Abstract

Contiguous gene syndromes affecting the mitochondrial oxidative phosphorylation system have been rarely reported. Here, we describe a patient with apparent mitochondrial encephalomyopathy accompanied by several unusual features, including dysmorphism and hepatopathy, caused by a homozygous triple gene deletion on chromosome 5. The deletion encompassed the NDUFAF2, ERCC8 and ELOVL7 genes, encoding complex I assembly factor 2 (also known as human B17.2L), a protein of the transcription-coupled nucleotide excision repair (TC-NER) machinery, and a putative elongase of very long-chain fatty acid synthesis, respectively. Detailed evaluation of cultured skin fibroblasts revealed disturbed complex I assembly, depolarization of the mitochondrial membrane, elevated cellular NAD(P)H level, increased superoxide production and defective TC-NER. ELOVL7 mRNA was not detectable in these cells and no alterations in fatty acid synthesis were found. By means of baculoviral complementation we were able to restore the aberrations, thereby establishing causative links between genotype and cell-physiological phenotype. This first chromosomal microdeletion illustrates that beside primary defects in mitochondrial genes also additional genes possibly contribute to the disease phenotype, providing an additional explanation for the broad clinical symptoms associated with these disorders.

INTRODUCTION

Contiguous gene syndromes are rare disorders characterized by apparently unrelated clinical signs and symptoms, which are caused by deletion of two or more genes that are adjacent to one another on a chromosome. Each of the individual genes involved may give rise to distinct clinical and biochemical features. Numerous examples of such syndromes have been described in literature (1–5). Investigation of these disorders on the molecular level offers unique insights into the function of affected genes and their relation to the disease phenotype.

To date, contiguous gene syndromes affecting mitochondrial oxidative phosphorylation (OXPHOS) have been rarely reported (6). Disturbances of the OXPHOS system are the cause of a broad spectrum of disorders that are often referred to as mitochondrial encephalomyopathies because of the prominent involvement of the nervous system and striated muscle (7). With an incidence of one in 5000 live births, OXPHOS disorders are among the most frequent inborn errors of metabolism (8). The OXPHOS system comprises five membrane-bound multiprotein complexes (complex I–V) and two mobile electron carriers that transfer electrons from NADH and succinate to molecular oxygen. Simultaneously, protons are translocated across the mitochondrial inner membrane; thereby creating a membrane potential, which is the driving force of ATP production. Complex I (CI), or NADH:ubiquinone oxidoreductase (ENZYME, EC 1.6.5.3), represents the main entry point of the OXPHOS system, as it initiates electron transfer by oxidizing NADH. In mammals, CI consists of 45 subunits of which seven are encoded by the mitochondrial DNA (mtDNA) and 38 by the nuclear genome (9). Dysfunction of CI is accountable for several severe disorders with variable onset, ranging from infancy to late adulthood. So far, disease-causing mutations have been found in each of the seven mtDNA-encoded subunits and in 12 of the nuclear genes encoding structural components of CI (10–12). In addition, mutations in genes encoding proteins that are required for CI assembly were recently implicated in severe childhood disorders (13–17).

A possible explanation for the rare implication of OXPHOS defects in contiguous gene syndromes might be that OXPHOS deficiencies may result in variable and often severe clinical manifestations, affecting different age groups and involving different organs and tissues. Therefore, characteristic constellations of symptoms and anomalies may be under-recognized. In addition, mutations in nuclear structural genes of CI are usually associated with devastating clinical phenotypes (e.g. Leigh syndrome or fatal infantile lactic acidosis) resulting in early death, and accordingly, the involvement of other genes with less severe clinical manifestations may be overshadowed (18). To date, no contiguous gene syndromes associated with isolated CI deficiency are known. In this report, we describe a girl who presented with an apparent mitochondrial encephalomyopathy accompanied by several abnormal dysmorphic features and hepatopathy, which was caused by a homozygous triple gene deletion on chromosome 5. The deletion encompassed the NDUFAF2 gene (GenBank accession no. NM_174889), encoding CI assembly factor 2, the ERCC8 gene (GenBank accession no. NM_000082), involved in the transcription-coupled nucleotide excision repair (TC-NER) pathway, and ELOVL7 (GenBank accession no. NM_024930), a member of the elongase [ELOVL: elongation of very long-chain fatty acids (VLCFA)] gene family. We investigated the consequences of the lack of chaperone NDUFAF2 for the biogenesis and functioning of the OXPHOS system and established downstream alterations in mitochondrial physiology. Moreover, we confirmed Cockayne syndrome type A (CS-A; MIM 216400) deficiency, as a result of the ERCC8 deletion, by the analysis of the NER system. No specific alterations in fatty acid synthesis as a consequence of the ELOVL7 deletion could be determined in the patient's fibroblasts, which can easily be explained by the lack of any detectable ELOVL7 expression in healthy human fibroblasts.

RESULTS

Enzyme activity measurements of OXPHOS complexes

Spectroscopy measurement of the enzyme activities of all five OXPHOS complexes revealed a significant decrease for CI in the patient's fibroblasts (45% of lowest control value), whereas all other complexes (CII–V) showed normal values (Table 1).

Table 1.

OXPHOS enzyme activities in fibroblasts

Enzyme activitiesa Activity (Reference range) 
Complex I 49 (110–260) 
Complex II 871 (536–1027) 
Complex III 2170 (1270–2620) 
Complex II+III (Succ:cyt c oxidoreductase; SCC) 189 (160–440) 
Complex IV (Cytochrome c oxidase) 801 (680–1190) 
Complex V (ATP synthase) 421 (209–935) 
Citrate synthase 250 (144–257) 
Enzyme activitiesa Activity (Reference range) 
Complex I 49 (110–260) 
Complex II 871 (536–1027) 
Complex III 2170 (1270–2620) 
Complex II+III (Succ:cyt c oxidoreductase; SCC) 189 (160–440) 
Complex IV (Cytochrome c oxidase) 801 (680–1190) 
Complex V (ATP synthase) 421 (209–935) 
Citrate synthase 250 (144–257) 

aEnzyme activities are expressed in mU/mU COX except for complex IV, which is expressed in mU/mU CS, and citrate synthase (CS), which is expressed in mU/mg protein. COX and CS levels were normal in the patient. Enzymatic activities were measured in triplicate in at least two independent patient-derived samples.

Complex I deficiency confirmed by decreased amounts of fully assembled complex I

To investigate the CI deficiency on protein level, mitochondrial fractions of the patient and healthy control fibroblasts were subjected to Blue Native-polyacrylamide gel electrophoresis (BN-PAGE) analysis by means of an in-gel activity assay and western blotting using antibodies directed against CI–III (Fig. 1A). The patient's fibroblasts showed a severe decrease in both CI activity and protein amount when compared with two control fibroblasts cell lines, whereas normal control levels were shown for CII and CIII. Furthermore, sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) analysis of these fractions revealed significant decreases in the protein levels of CI subunits NDUFS3, NDUFA9 and NDUFB6, as well as CI assembly factor NDUFAF1, whereas a relatively mild decrease was observed for the subunit NDUFS2 (Fig. 1B). Strikingly, no protein was detected at all for the CI assembly factor NDUFAF2 in the patient's fibroblasts. In contrast, normal NDUFAF2 protein levels were observed for two CI-deficient patients with unknown mutations. In addition, all patients showed normal levels of subunit SDHA of CII.

Figure 1.

Blue native (BN)- and sodium dodecyl sulfate (SDS)–polyacrylamide gel electrophoresis (PAGE) analysis of patient and control fibroblasts. (A) One-dimensional BN-PAGE shows a decrease in fully assembled Complex I activity and protein amount for the index patient (P(del)) in duplicate, compared with control fibroblasts (C1 and C2). Subunits against which the antibodies are used are depicted in brackets. (B) SDS–PAGE shows decreased levels of CI subunits in the patient and a total lack of assembly chaperone NDUFAF2. Two CI-deficient patients with unknown mutations are also shown (lanes 2 and 3). IGA: in-gel activity assay.

Figure 1.

Blue native (BN)- and sodium dodecyl sulfate (SDS)–polyacrylamide gel electrophoresis (PAGE) analysis of patient and control fibroblasts. (A) One-dimensional BN-PAGE shows a decrease in fully assembled Complex I activity and protein amount for the index patient (P(del)) in duplicate, compared with control fibroblasts (C1 and C2). Subunits against which the antibodies are used are depicted in brackets. (B) SDS–PAGE shows decreased levels of CI subunits in the patient and a total lack of assembly chaperone NDUFAF2. Two CI-deficient patients with unknown mutations are also shown (lanes 2 and 3). IGA: in-gel activity assay.

Mutational analysis

Extensive mutational analysis performed on the patient, i.e. screening for mtDNA rearrangements (deletions, insertions or duplications) and common mtDNA point mutations, and screening of all 38 nuclear genes and seven mitochondrial ND genes encoding the 45 CI subunits for mutations, did not reveal the molecular defect. Because NDUFAF2 protein was undetectable, we investigated the corresponding NDUFAF2 mRNA sequence. Analysis of polymerase chain reaction (PCR) amplification of cDNA derived from the patient's fibroblasts did not reveal a PCR product for the NDUFAF2 sequence, suggesting a destabilized mRNA, promoter mutation or gene deletion. Subsequent PCR amplification of the patient's genomic DNA failed to retrieve the NDUFAF2 gene, indicating a (total) gene deletion. PCR analysis using specific primer sets in regions surrounding the NDUFAF2 gene, led to the detection of a homozygous deletion of approximately 450 kb on chromosome 5. The location was refined by direct sequencing using chromosome map markers at 5q12.1 ranging from nucleotide 60,082,769 to 60,530,221 (UCSC Genome Browser, March 2006 assembly). This deletion encompassed the full sequence of three known genes, i.e. ELOVL7 (60,083,373–60,175,858; minus strand), ERCC8 (60,205,416–60,276,662; minus strand) and NDUFAF2 (69,276,713–60,484,621; plus strand). Single polymorphism microarray analysis revealed no major chromosomal rearrangements other than the described deletion in this patient. Screening of genomic DNA, isolated from blood samples of the clinically unaffected patient's relatives, revealed that both parents, two brothers and a sister were heterozygous for the deletion.

Complementation of the complex I defect with wild-type NDUFAF2

To prove the pathogenicity of the NDUFAF2 deletion, functional complementation of the CI defect was carried out by means of baculoviral transduction of patient and healthy control fibroblasts with constructs expressing either green fluorescent protein (GFP)-tagged NDUFAF2 protein or COX8 leader peptide fused to GFP. BN-PAGE analysis of mitochondrial fractions at 3 days after transduction revealed full restoration of CI activity and protein amount in the index patient's cells transduced with the NDUFAF2-GFP virus (Fig. 2A). In contrast, no change was observed in the patient's cells transduced with the COX8-GFP virus or in either NDUFAF2-GFP or COX8-GFP transduced healthy control cells. In addition, protein levels of CII and CIII remained unaffected. Importantly, two other CI-deficient patient cell lines, bearing mutations in the NDUFS4 or NDUFS7 gene, showed no changes in CI activity or CI protein amount—or the 830-kDa subcomplex of CI, which is normally observed in NDUFS4 patients—following transduction with NDUFAF2-GFP, demonstrating the specificity of the complementation.

Figure 2.

Complementation of the Complex I (CI) defect with wild-type NDUFAF2. (A) Blue Native-polyacrylamide gel electrophoresis analysis of transduction of patient and control fibroblasts with baculoviral constructs encoding either wild-type GFP-tagged NDUFAF2, or GFP targeted to mitochondria by the COX8 leader peptide. CI activity as well as protein amount have specifically been restored to normal control levels for the index patient (P(del)) upon NDUFAF2 transduction when compared with transduction with COX8-GFP. Healthy control fibroblasts (C1 and C2) show no changes in CI activity and protein amount after transduction with wild-type NDUFAF2. The CI defect in patients with mutations in the NDUFS4 (P(S4)) and NDUFS7 (P(S7)) subunits cannot be complemented by wild-type NDUFAF2. Levels of CII and CIII remain unaffected upon transduction in each cell line. Subunits against which the antibodies are used are depicted in brackets. (B) SDS–PAGE analysis of expression of NDUFAF2-GFP and COX8-GFP constructs in patient and control fibroblasts using polyclonal anti-EGFP antibody. untr: untransduced; AF2: NDUFAF2-GFP transduced; COX8: COX8-GFP transduced; 830 kD: 830-kDa subcomplex of CI; IGA: in-gel activity assay.

Figure 2.

Complementation of the Complex I (CI) defect with wild-type NDUFAF2. (A) Blue Native-polyacrylamide gel electrophoresis analysis of transduction of patient and control fibroblasts with baculoviral constructs encoding either wild-type GFP-tagged NDUFAF2, or GFP targeted to mitochondria by the COX8 leader peptide. CI activity as well as protein amount have specifically been restored to normal control levels for the index patient (P(del)) upon NDUFAF2 transduction when compared with transduction with COX8-GFP. Healthy control fibroblasts (C1 and C2) show no changes in CI activity and protein amount after transduction with wild-type NDUFAF2. The CI defect in patients with mutations in the NDUFS4 (P(S4)) and NDUFS7 (P(S7)) subunits cannot be complemented by wild-type NDUFAF2. Levels of CII and CIII remain unaffected upon transduction in each cell line. Subunits against which the antibodies are used are depicted in brackets. (B) SDS–PAGE analysis of expression of NDUFAF2-GFP and COX8-GFP constructs in patient and control fibroblasts using polyclonal anti-EGFP antibody. untr: untransduced; AF2: NDUFAF2-GFP transduced; COX8: COX8-GFP transduced; 830 kD: 830-kDa subcomplex of CI; IGA: in-gel activity assay.

Complex I assembly profile

More insight in the CI assembly profile of the index patient can be achieved by subjecting first dimension BN-PAGE-separated complexes to second dimension SDS–PAGE (two-dimensional BN/SDS–PAGE) followed by western blotting and immunodetection with CI antibodies (Fig. 3). Disturbance of CI assembly in the patient was demonstrated by the accumulation of low-molecular weight CI subcomplexes, containing subunits NDUFS2, NDUFS3 (sub 2–5), and ND1 (sub 4, 5), which correspond to CI assembly intermediates 2, 3, 4 and 5 of the model for human mitochondrial CI assembly proposed by Vogel et al. (19). The accumulation of a high-molecular weight subcomplex containing subunits NDUFB6 and ND1 was also more pronounced in the patient when compared with control fibroblasts. This subcomplex corresponds to the ‘appearing subcomplex’ a1 of the model. In addition, there was a decrease in NDUFAF1 associated with the approximately 500-kDa complex, which was described before in CI-deficient patients with mutations in structural complex I subunits (20). As expected, no change in CIV was observed with anti-COXII antibody.

Figure 3.

Complex I assembly profile of patient and control fibroblasts. Two-dimensional Blue Native (BN)-/sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) shows accumulation of low-molecular weight subcomplexes 1–5 in the index patient's fibroblasts (P(del)) and a decrease in the NDUFAF1-containing complex (see asterisk), compared with control fibroblasts (C2). Subcomplexes have been numbered according to the human CI assembly pathway model described before (19). Accumulation of ‘appearing subcomplex 1’ (a1) is also more pronounced for the patient. Normal levels of COXII demonstrate undisturbed CIV assembly.

Figure 3.

Complex I assembly profile of patient and control fibroblasts. Two-dimensional Blue Native (BN)-/sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) shows accumulation of low-molecular weight subcomplexes 1–5 in the index patient's fibroblasts (P(del)) and a decrease in the NDUFAF1-containing complex (see asterisk), compared with control fibroblasts (C2). Subcomplexes have been numbered according to the human CI assembly pathway model described before (19). Accumulation of ‘appearing subcomplex 1’ (a1) is also more pronounced for the patient. Normal levels of COXII demonstrate undisturbed CIV assembly.

Lack of NDUFAF2 alters mitochondrial physiology and function

To investigate the effects of the CI deficiency on mitochondrial physiology, several cell-physiological parameters were measured in control and patient fibroblasts. The first parameter, mitochondrial membrane potential, is tightly linked to accurate functioning of complex I. Microscopic analysis of the mitochondrial accumulation of fluorescent tetramethyl rhodamine methyl ester (TMRM), as an estimate of mitochondrial membrane potential, revealed a significant decrease in fibroblasts of the index patient compared with healthy control fibroblasts, indicative of depolarization of the mitochondrial membrane (Fig. 4A) (21). Depolarization was also measured for cells of the CI-deficient NDUFS7 patient. Strikingly, transduction with the NDUFAF2-GFP virus almost completely restored TMRM accumulation in the cells of the index patient, whereas no significant effect could be observed for the NDUFS7 patient.

Figure 4.

Measurement of mitochondrial membrane potential, cellular NAD(P)H and cellular superoxide levels. Measurements were performed on patient and control fibroblasts that remained untransduced or had been transduced with the NDUFAF2-GFP baculoviral construct. Measurements of all transduced and untransduced patient cells have been normalized to the average values of the corresponding transduced and untransduced healthy control cells, respectively. (A) Mitochondrial membrane potential of patient [P(del), n = 68; P(S7), n = 31] and control (C1, n = 58) fibroblasts was estimated from the average measured TMRM fluorescence pixel intensity. Wild-type NDUFAF2 almost completely restores membrane potential to normal control levels (C1, n = 55) in the index patient [P(del), n = 87], whereas no significant effect can be observed for the complex I-deficient NDUFS7 patient [P(S7), n = 82]. (B) Cellular NAD(P)H levels of patient [P(del), n = 34; P(S2), n = 57] and control (C1, n = 57) fibroblasts were measured as average NAD(P)H autofluorescence intensity. NAD(P)H levels have significantly been reduced in the index patient (P(del), n = 84) upon NDUFAF2-GFP transduction, but have not been changed for an NDUFS2 patient [P(S2), n = 59]. Control: C1, n = 44. (C) Cellular superoxide levels of patient [P(del), n = 130; P(S7), n = 89] and control fibroblasts (C1, n = 388) were measured as rates of HEt oxidation. The levels of superoxide production have significantly been reduced in the index patient [P(del), n = 145] upon NDUFAF2-GFP transduction, but have not been changed for the NDUFS7 patient [P(S7), n = 157]. Control: C1, n = 215. P-values <0.01 (double-asterisks) and <0.001 (triple-asterisks) were considered significantly different from corresponding control.

Figure 4.

Measurement of mitochondrial membrane potential, cellular NAD(P)H and cellular superoxide levels. Measurements were performed on patient and control fibroblasts that remained untransduced or had been transduced with the NDUFAF2-GFP baculoviral construct. Measurements of all transduced and untransduced patient cells have been normalized to the average values of the corresponding transduced and untransduced healthy control cells, respectively. (A) Mitochondrial membrane potential of patient [P(del), n = 68; P(S7), n = 31] and control (C1, n = 58) fibroblasts was estimated from the average measured TMRM fluorescence pixel intensity. Wild-type NDUFAF2 almost completely restores membrane potential to normal control levels (C1, n = 55) in the index patient [P(del), n = 87], whereas no significant effect can be observed for the complex I-deficient NDUFS7 patient [P(S7), n = 82]. (B) Cellular NAD(P)H levels of patient [P(del), n = 34; P(S2), n = 57] and control (C1, n = 57) fibroblasts were measured as average NAD(P)H autofluorescence intensity. NAD(P)H levels have significantly been reduced in the index patient (P(del), n = 84) upon NDUFAF2-GFP transduction, but have not been changed for an NDUFS2 patient [P(S2), n = 59]. Control: C1, n = 44. (C) Cellular superoxide levels of patient [P(del), n = 130; P(S7), n = 89] and control fibroblasts (C1, n = 388) were measured as rates of HEt oxidation. The levels of superoxide production have significantly been reduced in the index patient [P(del), n = 145] upon NDUFAF2-GFP transduction, but have not been changed for the NDUFS7 patient [P(S7), n = 157]. Control: C1, n = 215. P-values <0.01 (double-asterisks) and <0.001 (triple-asterisks) were considered significantly different from corresponding control.

Besides depolarization of the mitochondrial membrane, increase in NAD(P)H level is another hallmark of CI dysfunction (22). Measurement of NAD(P)H autofluorescence revealed a marked increase in fibroblasts of the index patient compared with healthy control fibroblasts and was considerably higher than in cells of an NDUFS2 patient (Fig. 4B). After NDUFAF2-GFP transduction, NAD(P)H autofluorescence almost completely normalized in cells of the index patient, but not in cells of the NDUFS2 patient.

A third common feature of fibroblasts harboring CI deficiency is increased superoxide production, which was determined by quantification of fluorescent hydroethidine (HEt) oxidation products (23). Fibroblasts of the index patient demonstrated remarkably high superoxide levels compared with healthy control cells and cells of the NDUFS7 patient (Fig. 4C). Again, a nearly complete restoration was observed for the index patient after transduction with the NDUFAF2-GFP virus, whereas transduction did not affect superoxide levels in the NDUFS7 patient.

Investigation of the nucleotide excision repair mechanism

The ERCC8 gene is essential for TC-NER of UV-induced DNA damage and is typically defective in patients with Cockayne syndrome belonging to complementation group A (CS-A; MIM 216400) (24,25). Since the ERCC8 gene is located in the deleted area, fibroblasts of the index patient were subjected to NER analysis. Fibroblasts displayed lowered TC-NER and normal global genome (GG)-NER activities when compared with healthy control fibroblasts after exposure to UV radiation (Fig. 5A), indicating defective TC-NER but proficient GG-NER. Analysis of cellular survival after exposure to increasing UV doses revealed a UV sensitivity of the index patient's cells that is characteristic of CS-A patients (Fig. 5B). Importantly, after fusion with a known Cockayne syndrome type B (CS-B; MIM 133540) cell strain (defective in the ERCC6 gene), but not with a CS-A strain, RNA synthesis rates of all heterokaryons were restored to normal levels, proving that the TC-NER defect could be complemented by CS-B cells, but not by cells from a CS-A patient. These repair parameters in combination with the genetic complementation analysis unequivocally demonstrate an ERCC8/CSA defect in fibroblasts of the index patient.

Figure 5.

Nucleotide excision repair (NER) analysis of patient and control fibroblasts after exposure to UV radiation. (A) NER activities of the index patient have been expressed as percentages of UV-exposed healthy control cells tested in the same experiment. Global genome NER (GG) was measured autoradiographically as ‘unscheduled DNA synthesis’ and transcription-coupled (TC) NER by recovery of overall RNA synthesis after UV exposure as described elsewhere (24). (B) Overall cell survival after exposure to graded UV doses (25). Proliferative activity of patient and control fibroblasts after UV exposure has been expressed as a percentage of unirradiated cells. The UV-survival curve of the index patient matches the curve of a known CSA patient. NER: nucleotide excision repair.

Figure 5.

Nucleotide excision repair (NER) analysis of patient and control fibroblasts after exposure to UV radiation. (A) NER activities of the index patient have been expressed as percentages of UV-exposed healthy control cells tested in the same experiment. Global genome NER (GG) was measured autoradiographically as ‘unscheduled DNA synthesis’ and transcription-coupled (TC) NER by recovery of overall RNA synthesis after UV exposure as described elsewhere (24). (B) Overall cell survival after exposure to graded UV doses (25). Proliferative activity of patient and control fibroblasts after UV exposure has been expressed as a percentage of unirradiated cells. The UV-survival curve of the index patient matches the curve of a known CSA patient. NER: nucleotide excision repair.

Analysis of fatty acid levels

Proteins belonging to the ELOVL family are required for the first reaction in the elongation cycle of VLCFA synthesis (26,27). To examine the effect of the deletion of the ELOVL7 gene on fatty acid biosynthesis, endogenous levels of saturated (C14:0–C28:0), mono-unsaturated (C18:1–C28:1) and poly-unsaturated (omega-3 and omega-6 series) fatty acids were determined in fibroblasts of the index patient, of two healthy control cell lines, and of four complex I-deficient patient cell lines with mutations in the NDUFAF2, NDUFS4 (two cell lines) and NDUFS7 genes. No differences could be observed in fatty acid levels between patient and control fibroblasts. To establish whether this could be owing to a low expression level of ELOVL7 in human fibroblasts, we performed PCR analysis using mRNA derived from a neuroblastoma cell line (SK-N-BE(2)c) as a positive control. This revealed that ELOVL7 is highly expressed in SK-N-BE(2)c cells, but not in human primary fibroblasts (S. Kemp, unpublished data).

DISCUSSION

We describe a patient with an unusual mitochondrial clinical presentation, including dysmorphic features, a generalized CNS involvement and lipid storage in the liver. Almost 20 years after the unclear death of the index patient we could finally make a diagnosis. The disease was caused by a homozygous triple gene deletion encompassing the genes NDUFAF2, ERCC8 and ELOVL7. This first report of a homozygous chromosomal microdeletion associated with a mitochondrial phenotype and isolated complex I deficiency, allowed us to investigate the consequences of each gene in this deleted region for the molecular mechanisms of cellular metabolism in which they exert their functions, and evaluate their possible contribution to the unique phenotype of the index patient.

Based on the early-onset encephalomyopathy with lactic acidemia, disturbance of the OXPHOS system was believed to play a major role in the pathology of the index patient. Indeed, enzyme activity measurements revealed a severe CI deficiency and subsequent screening of candidate genes revealed the absence of NDUFAF2. Further characterization of this gene disclosed the microdeletion of a region encompassing the genes ERCC8 and ELOVL7. So far, the complex I assembly factor NDUFAF2 has been implied in complex I deficiency in three patients described (13,28). To establish the contribution of chaperone NDUFAF2 on the disturbance of CI assembly, we performed baculoviral expression of wild-type NDUFAF2. NDUFAF2-GFP recombinant protein specifically restored protein amount and in-gel activity of fully assembled CI in the patient's fibroblasts. This illustrates that, as may be expected, the NDUFAF2 gene is solely responsible for the CI deficiency in these cells. Further characterization of the complex I assembly status in the patient's fibroblasts by two-dimensional BN-SDS electrophoresis revealed that the amount of fully assembled CI is severely reduced but not completely absent. This proves that assembly of CI is not entirely prevented by the complete lack of NDUFAF2 protein and demonstrates that the residual CI activity in described patients with a point mutation (13,28) is unlikely caused by small amounts of (truncated) NDUFAF2 protein. Consistent with the findings of Ogilvie and colleagues (13), we demonstrate accumulation of 380- and 480-kDa CI subcomplexes [subcomplex 4 and 5 (see Fig. 3)] in the absence of NDUFAF2 and using different antibodies we allowed to observe the accumulation of other early assembly intermediates, subcomplex 2 and 3 (Fig. 3) of the human CI assembly pathway model (19). In addition to the report of NDUFAF2 association with an 830-kDa CI subcomplex in certain patients (13), our preliminary experiments revealed that NDUFAF2-GFP also specifically associates with this 830-kDa subcomplex in healthy control fibroblasts but not with smaller subcomplexes (R. Janssen, unpublished data). These results are in line with a chaperone role for NDUFAF2 in a late stage of the CI assembly process, possibly by catalyzing an assembly step or by stabilizing an assembly intermediate, as has been argued before (13,29).

OXPHOS dysfunction has been demonstrated to have evident effects on several aspects of mitochondrial and cellular functioning, including mitochondrial membrane potential, cellular NAD(P)H levels and cellular superoxide production (30,31). All three parameters were altered in fibroblasts of the index patient, demonstrating the consequences of the NDUFAF2 deletion for cell metabolism. Importantly, all alterations could be restored upon baculoviral complementation with wild-type NDUFAF2, while no recovery was observed in fibroblasts of CI-deficient patients with mutations in the NDUFS7 or NDUFS2 subunits. These findings clearly establish the pathogenicity of the NDUFAF2 deletion for impaired CI functioning and disturbed cellular physiology in our index patient.

The ERCC8 gene encodes a protein involved in DNA repair and mutations of the gene cause CS-A. In mammalian cells, various DNA repair systems exist in order to cope with attacks of endogenous and environmental genotoxic agents on their genomes. One of them is the nucleotide excision repair (NER) pathway, a complex system that removes chemically and UV-induced helix-distorting lesions. The TC-NER subpathway is a mechanism that specifically removes transcription-blocking lesions from the transcribed strands of actively transcribed genes (24,25). CS-A, a rare autosomal recessive disorder characterized by UV sensitivity, severe neurological abnormalities, and progeriod symptoms, is caused by mutations in the ERCC8 gene, which encodes the CS-A protein that is part of the core of the TC-NER machinery (32). CS is primarily characterized by mild cutaneous photosensitivity, postnatal growth failure, progressive neurological dysfunction and symptoms reminiscent of segmental accelerated ageing. This progressive disorder generally manifests at 1–2 years of age and results in death at puberty or early adulthood (32,33). In addition to this classic CS, called type I, there is a less common early-onset form of CS, called type II, with more severe symptoms that are already present at birth. Moreover, CS may be associated with additional clinical features, including microcephaly, retinal degeneration, deafness and skeletal abnormalities such as osteoporosis and a bird-like face (32,33). In fibroblasts of our index patient, we clearly demonstrated the presence of the distinct repair defect of CS patients. Against this background, some of the symptoms, such as microcephaly, reduced birth weight, facial dysmorphia and dry skin, may well be compatible with CS type II. However, we cannot dismiss the possibility that the patient's early demise at 14 months prevented any clear typical signs associated with the more common CS type I to become manifest. Finally, the option of an interaction between CS and the phenotypes associated with the other gene defects remains fully open.

The ELOVL7 gene encodes a putative elongase of VLCFA synthesis and has not been linked with pathogenic mutations and/or deletions before. In mammals, fatty acids consisting of up to 16 carbons in length, which are synthesized by the cytosolic fatty acid synthase complex, as well as fatty acids taken up from the diet, are further elongated into long-chain fatty acids containing up to 20 carbon atoms, and/or into VLCFAs with over 20 carbon atoms (26). Synthesis of VLCFAs takes place at the cytoplasmic side of the endoplasmic reticulum (ER) and involves four successive enzymatic steps, which are carried out by individual membrane-bound proteins. The first regulatory reaction step in the elongation cycle, the condensation of a fatty acyl-CoA and malonyl-CoA, is the rate-limiting step, and is performed by members of the ELOVL protein family. To date, seven enzymes, elongases termed ELOVL1-7, have been identified in mammals and are suggested to perform the condensation reaction in the elongation cycle (26,27). The substrate specificity for all of the seven ELOVL proteins has not been determined yet, and mutations of the ELOVL7 gene have not been reported before.

Importantly, PCR analysis did not reveal any detectable expression of the ELOVL7 gene in human skin fibroblasts. In addition, no significant differences in fatty acid synthesis were observed between the index patient, healthy control subjects and CI-deficient patients with single mutations in the NDUFS4 and NDUFS7 subunits. Considering the tissue specificity of the ELOVL family members, it is plausible that ELOVL7 does not have a function in skin fibroblasts, but exerts its function, and consequently displays its defect, in other tissues. For instance, the apparent lipid inclusions observed in the ER of a liver biopsy of the patient could be indicative of disturbance of fatty acid metabolism, which could mean a possible involvement of the ELOVL7 deletion in the pathology. This hypothesis is supported by the observation of Ikeda et al. (34) that ELOVL7 has a preference for interaction with 3-hydroxyacyl-CoA dehydratase 3 (HACD3), another enzyme of the elongation cycle, which exhibits a remarkably high expression in liver. Unfortunately, since the patient was examined many years ago, there is no material left to perform additional liver function studies.

In conclusion, we present here a unique case of deletion of three genes with distinct functions, in which all three possibly contribute to the pathology of the patient. Involvement on the cell-physiological level was demonstrated for NDUFAF2 and ERCC8 by complementing the defects in their individual biochemical pathways, whereas involvement of the ELOVL7 deletion can be presumed.

From a medical perspective it is a difficult task to establish distinct genotype–phenotype correlations for each of the three deleted genes. It is quite plausible that the most severe defect with the earliest onset of symptoms and the fastest progression might overshadow the clinical features of the defects with a later onset and slower progression. Nevertheless, it seems striking that the clinical presentation of our patient was distinctively different from the three other reported patients with defects in NDUFAF2 (13,28). These children were born at term, had an uneventful perinatal course and did not show any dysmorphic features. Onset of first symptoms ranged from 8 months to 3 years and included respiratory irregularities, muscular hypotonia, ataxia and nystagmus. On MRI, all patients had characteristic symmetric lesions in the mamillothalamic tracts, substantia nigra/medial lemniscus, medial longitudinal fasciculus, the corpus medullare and the cerebellum, with relative sparing of the cortex and subcortical white matter. Although we do not have brain MRI images in our index patient, the clinical features and the autopsy results show clear differences compared with these findings (for details see case report). Especially, the dysmorphic features, the more severe and generalized CNS involvement with spongiform demyelination of the white matter and the lipid storage in the liver might indicate the involvement of additional factors beyond a purely mitochondrial disease. These findings have two important implications. First, considering the broad clinical spectrum of mitochondrial disorders and the discrepancy in symptoms among patients with the same gene defects, it should be kept in mind that additional gene defects may be present next to the main mitochondrial defect and influence the clinical outcome. Especially, when consanguinity is involved as is the case for many mitochondrial patients. Secondly, despite the presence of atypical features, still mitochondrial OXPHOS defects should be considered as a genetic cause.

MATERIALS AND METHODS

Case report

The girl was the second child of healthy consanguineous parents (first cousins) of Pakistani (Moslem) descent. Family history was unremarkable (one older sister and two younger brothers not affected). Prenatal ultrasound screening revealed intrauterine growth retardation. The patient was born at 38 weeks of gestation by caesarean section. Birth weight was 1.815 kg (approximately 0.5 kg < third percentile), length 45 cm (approximately 1 cm < third percentile) and head circumference 31 cm (approximately 0.5 cm < third percentile). APGAR scores were 6/8/10. Postpartally, the girl appeared dysmature and developed respiratory distress. Apart from microcephaly, several abnormal features including long philtrum, micrognathia, low-set ears and unusually dry skin were noted. Laboratory investigations revealed elevated levels of lactate (2.5–3.4 mmol/L; normal range 0.6–1.8) and alanine in blood (1046 µmol/L; normal range <450). Urine screening was normal, except for increased alanine excretion. Cranial ultrasound and a computed tomography scan of the brain detected no obvious pathology. Abdominal ultrasound demonstrated hepatomegaly. Opthalamological examinations at age 10 days and 2 months revealed small eye slits and bulbi. In addition, hypermetropia was suspected. Fundus examination was reported to be normal. The further clinical course of the patient was characterized by severe developmental delay, failure to thrive, progressive microcephaly, growth retardation, hepatomegaly, myoclonic epilepsy, pyramidal signs and spasticity. The girl repeatedly developed aspiration pneumonias and finally died at the age of 14 months owing to cardiorespiratory failure. Autopsy revealed severe, spongiform demyelination of the white matter, which was most pronounced in the occipital region and the cerebellum. Investigation of liver tissue demonstrated hepatic steatosis and electron microscopy (EM) studies revealed abnormally swollen mitochondria and inclusions of granular material in the ER, possibly accumulations of lipids. Moreover, accumulation of secondary lysomosomes around the sinusoides was observed. Histological evaluation of muscle tissue showed few small atrophic fibers, but was otherwise normal. No ragged red fibers or cytochrome c oxidase-negative fibers were seen. However, also in this tissue, ultrastructural studies by EM demonstrated swollen mitochondria.

Cell culture and OXPHOS enzyme activity measurements

Fibroblasts were obtained from skin biopsies according to the relevant institutional review boards and cultured in medium 199 with Earle's salt (M199; Invitrogen) supplemented with 10% (v/v) fetal bovine serum (Greiner Bio-One), penicillin and streptomycin (Invitrogen) in a humidified atmosphere of 95% air and 5% CO2 at 37°C. Measurement of OXPHOS enzyme activities in skin fibroblasts and muscle tissue were performed as described previously (35).

Sodium dodecyl sulfate- and blue native-polyacrylamide gel electrophoresis and western blotting

SDS- and BN-PAGE of mitochondria-enriched fractions was performed as described previously (36). Briefly, 20 and 40 µg of mitochondrial protein was loaded on 10% polyacrylamide gels for SDS–PAGE and 5–15% polyacrylamide gradient gels for BN-PAGE, respectively. For second dimension SDS–PAGE, first dimension BN-PAGE lanes were excised and placed on top of a 10% polyacrylamide SDS-gel and run as described previously (36). SDS- and BN-gels were subjected to western blotting using nitrocellulose membranes (Schleicher and Schuell). Immunodetection was performed using antibodies directed against CI subunits NDUFA9 (Invitrogen), NDUFB6 (MitoSciences), NDUFS2 (Professor B. Robinson, Toronto), NDUFS3 (Invitrogen) and ND1 (Dr A. Lombes, Paris), CII subunit SDHA (Invitrogen), CIII subunit Core2 (Invitrogen), CIV subunit COXII (Invitrogen) and CI assembly chaperones NDUFAF1 [our laboratory; (37)] and NDUFAF2 (Professor M. Tsuneoka, Kurume). Peroxidase-conjugated anti-mouse and anti-rabbit IgGs (Invitrogen) were used as secondary antibodies. Signals were generated by means of ECL plus (Amersham Biosciences) and autoradiography.

Complex I in-gel activity measurement

CI in-gel activity was detected as NADH:nitrotetrazolium blue oxidoreductase activity by incubation of BN-gels in the presence of 0.15 mm NADH (Roche), 3 mm nitrotetrazolium blue chloride (NTB; Sigma–Aldrich) and 2 mm Tris–HCl (Sigma–Aldrich) at pH 7.4, for 1 h protected from light (38).

RNA isolation, PCR amplification, DNA sequencing and genome-wide single nucleotide polymorphism microarray

Total DNA and mRNA was isolated from fibroblasts and blood samples according to standard procedures. cDNA was obtained by reverse transcriptase-polymerase chain reaction (RT-PCR) of mRNA according to the manufacturer's protocol (Promega) and subsequently amplified by PCR with a primer set encompassing the total NDUFAF2 mRNA sequence (GenBank accession no. NM_174889; forward (5′→3′) CTGGAGCATTACCCCTACTGCG, reverse (5′→3′) TAGTCACATCCATATACATGAAAAG). PCR products were cycle-sequenced using the ABI Prism BigDye Terminator v3.1 Cycle Sequencing Ready Reaction Kit (Applied Biosystems) and analyzed by a 3130xl Genetic Analyzer (Applied Biosystems), according to the manufacturer's protocol. Genome-wide single nucleotide polymorphism microarray was performed using Affymetrix 500kSNP microarrays as described elsewhere (39).

Cloning of baculoviral constructs and generation of recombinant baculoviruses

The cDNA sequences of the coding region of the NDUFAF2 gene and the mitochondrial targeting sequence of the gene encoding subunit VIII of cytochrome c oxidase (COX8) were cloned into a pFastBacTMDual vector (Invitrogen), modified for the expression of proteins in mammalian cells, behind a cytomegalovirus promoter and adjacent to a c-terminal GFP-tag sequence as described before (40). The obtained baculoviral vector constructs were used to generate infectious recombinant baculoviruses by site-specific transposon-mediated insertion into a baculovirus genome (bacmid) propagated in Escherichia coli cells. Isolated recombinant bacmids were used to infect Spodoptera frugiperda 9 (Sf9) insect cells for amplification of viruses.

Transduction of complex I-deficient fibroblasts with baculoviral constructs

Fibroblasts, cultured in 25-cm2 tissue culture flasks to approximately 70% confluence were transduced with the appropriate baculovirus (virus titer: 3 × 107) at a multiplicity of infection of approximately 10 in a total volume of 1.6 ml M199 for 3 h at 37°C. After incubation, the virus-containing medium was discarded and replaced by normal growth medium. The next day, 5 mm sodium butyrate (Sigma–Aldrich) was added to the medium to enhance protein expression and 3 days after transduction cells were harvested.

Fluorescence microscopy of TMRM, NAD(P)H and HEt oxidation products

For microscopy analysis of TMRM (Invitrogen) fluorescence, NAD(P)H autofluorescence and hydroethidine (HEt, Molecular Probes) oxidation product fluorescence, fibroblasts, cultured on glass coverslips (Ø 24 mm) to approximately 70% confluence, were incubated with the appropriate dye and imaged with an Axiovert 200M inverted microscope (Carl Zeiss) equipped with a 40 × /1.3 NA (HEt oxidation products and NAD(P)H) or a 63 × /1.25 NA (TMRM) Plan NeoFluar objective (Carl Zeiss), as described previously (21–23). All measurements were performed in HEPES-Tris medium (132 mm NaCl, 4.2 mm KCl, 1 mm CaCl2, 1 mm MgCl2, 5.5 mmd-glucose and 10 mm HEPES at pH 7.4) at 37°C. Quantification of fluorescence intensities was performed as described before (21–23,31,41). In each experiment, the average value obtained with control cells was set at 100%, to which all other values were related. Values from multiple experiments were expressed as means ± SEM. Statistical significance (Bonferroni-corrected) was assessed using Student's t-test.

Nucleotide excision repair assays

TC-NER and GG-NER activities of cultured fibroblasts after exposure to germicidal UV-C rays were assayed using standard autoradiographic methods described elsewhere (42) and expressed as a percentage of the activities of UV-exposed normal control cells. Overall cell survival was routinely assayed by global incorporation of tritiated thymidine 4 days after exposure to graded UV doses (43). Standard complementation analysis was performed as described before (42). Fibroblast strains were preloaded with distinct types of cytoplasmic beads and fused using inactivated Sendai virus. After appropriate incubation time, the mixture of unfused cells and fused multikaryons was exposed to UV radiation and assayed for activities of TC-NER and GG-NER.

Measurement of very long-chain fatty acid levels

Total cellular fatty acids were analyzed using the electrospray ionization mass spectrometry (ESI-MS) method described previously (44).

FUNDING

This work has been supported by The Netherlands Organization for Scientific Research (NWO; grant numbers: 901-03-156 and 016.086.328), the European Leukodystrophy Association (ELA: 2006-031I4) and by the European Union's 6th Framework Programme, Priority 1 ‘Life Sciences, Genomics and Biotechnology for Health’ (contract no. LSHM-CT-2004-503116, entitled EUMITOCOMBAT).

Conflict of Interest statement: The authors state that there is no conflict of interest.

ACKNOWLEDGEMENTS

The authors would like to thank Professor Makato Tsuneoka (Kurume University School of Medicine, Kurume, Japan) for providing anti-NDUFAF2 antibody and Dr Rolph Pfundt (Department of Human Genetics, Radboud University Nijmegen Medical Centre, Nijmegen, the Netherlands) for performing the molecular karyotyping.

REFERENCES

1
Greenberg
F.
Guzzetta
V.
Montes
d.O.-L.
Magenis
R.E.
Smith
A.C.
Richter
S.F.
Kondo
I.
Dobyns
W.B.
Patel
P.I.
Lupski
J.R.
Molecular analysis of the Smith-Magenis syndrome: a possible contiguous-gene syndrome associated with del(17)(p11.2)
Am. J. Hum. Genet.
 , 
1991
, vol. 
49
 (pg. 
1207
-
1218
)
2
Cassidy
S.B.
Dykens
E.
Williams
C.A.
Prader-Willi and Angelman syndromes: sister imprinted disorders
Am. J. Med. Genet.
 , 
2000
, vol. 
97
 (pg. 
136
-
146
)
3
Cardoso
C.
Leventer
R.J.
Ward
H.L.
Toyo-Oka
K.
Chung
J.
Gross
A.
Martin
C.L.
Allanson
J.
Pilz
D.T.
Olney
A.H.
, et al.  . 
Refinement of a 400-kb critical region allows genotypic differentiation between isolated lissencephaly, Miller-Dieker syndrome, and other phenotypes secondary to deletions of 17p13.3
Am. J. Hum. Genet.
 , 
2003
, vol. 
72
 (pg. 
918
-
930
)
4
Tassabehji
M.
Williams-Beuren syndrome: a challenge for genotype-phenotype correlations
Hum. Mol. Genet.
 , 
2003
, vol. 
12
 
Spec no. 2
(pg. 
R229
-
R237
)
5
Kobrynski
L.J.
Sullivan
K.E.
Velocardiofacial syndrome, DiGeorge syndrome: the chromosome 22q11.2 deletion syndromes
Lancet
 , 
2007
, vol. 
370
 (pg. 
1443
-
1452
)
6
Parvari
R.
Brodyansky
I.
Elpeleg
O.
Moses
S.
Landau
D.
Hershkovitz
E.
A recessive contiguous gene deletion of chromosome 2p16 associated with cystinuria and a mitochondrial disease
Am. J. Hum. Genet.
 , 
2001
, vol. 
69
 (pg. 
869
-
875
)
7
Smeitink
J.
van den Heuvel
L.
DiMauro
S.
The genetics and pathology of oxidative phosphorylation
Nat. Rev. Genet.
 , 
2001
, vol. 
2
 (pg. 
342
-
352
)
8
Skladal
D.
Halliday
J.
Thorburn
D.R.
Minimum birth prevalence of mitochondrial respiratory chain disorders in children
Brain
 , 
2003
, vol. 
126
 (pg. 
1905
-
1912
)
9
Carroll
J.
Fearnley
I.M.
Skehel
J.M.
Shannon
R.J.
Hirst
J.
Walker
J.E.
Bovine complex I is a complex of 45 different subunits
J. Biol. Chem.
 , 
2006
, vol. 
281
 (pg. 
32724
-
32727
)
10
Janssen
R.J.
Nijtmans
L.G.
van den Heuvel
L.P.
Smeitink
J.A.
Mitochondrial complex I: structure, function and pathology
J. Inherit. Metab. Dis.
 , 
2006
, vol. 
29
 (pg. 
499
-
515
)
11
Fernandez-Moreira
D.
Ugalde
C.
Smeets
R.
Rodenburg
R.J.
Lopez-Laso
E.
Ruiz-Falco
M.L.
Briones
P.
Martin
M.A.
Smeitink
J.A.
Arenas
J.
X-linked NDUFA1 gene mutations associated with mitochondrial encephalomyopathy
Ann. Neurol.
 , 
2007
, vol. 
61
 (pg. 
73
-
83
)
12
Berger
I.
Hershkovitz
E.
Shaag
A.
Edvardson
S.
Saada
A.
Elpeleg
O.
Mitochondrial complex I deficiency caused by a deleterious NDUFA11 mutation
Ann. Neurol.
 , 
2008
, vol. 
63
 (pg. 
405
-
408
)
13
Ogilvie
I.
Kennaway
N.G.
Shoubridge
E.A.
A molecular chaperone for mitochondrial complex I assembly is mutated in a progressive encephalopathy
J. Clin. Invest.
 , 
2005
, vol. 
115
 (pg. 
2784
-
2792
)
14
Dunning
C.J.
McKenzie
M.
Sugiana
C.
Lazarou
M.
Silke
J.
Connelly
A.
Fletcher
J.M.
Kirby
D.M.
Thorburn
D.R.
Ryan
M.T.
Human CIA30 is involved in the early assembly of mitochondrial complex I and mutations in its gene cause disease
EMBO J.
 , 
2007
, vol. 
26
 (pg. 
3227
-
3237
)
15
Saada
A.
Edvardson
S.
Rapoport
M.
Shaag
A.
Amry
K.
Miller
C.
Lorberboum-Galski
H.
Elpeleg
O.
C6ORF66 is an assembly factor of mitochondrial complex I
Am. J. Hum. Genet.
 , 
2008
, vol. 
82
 (pg. 
32
-
38
)
16
Pagliarini
D.J.
Calvo
S.E.
Chang
B.
Sheth
S.A.
Vafai
S.B.
Ong
S.E.
Walford
G.A.
Sugiana
C.
Boneh
A.
Chen
W.K.
, et al.  . 
A mitochondrial protein compendium elucidates complex I disease biology
Cell
 , 
2008
, vol. 
134
 (pg. 
112
-
123
)
17
Sugiana
C.
Pagliarini
D.J.
McKenzie
M.
Kirby
D.M.
Salemi
R.
bu-Amero
K.K.
Dahl
H.H.
Hutchison
W.M.
Vascotto
K.A.
Smith
S.M.
, et al.  . 
Mutation of C20orf7 disrupts complex I assembly and causes lethal neonatal mitochondrial disease
Am. J. Hum. Genet.
 , 
2008
, vol. 
83
 (pg. 
468
-
478
)
18
Loeffen
J.L.
Smeitink
J.A.
Trijbels
J.M.
Janssen
A.J.
Triepels
R.H.
Sengers
R.C.
van den Heuvel
L.P.
Isolated complex I deficiency in children: clinical, biochemical and genetic aspects
Hum. Mutat.
 , 
2000
, vol. 
15
 (pg. 
123
-
134
)
19
Vogel
R.O.
Dieteren
C.E.
van den Heuvel
L.P.
Willems
P.H.
Smeitink
J.A.
Koopman
W.J.
Nijtmans
L.G.
Identification of mitochondrial complex I assembly intermediates by tracing tagged NDUFS3 demonstrates the entry point of mitochondrial subunits
J. Biol. Chem.
 , 
2007
, vol. 
282
 (pg. 
7582
-
7590
)
20
Vogel
R.O.
van den Brand
M.A.
Rodenburg
R.J.
van den Heuvel
L.P.
Tsuneoka
M.
Smeitink
J.A.
Nijtmans
L.G.
Investigation of the complex I assembly chaperones B17.2L and NDUFAF1 in a cohort of CI deficient patients
Mol. Genet. Metab.
 , 
2007
, vol. 
91
 (pg. 
176
-
182
)
21
Distelmaier
F.
Koopman
W.J.
Testa
E.R.
de Jong
A.S.
Swarts
H.G.
Mayatepek
E.
Smeitink
J.A.
Willems
P.H.
Life cell quantification of mitochondrial membrane potential at the single organelle level
Cytometry A
 , 
2008
, vol. 
73
 (pg. 
129
-
138
)
22
Verkaart
S.
Koopman
W.J.
Cheek
J.
van Emst-de Vries
S.E.
van den Heuvel
L.W.
Smeitink
J.A.
Willems
P.H.
Mitochondrial and cytosolic thiol redox state are not detectably altered in isolated human NADH:ubiquinone oxidoreductase deficiency
Biochim. Biophys. Acta
 , 
2007
, vol. 
1772
 (pg. 
1041
-
1051
)
23
Verkaart
S.
Koopman
W.J.
van Emst-de Vries
S.E.
Nijtmans
L.G.
van den Heuvel
L.W.
Smeitink
J.A.
Willems
P.H.
Superoxide production is inversely related to complex I activity in inherited complex I deficiency
Biochim. Biophys. Acta
 , 
2007
, vol. 
1772
 (pg. 
373
-
381
)
24
Troelstra
C.
van Gool
A.
de Wit
J.
Vermeulen
W.
Bootsma
D.
Hoeijmakers
J.H.
ERCC6, a member of a subfamily of putative helicases, is involved in Cockayne's syndrome and preferential repair of active genes
Cell
 , 
1992
, vol. 
71
 (pg. 
939
-
953
)
25
de Waard
H.
de Wit
J.
Andressoo
J.O.
van Oostrom
C.T.
Riis
B.
Weimann
A.
Poulsen
H.E.
van Steeg
H.
Hoeijmakers
J.H.
van der Horst
G.T.
Different effects of CSA and CSB deficiency on sensitivity to oxidative DNA damage
Mol. Cell Biol.
 , 
2004
, vol. 
24
 (pg. 
7941
-
7948
)
26
Jakobsson
A.
Westerberg
R.
Jacobsson
A.
Fatty acid elongases in mammals: their regulation and roles in metabolism
Prog. Lipid Res.
 , 
2006
, vol. 
45
 (pg. 
237
-
249
)
27
Denic
V.
Weissman
J.S.
A molecular caliper mechanism for determining very long-chain fatty acid length
Cell
 , 
2007
, vol. 
130
 (pg. 
663
-
677
)
28
Barghuti
F.
Elian
K.
Gomori
J.M.
Shaag
A.
Edvardson
S.
Saada
A.
Elpeleg
O.
The unique neuroradiology of complex I deficiency due to NDUFA12L defect
Mol. Genet. Metab.
 , 
2008
, vol. 
94
 (pg. 
78
-
82
)
29
Lazarou
M.
McKenzie
M.
Ohtake
A.
Thorburn
D.R.
Ryan
M.T.
Analysis of the assembly profiles for mitochondrial- and nuclear-DNA-encoded subunits into complex I
Mol. Cell. Biol.
 , 
2007
, vol. 
27
 (pg. 
4228
-
4237
)
30
Vogel
R.O.
Janssen
R.J.
van den Brand
M.A.
Dieteren
C.E.
Verkaart
S.
Koopman
W.J.
Willems
P.H.
Pluk
W.
van den Heuvel
L.P.
Smeitink
J.A.
Nijtmans
L.G.
Cytosolic signaling protein Ecsit also localizes to mitochondria where it interacts with chaperone NDUFAF1 and functions in complex I assembly
Genes Dev.
 , 
2007
, vol. 
21
 (pg. 
615
-
624
)
31
Hoefs
S.J.
Dieteren
C.E.
Distelmaier
F.
Janssen
R.J.
Epplen
A.
Swarts
H.G.
Forkink
M.
Rodenburg
R.J.
Nijtmans
L.G.
Willems
P.H.
, et al.  . 
NDUFA2 complex I mutation leads to Leigh disease
Am. J. Hum. Genet.
 , 
2008
, vol. 
82
 (pg. 
1306
-
1315
)
32
Nance
M.A.
Berry
S.A.
Cockayne syndrome: review of 140 cases
Am. J. Med. Genet.
 , 
1992
, vol. 
42
 (pg. 
68
-
84
)
33
Andressoo
J.O.
Hoeijmakers
J.H.
Transcription-coupled repair and premature ageing
Mutat. Res.
 , 
2005
, vol. 
577
 (pg. 
179
-
194
)
34
Ikeda
M.
Kanao
Y.
Yamanaka
M.
Sakuraba
H.
Mizutani
Y.
Igarashi
Y.
Kihara
A.
Characterization of four mammalian 3-hydroxyacyl-CoA dehydratases involved in very long-chain fatty acid synthesis
FEBS Lett.
 , 
2008
, vol. 
582
 (pg. 
2435
-
2440
)
35
Smeitink
J.
Sengers
R.
Trijbels
F.
van den Heuvel
L.
Human NADH:ubiquinone oxidoreductase
J. Bioenerg. Biomembr.
 , 
2001
, vol. 
33
 (pg. 
259
-
266
)
36
Calvaruso
M.A.
Smeitink
J.
Nijtmans
L.
Electrophoresis techniques to investigate defects in oxidative phosphorylation
Methods
 , 
2008
, vol. 
46
 (pg. 
281
-
287
)
37
Vogel
R.O.
Janssen
R.J.
Ugalde
C.
Grovenstein
M.
Huijbens
R.J.
Visch
H.J.
van den Heuvel
L.P.
Willems
P.H.
Zeviani
M.
Smeitink
J.A.
Nijtmans
L.G.
Human mitochondrial complex I assembly is mediated by NDUFAF1
FEBS J.
 , 
2005
, vol. 
272
 (pg. 
5317
-
5326
)
38
Nijtmans
L.G.
Henderson
N.S.
Holt
I.J.
Blue Native electrophoresis to study mitochondrial and other protein complexes
Methods
 , 
2002
, vol. 
26
 (pg. 
327
-
334
)
39
McMullan
D.J.
Bonin
M.
Hehir-Kwa
J.Y.
de Vries
B.B.
Dufke
A.
Rattenberry
E.
Steehouwer
M.
Moruz
L.
Pfundt
R.
de Leeuw
N.
, et al.  . 
Molecular karyotyping of patients with unexplained mental retardation by SNP arrays: a multicenter study
Hum. Mutat.
 , 
2009
 
Epub ahead of print
40
Visch
H.J.
Rutter
G.A.
Koopman
W.J.
Koenderink
J.B.
Verkaart
S.
de Groot
T.
Varadi
A.
Mitchell
K.J.
van den Heuvel
L.P.
Smeitink
J.A.
Willems
P.H.
Inhibition of mitochondrial Na+-Ca2+ exchange restores agonist-induced ATP production and Ca2+ handling in human complex I deficiency
J. Biol. Chem.
 , 
2004
, vol. 
279
 (pg. 
40328
-
40336
)
41
Komen
J.C.
Distelmaier
F.
Koopman
W.J.
Wanders
R.J.
Smeitink
J.
Willems
P.H.
Phytanic acid impairs mitochondrial respiration through protonophoric action
Cell Mol. Life Sci.
 , 
2007
, vol. 
64
 (pg. 
3271
-
3281
)
42
Jaspers
N.G.
Raams
A.
Silengo
M.C.
Wijgers
N.
Niedernhofer
L.J.
Robinson
A.R.
Giglia-Mari
G.
Hoogstraten
D.
Kleijer
W.J.
Hoeijmakers
J.H.
Vermeulen
W.
First reported patient with human ERCC1 deficiency has cerebro-oculo-facio-skeletal syndrome with a mild defect in nucleotide excision repair and severe developmental failure
Am. J. Hum. Genet.
 , 
2007
, vol. 
80
 (pg. 
457
-
466
)
43
Jaspers
N.G.
Raams
A.
Kelner
M.J.
Ng
J.M.
Yamashita
Y.M.
Takeda
S.
McMorris
T.C.
Hoeijmakers
J.H.
Anti-tumour compounds illudin S and Irofulven induce DNA lesions ignored by global repair and exclusively processed by transcription- and replication-coupled repair pathways
DNA Repair (Amst)
 , 
2002
, vol. 
1
 (pg. 
1027
-
1038
)
44
Valianpour
F.
Selhorst
J.J.
van Lint
L.E.
van Gennip
A.H.
Wanders
R.J.
Kemp
S.
Analysis of very long-chain fatty acids using electrospray ionization mass spectrometry
Mol. Genet. Metab.
 , 
2003
, vol. 
79
 (pg. 
189
-
196
)

Author notes

The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors.