonetheless, the occurrence of abnormal methylation at the H19 and GTL2 loci was significantly increased in oligospermic patients when compared with normospermic patients (Supplementary Material, Table S1).
DNA methylation analyses in a case of a neonate whose father's sperm showed abnormal methylation at imprinted loci. DNA methylation analyses COBRA ( A ) and bisulphite-PCR sequencing ( B ) of genomic DNA prepared from the neonate produced by ICSI treatment with sperm (case 26) that we showed had an abnormal pattern of DNA methylation at imprinted loci. Sp, sperm DNA from the male patient; Bl, leukocyte DNA from the male patient and Um, leukocyte DNA from the umbilical cord blood from the neonate. Closed and open circles represent methylated and unmethylated CpGs, respectively.
Analysis of the maternal methylation imprint of the sperm
We next extended the methylation analyses of the human sperm DNA to maternal methylation regions associated with PEG1, LIT1 , ZAC , PEG3 and SNRPN . We previously reported that these regions of PEG1 , LIT1 , ZAC were DMRs that showed 50% methylation in somatic cells and were completely methylated in the fully grown ovum ( 15 ). Here, we confirmed that the human SNRPN and PEG3 DMRs in both normal somatic and germ cells were methylated in a similar manner as previously shown (data not shown). We then performed the methylation analyses of the five maternal DMRs in the sperm samples. First, COBRA analyses were performed in order to examine the overall methylation patterns (Fig. 1 Bb). Almost all sperm samples were shown to have the expected unmethylated pattern, but a few samples also had the methylated band pattern ( PEG1 12 cases; LIT1 four cases; ZAC three cases; PEG3 five cases and SNRPN four cases) (Table 1 ). Furthermore, as with the paternal DNA methylation analysis, the proportion of oligospermic patients with aberrant methylation profiles was significantly increased when compared with normospermic patients (Supplementary Material, Table S1).
We confirmed the results of the COBRA assay by sequencing 10–20 clones at every CpG site within the DMRs (Fig. 1 C and Table 1 ). Half of the sperm samples with severe oligospermia (five of 10 cases) were shown to have an abnormal methylation pattern in the maternal DMRs. Among the cases of moderate oligospermia, three of eight cases were shown to have an abnormal maternal methylation pattern. Also, 12 cases in which the sperm appeared normal were shown to have both methylated and unmethylated band patterns.
Among the cases examined, 12 of 24 had an abnormal methylation pattern. Ten cases were found to show aberrant methylation at both paternally and maternally methylated DMRs. Of the six severest oligospermia cases, five were shown to have both the maternal and the paternal abnormal methylation patterns. Within the normal-appearing sperm samples, very few showed aberrant methylation at both paternally and maternally methylated DMRs.
Methylation analysis of non-imprinted repetitive genes
The great majority of CpGs present in the mammalian genome are contained within repetitive DNA elements. To find whether DNA methylation errors occur in ejaculated sperm on a more global level, we assessed the methylation profile of non-imprinted repetitive elements, such as long interspersed nucleotide elements ( LINE1 ) and Alu elements. We examined a total of 28 CpG sites in a 413 bp fragment of LINE1 and 12 CpG sites in a 152 bp fragment of Alu in sperm that we had identified with abnormal methylation at imprinted loci by COBRA (Fig. 1 Ah and i). Our results showed that the ratio of the methylation showed no significant differences between the cases of normal imprint methylation and those of aberrant imprint methylation (Table 1 ). All the results of the COBRA and bisulphite-PCR analyses are shown in Supplementary Material, Table S2.
Analysis of an infant born from ICSI from a patient with an aberrant sperm DNA methylation pattern
We followed the infertility treatments and pregnancy history of 24 cases that showed the abnormal DNA methylation patterns (Table 2 ). Four of the pregnancies from ICSI ended in a miscarriage. One patient had spontaneous pregnancy without ART. Two patients after ICSI had live births. In one of these cases, the baby was delivered at full term by a caesarean operation at the patient's request. The neonate was female and birth weight was 2650 g, height 47.2 cm and Apgar score 9 points/1 min (10 points/5 min). No abnormalities were seen on physical and neurological examinations.
Treatment and outcome of ART with sperm shown to have abnormal DNA methylation patterns at imprinted gene loci
| Case (age) | Cause of infertility | ART (number) | Fertilized rate (%) | Embryo stage | Embryo grade | Pregnancy (time) | Abortion (time) |
|---|---|---|---|---|---|---|---|
| 7 (46) | Unknown | IVF (1), ICSI (10) | 50.6 | 6 cell | 3 | — | — |
| 16 (34) | Male factor | ICSI (2) | 83.5 | 1 | — | ||
| 26 (38) | Male factor | ICSI (21) | 68.3 | 8 cell | 2 | 1 a | 1 |
| 29 (34) | Tubal factor | IVF(1), ICSI (4) | 77.8 | 9 cell | 2 | — | |
| 30 (36) | Unknown | ICSI (2) | 66.3 | 6 cell | 2 | — | — |
| 31 (40) | Unknown | ICSI (1) | 0 | — | |||
| 32 (33) | Endometriosis | IVF (7), ICSI (3) | 67.3 | 5 cell | 3 | — | 1 |
| 37 (34) | Tubal factor | ICSI (3) | 80 | ||||
| 39 (31) | Endometriosis | IVF (1), ICSI (3) | 65.7 | 8 cell | 2 | 1 b | — |
| 49 (38) | Unknown | IVF (2), ICSI (2) | 49.8 | — | — | ||
| 52 (31) | Tubal factor | ICSI (1) | 50 | 1 | — | ||
| 54 (32) | Male factor | ICSI (1) | 40 | 1 | 1 | ||
| 56 (34) | Unknown | 0 | — | — | — | ||
| 59 (33) | Unknown | IVF (1), ICSI (1) | 81.5 | — | — | ||
| 62 (40) | Unknown | ICSI (1) | 69 | 1 a | — | ||
| 63 (27) | Male factor | ICSI (2) | 45 | — | — | ||
| 66 (34) | Male factor | 0 | — | — | — | ||
| 67 (37) | Endometriosis | IVF (2) | 33 | — | — | ||
| 79 (30) | Unknown | 0 | — | — | — | ||
| 82 (37) | Endometriosis | IVF (2) | 33 | — | — | ||
| 83 (32) | Male factor | 0 | — | — | — | ||
| 85 (34) | Unknown | 0 | — | — | — | ||
| 87 (32) | Unknown | IVF (1), ICSI (1) | 82 | — | 1 | ||
| 90 (38) | Unknown | 0 | — | — | — |
| Case (age) | Cause of infertility | ART (number) | Fertilized rate (%) | Embryo stage | Embryo grade | Pregnancy (time) | Abortion (time) |
|---|---|---|---|---|---|---|---|
| 7 (46) | Unknown | IVF (1), ICSI (10) | 50.6 | 6 cell | 3 | — | — |
| 16 (34) | Male factor | ICSI (2) | 83.5 | 1 | — | ||
| 26 (38) | Male factor | ICSI (21) | 68.3 | 8 cell | 2 | 1 a | 1 |
| 29 (34) | Tubal factor | IVF(1), ICSI (4) | 77.8 | 9 cell | 2 | — | |
| 30 (36) | Unknown | ICSI (2) | 66.3 | 6 cell | 2 | — | — |
| 31 (40) | Unknown | ICSI (1) | 0 | — | |||
| 32 (33) | Endometriosis | IVF (7), ICSI (3) | 67.3 | 5 cell | 3 | — | 1 |
| 37 (34) | Tubal factor | ICSI (3) | 80 | ||||
| 39 (31) | Endometriosis | IVF (1), ICSI (3) | 65.7 | 8 cell | 2 | 1 b | — |
| 49 (38) | Unknown | IVF (2), ICSI (2) | 49.8 | — | — | ||
| 52 (31) | Tubal factor | ICSI (1) | 50 | 1 | — | ||
| 54 (32) | Male factor | ICSI (1) | 40 | 1 | 1 | ||
| 56 (34) | Unknown | 0 | — | — | — | ||
| 59 (33) | Unknown | IVF (1), ICSI (1) | 81.5 | — | — | ||
| 62 (40) | Unknown | ICSI (1) | 69 | 1 a | — | ||
| 63 (27) | Male factor | ICSI (2) | 45 | — | — | ||
| 66 (34) | Male factor | 0 | — | — | — | ||
| 67 (37) | Endometriosis | IVF (2) | 33 | — | — | ||
| 79 (30) | Unknown | 0 | — | — | — | ||
| 82 (37) | Endometriosis | IVF (2) | 33 | — | — | ||
| 83 (32) | Male factor | 0 | — | — | — | ||
| 85 (34) | Unknown | 0 | — | — | — | ||
| 87 (32) | Unknown | IVF (1), ICSI (1) | 82 | — | 1 | ||
| 90 (38) | Unknown | 0 | — | — | — |
a ICSI pregnancy and birth.
b Spontaneous pregnancy and birth.
Treatment and outcome of ART with sperm shown to have abnormal DNA methylation patterns at imprinted gene loci
| Case (age) | Cause of infertility | ART (number) | Fertilized rate (%) | Embryo stage | Embryo grade | Pregnancy (time) | Abortion (time) |
|---|---|---|---|---|---|---|---|
| 7 (46) | Unknown | IVF (1), ICSI (10) | 50.6 | 6 cell | 3 | — | — |
| 16 (34) | Male factor | ICSI (2) | 83.5 | 1 | — | ||
| 26 (38) | Male factor | ICSI (21) | 68.3 | 8 cell | 2 | 1 a | 1 |
| 29 (34) | Tubal factor | IVF(1), ICSI (4) | 77.8 | 9 cell | 2 | — | |
| 30 (36) | Unknown | ICSI (2) | 66.3 | 6 cell | 2 | — | — |
| 31 (40) | Unknown | ICSI (1) | 0 | — | |||
| 32 (33) | Endometriosis | IVF (7), ICSI (3) | 67.3 | 5 cell | 3 | — | 1 |
| 37 (34) | Tubal factor | ICSI (3) | 80 | ||||
| 39 (31) | Endometriosis | IVF (1), ICSI (3) | 65.7 | 8 cell | 2 | 1 b | — |
| 49 (38) | Unknown | IVF (2), ICSI (2) | 49.8 | — | — | ||
| 52 (31) | Tubal factor | ICSI (1) | 50 | 1 | — | ||
| 54 (32) | Male factor | ICSI (1) | 40 | 1 | 1 | ||
| 56 (34) | Unknown | 0 | — | — | — | ||
| 59 (33) | Unknown | IVF (1), ICSI (1) | 81.5 | — | — | ||
| 62 (40) | Unknown | ICSI (1) | 69 | 1 a | — | ||
| 63 (27) | Male factor | ICSI (2) | 45 | — | — | ||
| 66 (34) | Male factor | 0 | — | — | — | ||
| 67 (37) | Endometriosis | IVF (2) | 33 | — | — | ||
| 79 (30) | Unknown | 0 | — | — | — | ||
| 82 (37) | Endometriosis | IVF (2) | 33 | — | — | ||
| 83 (32) | Male factor | 0 | — | — | — | ||
| 85 (34) | Unknown | 0 | — | — | — | ||
| 87 (32) | Unknown | IVF (1), ICSI (1) | 82 | — | 1 | ||
| 90 (38) | Unknown | 0 | — | — | — |
| Case (age) | Cause of infertility | ART (number) | Fertilized rate (%) | Embryo stage | Embryo grade | Pregnancy (time) | Abortion (time) |
|---|---|---|---|---|---|---|---|
| 7 (46) | Unknown | IVF (1), ICSI (10) | 50.6 | 6 cell | 3 | — | — |
| 16 (34) | Male factor | ICSI (2) | 83.5 | 1 | — | ||
| 26 (38) | Male factor | ICSI (21) | 68.3 | 8 cell | 2 | 1 a | 1 |
| 29 (34) | Tubal factor | IVF(1), ICSI (4) | 77.8 | 9 cell | 2 | — | |
| 30 (36) | Unknown | ICSI (2) | 66.3 | 6 cell | 2 | — | — |
| 31 (40) | Unknown | ICSI (1) | 0 | — | |||
| 32 (33) | Endometriosis | IVF (7), ICSI (3) | 67.3 | 5 cell | 3 | — | 1 |
| 37 (34) | Tubal factor | ICSI (3) | 80 | ||||
| 39 (31) | Endometriosis | IVF (1), ICSI (3) | 65.7 | 8 cell | 2 | 1 b | — |
| 49 (38) | Unknown | IVF (2), ICSI (2) | 49.8 | — | — | ||
| 52 (31) | Tubal factor | ICSI (1) | 50 | 1 | — | ||
| 54 (32) | Male factor | ICSI (1) | 40 | 1 | 1 | ||
| 56 (34) | Unknown | 0 | — | — | — | ||
| 59 (33) | Unknown | IVF (1), ICSI (1) | 81.5 | — | — | ||
| 62 (40) | Unknown | ICSI (1) | 69 | 1 a | — | ||
| 63 (27) | Male factor | ICSI (2) | 45 | — | — | ||
| 66 (34) | Male factor | 0 | — | — | — | ||
| 67 (37) | Endometriosis | IVF (2) | 33 | — | — | ||
| 79 (30) | Unknown | 0 | — | — | — | ||
| 82 (37) | Endometriosis | IVF (2) | 33 | — | — | ||
| 83 (32) | Male factor | 0 | — | — | — | ||
| 85 (34) | Unknown | 0 | — | — | — | ||
| 87 (32) | Unknown | IVF (1), ICSI (1) | 82 | — | 1 | ||
| 90 (38) | Unknown | 0 | — | — | — |
a ICSI pregnancy and birth.
b Spontaneous pregnancy and birth.
We were able to examine whether the aberrant imprint methylation of H19, PEG1 and ZAC that we had identified in the paternal germ cells was transmitted to the infant by carrying out the bisulphite-PCR methylation assays of the seven imprinted loci in DNA obtained from umbilical cord blood from the infant and also in the father's blood (Fig. 2 ). In the amplified region of H19 DMR (AF125183: 7877–8096), both samples were heterozygous for a C/A polymorphism at nucleotide 8008, which allowed us to differentiate between the two parental alleles by bisulphite-PCR sequence. This showed that there was allele-specific DNA methylation and we infer that the paternal H19 allele was methylated. There was no polymorphism in the other amplified regions; however, we observed about half methylated and half unmethylated (or partially demethylated in GTL2 ) templates likely to represent the differentially methylated paternal and maternal alleles both by COBRA and by bisulphite-PCR sequencing. Normal methylation patterns were seen at all the seven DMRs of the imprinted genes and the repetitive elements that we examined in the infant's DNA. These results showed that the abnormal methylation pattern seen in the father's sperm DNA was not inherited by the neonate in this case.
DISCUSSION
Imprint region-specific methylation error in the sperm in infertile patients
The DNA methylation of DMRs associated with imprinted genes is reset with every reproductive cycle. Imprint resetting involves the acquisition of new sex-specific imprints. In humans, ejaculated and mature sperm should be methylated in the paternal DMRs, but unmethylated in the maternal DMRs. We analysed the DNA methylation status of seven DMRs in the ejaculated sperm of men from 97 couples who had undergone infertility treatment. We found 14 samples with abnormal methylation of the paternal DNA methylation at H19 and GTL2 and 20 samples with abnormalities of maternal DMRs at PEG1, LIT1, ZAC, PEG3 and SNRPN . Of these, approximately half of the cases showed abnormalities in both maternal and paternal imprints. The majority of these doubly defective samples were in men with moderate or severe oligospermia. These abnormalities were specific to imprinted loci because we found that global DNA methylation was normal in these samples.
A limited number of studies have been reported on the profile of DNA methylation acquisition of DMRs of the imprinted genes in human adult sperm. Marques et al . reported on the association of the abnormal genomic imprinting of H19 with hypospermatogenesis. The methylation aberration in the CTCF binding site ( 23 ) of the H19 gene was seen in the cases of moderate oligospermia (12.5%) and was seen even more frequently in cases of severe oligospermia (30%), but was not seen in normospermia patients ( 24 ). Our results for H19 were similar to those findings reported. However, the imprint methylation errors were not limited to H19 and were also seen in the normal-appearing sperm.
In mice, H19 , Rasgrf1 and Gtl2 methylation imprints are initiated pre-natally at almost the same time during embryonic germ cell development. We identified the equivalent human DMR of GTL2 , but could not find the human RASGRF1 DMR within in the CpG-rich region analysed. In our sperm analysis, we found incomplete methylation of GTL2 ; normospermia (6.3%) (five of 79 cases), moderate oligospermia (25%) (two of eight cases) and severe oligospermia (50%) (five of 10 cases). These results reveal that abnormal spermatogenesis (leading to low sperm counts) is associated with defective GTL2 methylation. One patient with severe oligospermia, among the 97 patients examined, showed incomplete methylation acquisition in both H19 and GTL2 DMRs. As paternal methylation was absent, the abnormal genomic imprinting could be a result of a change in the DNA methyltransferase activity ( 32 ), and the differences between H19 and GTL2 DMRs may indicate the specificity and sensitivity of each imprinted region.
When we examined the methylation acquisition of the maternally methylated DMRs in the ejaculated sperm, we found that errors were more frequent than those at paternally methylated DMRs. A total of 20 of 97 cases (20.6%) were shown to have abnormal maternal methylation of PEG1, LIT1, ZAC, PEG3 and SNRPN . Our results showed the presence of maternal methylation in cases of normospermia (15.2%) (12 of 79 cases), moderate oligospermia (37.5%) (three of eight cases) and severe oligospermia (50%) (five of 10 cases). The results suggest that abnormal spermatogenesis was associated with a rise in the maternal methylation or a failure in erasure. The presence of abnormal DNA methylation at different maternal DMRs varied between samples in many cases. This may suggest differences in the specificity and sensitivity of each imprinted region. As the global methylation was stable, the DMRs of imprinted genes are more labile and readily changeable. It has been shown that the short tandem repeat elements within the DMRs of some imprinted genes are important for imprinting ( 33 ). We speculate that the degree to which imprinted genes are repeat-like may be one of the factors involved in determining methylation status. However, we cannot test this hypothesis.
The most frequent methylation error was seen in the PEG1 DMR. In our previous report, we showed that demethylation of PEG1 was present in the growing oocytes from superovulated infertile women ( 15 ). This PEG1 DMR may be especially vulnerable to errors. In both humans and mice, the PEG1 DMR spans the promoter, the first exon and part of the first intron and is unmethylated on the active paternal allele ( 34 , 35 ). Paternal transmission of a methylated Peg1 gene results in growth-retarded embryos and increased post-natal death. Abnormal adult maternal behaviour has also been noted in Peg1 -deficient females ( 36 ). A number of imprinted genes have also been shown to play a role in regulating neonatal growth and development (MRC Mammalian Genetics Unit, Harwell, UK, http://www.mgu.har.mrc.ac.uk/research/imprinting/function.html ). In general, ART-treatment babies are characterized by low birth weight. Our work provides further data to suggest that this may be a result of accumulated small changes in DNA methylation at imprinted loci in the sperm and oocytes of infertile couples.
Mechanisms of methylation errors in sperm
Our results showed partial methylation errors in almost all cases. This acquisition of errors had no specificity and showed a scattered distribution in the various imprinted loci. DNA methyltransferases (Dnmts) and methyl-binding domain proteins are probably key regulators in the process of methylation acquisition of the germ cells ( 37–42 ). The Dnmt 3A and 3L knockout female mice were aborted and could not acquire the maternal imprint methylation. In males, the phenotype was oligospermia. In humans with infertility problems, there are no reports as yet that these de novo methylases or associated proteins are lost or mutated. A model based on errors in trafficking of the oocyte isoform of DNMT1 has been proposed to explain the genetics of BWS in monozygotic twins ( 43 ). Recently, Arnaud et al . ( 44 ) showed that a maternal imprint could be acquired in the absence of Dnmt3L in female germ cells. This incomplete penetrance of DNMT3L deficiency was neither locus nor embryo-specific, but instead stochastic, suggesting that in the absence of Dmnt3L, other factors can mark individual DMRs. In addition, natural changes in gene expression levels occur during ageing, such as changes in the expression of Dnmt3 proteins required for the establishment of the germ line imprint ( 41 ), which may, in turn, be due to changes in the endocrine environment.
Outcome of using sperm with abnormal imprint methylation
We found 24 patients whose sperm had abnormal DNA methylation among the sperm samples of men from 97 infertile couples. Although the sample size was relatively limited ( 24 ), the live-birth rates achieved by ICSI technology within this group appeared lower than expected from this technology. Only one sperm sample with both paternal and maternal methylation errors of imprinted genes was successfully used to fertilize an ovum using ICSI and resulted in normal pregnancy. The newborn was normal and did not show any abnormality in the methylation of imprinted genes. There are two possible explanations: one is that the fertilizing sperm prepared using ICSI was a rare sperm with a normal DNA methylation pattern and the other is that the methylation abnormalities reverted to normal after fertilization. We cannot distinguish between these two possibilities. However, we are now analysing the methylation status of imprinted genes in the DNA of the abortion products resulting from fertilization with other sperm sample shown to have with abnormal DNA methylation patterns. This may allow us to partially resolve this question.
In addition to general growth abnormalities, many imprint methylation errors also lead to the occurrence of various cancers ( 45 , 46 ). Although our study examined a limited number of imprinted genes, our data, and those of others, strongly support the need for further research in this area. A retrospective examination of children born after each ART method focusing on imprinted genes would also be valuable in determining the safest and most ethical approach to use.
MATERIALS AND METHODS
Sperm collection
The ejaculated sperm samples were collected from the male partner of 97 infertile couples who had consulted a physician at St Luke Clinic. Routine semen analysis (volume, counting, rates of motility and occupied acrozorm) was performed. Motile sperm cells were purified away from lymphocyte contamination, immature germ cells and epithelial cells in using the swim-up method ( 47 ). Of the 97 patients, 79 showed a normal sperm count (>20 × 10 6 /ml). The remaining 18 patients had oligospermia (10 cases had severe oligospermia). The study was performed after obtaining patients' consent and with approval of the institutional Ethics Committee. The sperm were washed repeatedly and placed in phosphate-buffered saline and DNA was obtained by using a standard extraction method with the addition of 0.1 m m 2-mercaptoethanol ( 48 ). Normal human leukocyte DNA was used as a control.
Bisulphite treatment PCR
The methylation assay was performed at the DMRs of seven imprinted genes [ H19 , GTL2 , PEG1 ( MEST ), LIT1 ( KCNQ1OT1 ), ZAC ( PLAGL1 ), PEG3 and SNRPN ] in humans using the COBRA and sequencing technique ( 19 ). Each sperm DNA sample was treated with sodium bisulphite using an EZ DNA Methylation Kit (Zymo Research, Orange, CA) and amplified by PCR as follows: a PCR reaction mix containing 0.5 µ m of each of the four following primer sets, 200 µ m dNTPs, 1 × PCR buffer, 1.25 U of EX Taq Hot Start DNA Polymerase (Takara Bio, Tokyo, Japan) in a total volume of 20 µl was used. The following PCR programme was used for PEG1 and LIT1 : 1 min of denaturation at 94°C followed by 35 cycles of 30 s at 94°C, 30 s at 60°C and 30 s at 72°C and a final extension for 5 min at 72°C. In the case of H19 and SNRPN , semi-nested PCR was carried out as DNA input for 1 µl of the first-round PCR product with the same first-round PCR condition. The PCR conditions for GTL2 , ZAC and PEG3 were described previously ( 49–51 ). The region analysed for each of these genes was within the DMR of CpG islands. We examined 18 CpG sites in a 220 bp fragment of H19 (AF125183: 7877–8096), 15 CpG sites in a 259 bp fragment of GTL2 (AL117190: 51004–51262), 22 CpG sites in a 219 bp fragment of PEG1 (Y10620: 609–827), 26 CpG sites in a 307 bp fragment of LIT1 (U90095: 67252–67558), 19 CpG sites in a 152 bp fragment of ZAC (AL109755: 52735–52886), 33 CpG sites in a 322 bp fragment of PEG3 (AC006115: 163172–163493) and 21 CpG sites in a 240 bp fragment of SNRPN (U41384: 15256–15495). These are summarized in Table 3 .
Sequences of primers using the bisulphite-PCR analyses
| Gene | Primer sequence (5′–3′) | Size (bp) | Number of CpG sites | References | |
|---|---|---|---|---|---|
| Paternally methylated genes | |||||
| H19 a | F1: | AGGTGTTTTAGTTTTATGGATGATGG | 220 | 18 | |
| F2: | TATATGGGTATTTTTGGAGGTTTTT | ||||
| R1: | ATAAATATCCTATTCCCAAATAACCCC | ||||
| GTL2 | F: | GGGTTGGGTTTTGTTAGTTGTT | 259 | 15 | Kawakami et al . ( 49 ) |
| R: | CCAATTACAATACCACAAAATTAC | ||||
| Maternally methylated genes | |||||
| PEG1 | F: | TYGTTGTTGGTTAGTTTTGTAYGGTT | 219 | 22 | |
| R: | CCCAAAAACAACCCCAACTC | ||||
| LIT1 | F: | TTTTGGTAGGATTTTGTTGAGGAGT | 307 | 26 | |
| R: | CCTCACACCCAACCAATACCTC | ||||
| ZAC | F: | GGGGTAGTYGTGTTTATAGTTTAGTA | 152 | 19 | Kamikihara et al . ( 50 ) |
| R: | CRAACACCCAAACACCTACCCTA | ||||
| PEG3 | F: | AAAAGGTATTAATTATTTATAGTTTGGT | 322 | 33 | El-Maarri et al . ( 51 ) |
| R: | AAAAATATCCACCCTAAACTAATAA | ||||
| SNRPN a | F1: | GTGTTGTGGGGTTTTAGGGGTTTAG | 240 | 21 | |
| F2: | AGGGAGTTGGGATTTTTGTATTG | ||||
| R1: | CTCCCCAAACTATCTCTTAAAAAAAACC | ||||
| Non-imprinted genes | |||||
| LINE-1 | F: | TTGAGTTGTGGTGGGTTTTATTTAG | 413 | 28 | Yang et al . ( 52 ) |
| R: | TCATCTCACTAAAAAATACCAAACA | ||||
| Alu | F: | GATCTTTTTATTAAAAATATAAAAATTAGT | 152 | 12 | Yang et al . ( 52 ) |
| R: | GATCCCAAACTAAAATACAATAA | ||||
| Gene | Primer sequence (5′–3′) | Size (bp) | Number of CpG sites | References | |
|---|---|---|---|---|---|
| Paternally methylated genes | |||||
| H19 a | F1: | AGGTGTTTTAGTTTTATGGATGATGG | 220 | 18 | |
| F2: | TATATGGGTATTTTTGGAGGTTTTT | ||||
| R1: | ATAAATATCCTATTCCCAAATAACCCC | ||||
| GTL2 | F: | GGGTTGGGTTTTGTTAGTTGTT | 259 | 15 | Kawakami et al . ( 49 ) |
| R: | CCAATTACAATACCACAAAATTAC | ||||
| Maternally methylated genes | |||||
| PEG1 | F: | TYGTTGTTGGTTAGTTTTGTAYGGTT | 219 | 22 | |
| R: | CCCAAAAACAACCCCAACTC | ||||
| LIT1 | F: | TTTTGGTAGGATTTTGTTGAGGAGT | 307 | 26 | |
| R: | CCTCACACCCAACCAATACCTC | ||||
| ZAC | F: | GGGGTAGTYGTGTTTATAGTTTAGTA | 152 | 19 | Kamikihara et al . ( 50 ) |
| R: | CRAACACCCAAACACCTACCCTA | ||||
| PEG3 | F: | AAAAGGTATTAATTATTTATAGTTTGGT | 322 | 33 | El-Maarri et al . ( 51 ) |
| R: | AAAAATATCCACCCTAAACTAATAA | ||||
| SNRPN a | F1: | GTGTTGTGGGGTTTTAGGGGTTTAG | 240 | 21 | |
| F2: | AGGGAGTTGGGATTTTTGTATTG | ||||
| R1: | CTCCCCAAACTATCTCTTAAAAAAAACC | ||||
| Non-imprinted genes | |||||
| LINE-1 | F: | TTGAGTTGTGGTGGGTTTTATTTAG | 413 | 28 | Yang et al . ( 52 ) |
| R: | TCATCTCACTAAAAAATACCAAACA | ||||
| Alu | F: | GATCTTTTTATTAAAAATATAAAAATTAGT | 152 | 12 | Yang et al . ( 52 ) |
| R: | GATCCCAAACTAAAATACAATAA | ||||
a Hemi-nested PCRs were carried out in these regions. F1 and R1 were used for first PCR and F2 and R1 were used for second PCR.
Sequences of primers using the bisulphite-PCR analyses
| Gene | Primer sequence (5′–3′) | Size (bp) | Number of CpG sites | References | |
|---|---|---|---|---|---|
| Paternally methylated genes | |||||
| H19 a | F1: | AGGTGTTTTAGTTTTATGGATGATGG | 220 | 18 | |
| F2: | TATATGGGTATTTTTGGAGGTTTTT | ||||
| R1: | ATAAATATCCTATTCCCAAATAACCCC | ||||
| GTL2 | F: | GGGTTGGGTTTTGTTAGTTGTT | 259 | 15 | Kawakami et al . ( 49 ) |
| R: | CCAATTACAATACCACAAAATTAC | ||||
| Maternally methylated genes | |||||
| PEG1 | F: | TYGTTGTTGGTTAGTTTTGTAYGGTT | 219 | 22 | |
| R: | CCCAAAAACAACCCCAACTC | ||||
| LIT1 | F: | TTTTGGTAGGATTTTGTTGAGGAGT | 307 | 26 | |
| R: | CCTCACACCCAACCAATACCTC | ||||
| ZAC | F: | GGGGTAGTYGTGTTTATAGTTTAGTA | 152 | 19 | Kamikihara et al . ( 50 ) |
| R: | CRAACACCCAAACACCTACCCTA | ||||
| PEG3 | F: | AAAAGGTATTAATTATTTATAGTTTGGT | 322 | 33 | El-Maarri et al . ( 51 ) |
| R: | AAAAATATCCACCCTAAACTAATAA | ||||
| SNRPN a | F1: | GTGTTGTGGGGTTTTAGGGGTTTAG | 240 | 21 | |
| F2: | AGGGAGTTGGGATTTTTGTATTG | ||||
| R1: | CTCCCCAAACTATCTCTTAAAAAAAACC | ||||
| Non-imprinted genes | |||||
| LINE-1 | F: | TTGAGTTGTGGTGGGTTTTATTTAG | 413 | 28 | Yang et al . ( 52 ) |
| R: | TCATCTCACTAAAAAATACCAAACA | ||||
| Alu | F: | GATCTTTTTATTAAAAATATAAAAATTAGT | 152 | 12 | Yang et al . ( 52 ) |
| R: | GATCCCAAACTAAAATACAATAA | ||||
| Gene | Primer sequence (5′–3′) | Size (bp) | Number of CpG sites | References | |
|---|---|---|---|---|---|
| Paternally methylated genes | |||||
| H19 a | F1: | AGGTGTTTTAGTTTTATGGATGATGG | 220 | 18 | |
| F2: | TATATGGGTATTTTTGGAGGTTTTT | ||||
| R1: | ATAAATATCCTATTCCCAAATAACCCC | ||||
| GTL2 | F: | GGGTTGGGTTTTGTTAGTTGTT | 259 | 15 | Kawakami et al . ( 49 ) |
| R: | CCAATTACAATACCACAAAATTAC | ||||
| Maternally methylated genes | |||||
| PEG1 | F: | TYGTTGTTGGTTAGTTTTGTAYGGTT | 219 | 22 | |
| R: | CCCAAAAACAACCCCAACTC | ||||
| LIT1 | F: | TTTTGGTAGGATTTTGTTGAGGAGT | 307 | 26 | |
| R: | CCTCACACCCAACCAATACCTC | ||||
| ZAC | F: | GGGGTAGTYGTGTTTATAGTTTAGTA | 152 | 19 | Kamikihara et al . ( 50 ) |
| R: | CRAACACCCAAACACCTACCCTA | ||||
| PEG3 | F: | AAAAGGTATTAATTATTTATAGTTTGGT | 322 | 33 | El-Maarri et al . ( 51 ) |
| R: | AAAAATATCCACCCTAAACTAATAA | ||||
| SNRPN a | F1: | GTGTTGTGGGGTTTTAGGGGTTTAG | 240 | 21 | |
| F2: | AGGGAGTTGGGATTTTTGTATTG | ||||
| R1: | CTCCCCAAACTATCTCTTAAAAAAAACC | ||||
| Non-imprinted genes | |||||
| LINE-1 | F: | TTGAGTTGTGGTGGGTTTTATTTAG | 413 | 28 | Yang et al . ( 52 ) |
| R: | TCATCTCACTAAAAAATACCAAACA | ||||
| Alu | F: | GATCTTTTTATTAAAAATATAAAAATTAGT | 152 | 12 | Yang et al . ( 52 ) |
| R: | GATCCCAAACTAAAATACAATAA | ||||
a Hemi-nested PCRs were carried out in these regions. F1 and R1 were used for first PCR and F2 and R1 were used for second PCR.
To confirm that the sequencing results did not reflect a cloning bias, restriction analysis (COBRA) was carried out on germ cell and somatic cell DNA, cutting the DNA with enzymes that could cleave only the methylated templates of the same bisulphite-treated PCR samples. PCR products of each DMR were then digested with the enzyme Taq I for H19, GTL2 , PEG1 , LIT1 , ZAC , PEG3 and SNRPN , with Mlu I for H19 , with Nru I for GTL2 and with Mbo I for PEG1 , so that the undigested and digested products indicated unmethylated and methylated templates, respectively, and electrophoresed on a 2.5% agarose gel. If the unmethylated bands were seen in H19 and GTL2 paternally imprinted genes or the methylated bands were seen in PEG1 , LIT1 , ZAC , PEG3 and SNRPN maternally imprinted genes, each gene was quantified with Lumiimager analyser and Lumianalyst software package (Roche Diagnostics, Basel, Switzerland), and the percentage of methylated restriction enzyme site in each genomic sample was calculated from the ratio between the enzyme-cleaved PCR products and the total amount of PCR products. The PCR products were purified and cloned into the pGEM-T vector (Promega, Madison, WI, USA), and individual clones were sequenced using M13 reverse primer and an automated ABI Prism 3130xl Genetic Analyser (Applied Biosystems, Foster city, CA, USA). An average of 20 clones was sequenced for each individual. The repetitive sequences ( LINE1 and Alu ) were also examined using the same methods. The PCR conditions were previously described ( 52 ) and the restriction enzymes used were Hin fI and Mbo I, respectively. At least two separate sodium modification treatments were carried out for each DNA sample and at least three independent amplification experiments were performed for each individual examined.
Statistical analysis
Two proportions were used to analyse the observed data using the difference between two proportions test (STATISTICA, StatSoft, Tokyo, Japan). P -values less than 0.05 were considered significant.
SUPPLEMENTARY MATERIAL
Supplementary Material is available at HMG Online.
FUNDING
This work was supported by a grant from the Ministry of Health and Welfare of Japan (19390423 and 19791131), Suzuken Memorial Foundation, Akaeda Medical Research Foundation and Smoking Research Foundation (T.A.), a grant-in-aid from Kurokawa Cancer Research Foundation, Scientific Research on Priority Areas from the Ministry of Education, Science and Culture, Japan, the Ministry of Health, Labour and Welfare, Japan and 21st Century COE Program Special Research Grant (Tohoku University) from the Ministry of Education Science, Sports and Culture, Japan (N.Y.).
ACKNOWLEDGEMENTS
We would like to thank Miss M. Nasu for technical assistance and all the members of our laboratory for their support and valuable suggestions. In particular, we thank Dr R. John for comments on the manuscript.
Conflict of Interest statement . No conflicts of interest were reported by the investigators.
