Abstract

Arthrogryposis multiplex congenita (AMC) is a group of disorders characterized by congenital joint contractures caused by reduced fetal movements. AMC has an incidence of 1 in 3000 newborns and is genetically heterogeneous. We describe an autosomal recessive form of myogenic AMC in a large consanguineous family. The disease is characterized by bilateral clubfoot, decreased fetal movements, delay in motor milestones, then progressive motor decline after the first decade. Genome-wide linkage analysis revealed a single locus on chromosome 6q25 with Zmax = 3.55 at θ = 0.0 and homozygosity of the polymorphic markers at this locus in patients. Homozygous A to G nucleotide substitution of the conserved AG splice acceptor site at the junction of intron 136 and exon 137 of the SYNE-1 gene was found in patients. This mutation results in an aberrant retention of intron 136 of SYNE-1 RNA leading to premature stop codons and the lack of the C-terminal transmembrane domain KASH of nesprin-1, the SYNE-1 gene product. Mice lacking the KASH domain of nesprin-1 display a myopathic phenotype similar to that observed in patients. Altogether, these data strongly suggest that the splice site mutation of SYNE-1 gene found in the family is responsible for AMC. Recent reports have shown that mutations of the SYNE-1 gene might be responsible for autosomal recessive adult onset cerebellar ataxia. These data indicate that mutations of nesprin-1 which interacts with lamin A/C may lead to at least two distinct human disease phenotypes, myopathic or neurological, a feature similar to that found in laminopathies.

INTRODUCTION

The common factor causing congenital arthrogryposis is lack of or decreased fetal movements in utero. The condition varies in its clinical presentation, etiology and pathogenesis. AMC can be secondary to a myopathic process, a neurogenic process affecting either the central or the peripheral nervous system, connective tissue disorders, mechanical or maternal illness (1). The etiology and pathogenesis of congenital contractures remain unclear in the majority of cases, most of which are sporadic.

Here, we describe a two-generation consanguineous family with arthrogryposis. Genome-wide linkage analysis revealed a single locus on chromosome 6q25. A mutation of the conserved AG splice acceptor site at the junction of intron 136 and exon 137 of the SYNE-1 gene was found in patients. This mutation leads to premature stop codons and the lack of the C-terminal transmembrane domain KASH of nesprin-1. Recently, mice carrying a homozygous deletion of the C terminus of nesprin-1, encoded by the SYNE-1 gene, were generated (2). Mutant mice exhibit lethality, with half dying at or near birth from respiratory failure. Surviving mice display progressive hindlimb weakness, kyphoscoliosis, muscle pathology and cardiac conduction defects. These findings indicate that nesprin-1 has an important function in muscle development and maintenance in both human and mouse.

RESULTS

The two probands (III4, III5) were born from first-degree consanguineous marriage (Fig. 1A) of a Palestinian couple of East Jerusalem origin. Patient III5 was born at term of a pregnancy marked by decreased fetal movements. At birth, severe hypotonia associated with bilateral club foot were observed without dysmorphic features nor malformations. The patient was able to walk independently at 3 years of age. The disease was progressive since the patient was no more able to walk at the age of 12 years and developed severe scoliosis. Mild facial weakness was observed without ophtalmoplegia. Deep reflexes were absent. Neither pyramidal nor cerebellar involvement was noticed. The intelligence was normal. CK level was normal. Electromyography was not conclusive showing mild chronic neurogenic findings with normal motor and sensory nerve conduction velocity and mild jitter in two muscle fibers of orbicularis oculi. This last finding was interpreted as secondary to the neurogenic process. Muscle biopsy was performed at 8 years of age. Variation in size of muscle fibers was found without increased number of muscle fibers with central nuclei. No muscle necrosis, endomysial fibrosis nor neurogenic findings were observed. Genetic analysis of the DMPK and SMN1 genes excluded myotonic dystrophy-1 and spinal muscular atrophy, respectively. The older affected brother (III4) was born with severe hypotonia and bilateral clubfoot. The patient was able to walk independently at 3 years then only with support at 12 years of age. There was no cerebellar or pyramidal involvement. He developed severe kyphoscoliosis and restrictive lung disease. He died at 22 years of age from pneumonia and sepsis. CK level was normal. Muscle biopsy was not conclusive. The brother of affected children (III2) married his first cousin (III1) and had two pregnancies (Fig. 1A). Both fetuses were diagnosed as affected on the basis of ultrasonographic findings showing at 28 and 16 weeks of the first and second pregnancies, respectively, bilateral clubfoot associated with diminished movements of the fetus without IUGR nor associated malformations. Pregnancies were terminated. Muscle biopsy was performed in the fetus IV1 and revealed variation in the size of muscle fibers, without muscle necrosis nor increased muscle fibers with internal nuclei.

Figure 1.

Linkage analysis of the family suffering from autosomal recessive AMC. (A) Haplotypes of family members at the 6q25 locus using polymorphic microsatellite markers. Filled and unfilled symbols represent affected and unaffected individuals, respectively. The numbers denote individuals whose DNA samples were analyzed. Note the homozygosity of genotypes between the crossing-over events (horizontal bars). The centromeric boundary was established on the basis of SNP analysis. (B) Multipoint linkage analysis using SNP data showing LOD score Zmax = 3.55 at θ = 0.0 on chromosome 6q25. X-axis: genetic distance in centimorgan, Y-axis: Lod score.

Figure 1.

Linkage analysis of the family suffering from autosomal recessive AMC. (A) Haplotypes of family members at the 6q25 locus using polymorphic microsatellite markers. Filled and unfilled symbols represent affected and unaffected individuals, respectively. The numbers denote individuals whose DNA samples were analyzed. Note the homozygosity of genotypes between the crossing-over events (horizontal bars). The centromeric boundary was established on the basis of SNP analysis. (B) Multipoint linkage analysis using SNP data showing LOD score Zmax = 3.55 at θ = 0.0 on chromosome 6q25. X-axis: genetic distance in centimorgan, Y-axis: Lod score.

To identify the disease locus, genome-wide linkage analysis was performed using the Affymetrix 250K SNP arrays following standard protocol. Multipoint linkage analysis of SNP data applied to the whole genome revealed a single locus on chromosome 6q25 with a maximum LOD score Zmax = 3.55 at θ = 0.0 (Fig. 1B). The candidate region was 6 Mb in size between SNP rs4897057 (physical position 149,195,883) and rs9397769 (physical position 155,412,076). Homozygosity at each SNP locus was found within this interval in all affected individuals of the family. To confirm and narrow the region linked to the disease locus, microsatellite markers mapping within or flanking the candidate region were selected and analyzed (D6S1637, D6S1654, D6S1687, D6S420, D6S290, D6S441, D6S425, D6S1577, D6S442, Fig. 1). Multipoint linkage analysis of microsatellite markers with the disease locus confirmed the SNP data (Zmax = 3.55 at θ = 0.0, data not shown). The recombinant events occurred between rs4897057 and rs17079169 (centromeric boundary) and between D6S425 and D6S1577 (telomeric boundary). Linkage and homozygosity by descent allowed the mapping of the disease gene within this interval (Fig. 1).

Using Map viewer (NCBI), a total of 53 genes were localized in the candidate region. Among them, those expressed in skeletal muscle or neurons, or encoding proteins interacting with proteins involved in the neuromuscular system development, maintenance or diseases in either human or mouse were selected for sequence analysis. SYNE-1 gene was regarded as the best candidate. It encodes nesprin-1, a large protein of 8797 amino acids. Nesprin-1α (isoform 3 starting from a Methionine at position 7839) has been shown to be highly expressed in skeletal muscle and heart (3–5). Nesprin-1 interacts with the muscle specific-tyrosine kinase (MuSK), lamin A and emerin both in vitro and in vivo (3,6) mutations of these genes are responsible for myopathies. A set of 21 PCR primer pairs were designed from genomic DNA to amplify each exon and exon–intron junctions of the SYNE-1 isoform 3. Sequence analysis of arthrogryposis multiplex congenital (AMC) patient (III5) revealed a homozygous A to G nucleotide substitution of the conserved AG splice acceptor site at the junction of intron 136 and exon 137 (Fig. 2A). All affected individuals or obligate carriers carried homozygous or heterozygous mutations, respectively, demonstrating the co-segregation of the mutation with the disease phenotype (data not shown, available on request). The A to G mutation creates MspI restriction site in the genomic sequence and was used to screen for the mutation in all available family members and in an additional 100 healthy individuals. MLH1 exon 18 that contains MspI restriction was co-amplified and used as internal control for digestion (Table 1 and Fig. 2B). This procedure confirmed sequence analysis and did not reveal the A to G acceptor splice site mutation in 200 chromosomes from healthy individuals (Fig. 2B and data not shown).

Figure 2.

Analysis of SYNE-1 at the DNA and RNA level in AMC patient and control. (A) Sequence of the SYNE-1 gene revealed a homozygous A to G nucleotide substitution of the AG splice acceptor site at the intron 136 and exon 137 junction in patient (arrow). (B) Analysis of the mutation in family members and control. Left panel: undigested PCR amplification products of SYNE-1 intron 136–exon 137 (330 bp) and MLH1 exon 18 (250 bp, −MspI). Right panel: the PCR amplification products were digested using MspI restriction enzyme (+MspI). The mutation of SYNE-1 gene creates an MspI restriction site leading to two products (210 and 120 bp) in patients or carriers. MLH1 exon 18 is used as internal control for MspI digestion leading to 150 bp fragment. This test confirms the cosegregation of the SYNE-1 mutation with the phenotype and haplotypes in the family. C: control. (C) RT–PCR analysis of exons 136–138 of SYNE-1 transcripts in control (C) and patient (P). Note the abnormal size (660 bp) of the RT–PCR product in patient when compared with control (395 bp). (D) RT–PCR analysis of exons 133–135 of SYNE-1 transcript in control (C) and patient (P). (-), water. β-Actin was used as internal control for RT–PCR analysis.

Figure 2.

Analysis of SYNE-1 at the DNA and RNA level in AMC patient and control. (A) Sequence of the SYNE-1 gene revealed a homozygous A to G nucleotide substitution of the AG splice acceptor site at the intron 136 and exon 137 junction in patient (arrow). (B) Analysis of the mutation in family members and control. Left panel: undigested PCR amplification products of SYNE-1 intron 136–exon 137 (330 bp) and MLH1 exon 18 (250 bp, −MspI). Right panel: the PCR amplification products were digested using MspI restriction enzyme (+MspI). The mutation of SYNE-1 gene creates an MspI restriction site leading to two products (210 and 120 bp) in patients or carriers. MLH1 exon 18 is used as internal control for MspI digestion leading to 150 bp fragment. This test confirms the cosegregation of the SYNE-1 mutation with the phenotype and haplotypes in the family. C: control. (C) RT–PCR analysis of exons 136–138 of SYNE-1 transcripts in control (C) and patient (P). Note the abnormal size (660 bp) of the RT–PCR product in patient when compared with control (395 bp). (D) RT–PCR analysis of exons 133–135 of SYNE-1 transcript in control (C) and patient (P). (-), water. β-Actin was used as internal control for RT–PCR analysis.

Table 1.

Primers used for sequence, RNA and mutation analyses

Primer Primer sequence (5′–3′)
 
 Forward Reverse 
Syne-1 ex131 ttacctgttcagtaggaacccttt cggccgaaatcatcaaaaat 
Syne-1 ex132 agctgggctggatgtattaag ctgatgaaaggcagactgaaag 
Syne-1 ex133 gcacgctagagaaacatgagt ccaggaggacagatattccat 
Syne-1 ex134 gcctagccatttaccaacatag cagtggatactctgggtgattt 
Syne-1 ex135 gttctggagcgaaaacagtct gtcttggaactccaactaccag 
Syne-1 ex136 ctactgagagtccttcgctgat ctgccatcccattcttacaa 
Syne-1 ex137 gcttctcattgcttgctgag cacaaaagagccacaaatcc 
Syne-1 ex138 tgtaagcaacaacaatagcaaaa tcccacacgacttattctcttt 
Syne-1 ex139a gtggcccagataagaagctagt actgaggtcatagtcgtgatcc 
Syne-1 ex139b acagccttcctccaatctct cctctgactttcctttaagctg 
Syne-1 ex140 agggtttccagaacttagctgt tgctaagagaggaggattgcta 
Syne-1 ex141 gctttgtaattacccacacctg cagacgaactgttctttgacac 
Syne-1 ex142 cacagacacttctcttgctgag gctgttaacaaagtgcttcagg 
Syne-1 ex143a tggctgccaacctatgttta agctgttccaactcctcctc 
Syne-1 ex143b atgaagcagaacctccagaag taagagcagctcgaactagagg 
Syne-1 ex144 ggatcttttcattcatgtgaaac gtcacacactcagctaaattgc 
Syne-1 ex145 ccaagtatgtttgctaatggtg aatgcaaccctgctaaaaataa 
Syne-1 ex146 ctgcacttttggagcttttg gatgcttctttggtctccagta 
Syne-1 ex147 agataacgtggtgcaacagag tactgtcacttcccagtgttca 
Syne-1 ex148 gcctggactgaacattcttct aggcagaccagatataggtcaa 
Syne-1 ex149 tccgacactggagttatctgag cttatgacccgatcctccttat 
D6S1637 cctctggactcagtaggaagtg caagatagatgcggcacaat 
D6S1654 atttgccgctttctatgg tgtatgttcagttactggacagg 
D6S1687 tagaagggtacaatttggg aaagggcattgggaac 
D6S420 gttttggtgactcaagacca gtgattcctcccaaaagatc 
D6S290 gtttgctggatgagtgg gatttggtgaatgctctg 
D6S441 aacaatatttggtgactgttaaagg tggacaaattgattaggaagtaaag 
D6S425 ccctgcctctacaaaaagtt attggttaatgctgccagta 
D6S1577 tgacattaggaggcactgg ttaacttgtctggctgtttggat 
D6S442 agctacattactcacccaacac attttcaccatcacaattctct 
Syne-1 exons 136–138 ggccagggagaaccgcactgat cctggcagtaccgtcggagctcat 
β-Actin ccaaccgcgagaagatgacccag ggaagagtgcctcagggcagcg 
Syne-1 exons 133–135 aggacctggctcgctcacatcg ccccagaagagctgggaaaagcag 
MLH1 ex18 gtagtctgtgatctccgttt atgtatgaggtcctgtccta 
Syne-1 ex137 Mspgcttctcattgcttgctgag cacaaaagagccacaaatcc 
Primer Primer sequence (5′–3′)
 
 Forward Reverse 
Syne-1 ex131 ttacctgttcagtaggaacccttt cggccgaaatcatcaaaaat 
Syne-1 ex132 agctgggctggatgtattaag ctgatgaaaggcagactgaaag 
Syne-1 ex133 gcacgctagagaaacatgagt ccaggaggacagatattccat 
Syne-1 ex134 gcctagccatttaccaacatag cagtggatactctgggtgattt 
Syne-1 ex135 gttctggagcgaaaacagtct gtcttggaactccaactaccag 
Syne-1 ex136 ctactgagagtccttcgctgat ctgccatcccattcttacaa 
Syne-1 ex137 gcttctcattgcttgctgag cacaaaagagccacaaatcc 
Syne-1 ex138 tgtaagcaacaacaatagcaaaa tcccacacgacttattctcttt 
Syne-1 ex139a gtggcccagataagaagctagt actgaggtcatagtcgtgatcc 
Syne-1 ex139b acagccttcctccaatctct cctctgactttcctttaagctg 
Syne-1 ex140 agggtttccagaacttagctgt tgctaagagaggaggattgcta 
Syne-1 ex141 gctttgtaattacccacacctg cagacgaactgttctttgacac 
Syne-1 ex142 cacagacacttctcttgctgag gctgttaacaaagtgcttcagg 
Syne-1 ex143a tggctgccaacctatgttta agctgttccaactcctcctc 
Syne-1 ex143b atgaagcagaacctccagaag taagagcagctcgaactagagg 
Syne-1 ex144 ggatcttttcattcatgtgaaac gtcacacactcagctaaattgc 
Syne-1 ex145 ccaagtatgtttgctaatggtg aatgcaaccctgctaaaaataa 
Syne-1 ex146 ctgcacttttggagcttttg gatgcttctttggtctccagta 
Syne-1 ex147 agataacgtggtgcaacagag tactgtcacttcccagtgttca 
Syne-1 ex148 gcctggactgaacattcttct aggcagaccagatataggtcaa 
Syne-1 ex149 tccgacactggagttatctgag cttatgacccgatcctccttat 
D6S1637 cctctggactcagtaggaagtg caagatagatgcggcacaat 
D6S1654 atttgccgctttctatgg tgtatgttcagttactggacagg 
D6S1687 tagaagggtacaatttggg aaagggcattgggaac 
D6S420 gttttggtgactcaagacca gtgattcctcccaaaagatc 
D6S290 gtttgctggatgagtgg gatttggtgaatgctctg 
D6S441 aacaatatttggtgactgttaaagg tggacaaattgattaggaagtaaag 
D6S425 ccctgcctctacaaaaagtt attggttaatgctgccagta 
D6S1577 tgacattaggaggcactgg ttaacttgtctggctgtttggat 
D6S442 agctacattactcacccaacac attttcaccatcacaattctct 
Syne-1 exons 136–138 ggccagggagaaccgcactgat cctggcagtaccgtcggagctcat 
β-Actin ccaaccgcgagaagatgacccag ggaagagtgcctcagggcagcg 
Syne-1 exons 133–135 aggacctggctcgctcacatcg ccccagaagagctgggaaaagcag 
MLH1 ex18 gtagtctgtgatctccgttt atgtatgaggtcctgtccta 
Syne-1 ex137 Mspgcttctcattgcttgctgag cacaaaagagccacaaatcc 

To determine whether the splice acceptor site mutation affects the splicing of SYNE-1 RNA, RT–PCR analysis of total RNA extracted from skin fibroblasts cultured from the patient and control individuals was performed using primers chosen in exons 136 and 138 (Table 1). An aberrant alternative spliced product leading to a larger PCR product was observed in patient (Fig. 2C). Sequence analysis of the aberrant PCR product revealed retention of the intron 136 followed by exons 137 and 138 when compared with control RT–PCR product (Fig. 3). The intron 137 was correctly spliced (Fig. 3). The retention of intron 136 leads to premature stop codons after additional seven missense residues instead of the native 693 residues of the C-terminal region of the nesprin-1. This deleted region of nesprin-1 includes the C-terminal transmembrane domain KASH (Fig. 3B). To know whether this abnormal spliced product may have an effect on the SYNE-1 RNA stability, RT–PCR of exons located upstream from the exon 136 was performed (Table 1). A 25% reduction of SYNE-1 RNA level was observed in patient when compared with control and β-actin RNA (Table 1 and Fig. 2D). Immunolabeling of nesprin-1 was performed using polyclonal antibodies specific to nesprin-1 peptide mapping close to the KASH domain (AN1, 5) on fibroblast cultures of control and patient. No detectable nesprin-1 immunolabeling was observed in patient fibroblasts (Fig. 4). Immunolabeling of lamin A/C (MANLAC1-4A7) (7) and emerin (MANEM5-8A1) (8) on the same fibroblast cultures did not reveal any difference between control and patients (Fig. 4).

Figure 3.

Sequence analysis of the SYNE-1 transcripts in AMC patient and control. RT–PCR products of exons 136–138 of SYNE-1 were sequenced in control and patients using forward and reverse primers. Arrows indicate intron–exon junctions. (A) Forward sequence: note the insertion of intron 136 in RT–PCR products of the patient. The A to G substitution is indicated as box (right panel). (B) The deduced amino acid sequence shows that the retention of intron 136 leads to several stop codons in patient (underlined). (C) Reverse sequence: note the correct splicing of intron 137 in patient.

Figure 3.

Sequence analysis of the SYNE-1 transcripts in AMC patient and control. RT–PCR products of exons 136–138 of SYNE-1 were sequenced in control and patients using forward and reverse primers. Arrows indicate intron–exon junctions. (A) Forward sequence: note the insertion of intron 136 in RT–PCR products of the patient. The A to G substitution is indicated as box (right panel). (B) The deduced amino acid sequence shows that the retention of intron 136 leads to several stop codons in patient (underlined). (C) Reverse sequence: note the correct splicing of intron 137 in patient.

Figure 4.

Immunolabeling experiments of nesprin-1, emerin and lamin A/C in control and patient fibroblasts. Cultures of fibroblasts derived from control (AA″, CC″, EE″) and patients (BB″, DD″, FF″) were immunolabeled using anti-nesprin-1 (A′, B′, AN1), emerin (C′, D′, MANEM5-8A1) or lamin A/C (E′, F′, MANLAC1-4A7) antibodies. Nuclei were stained with Dapi (A–F). (A″–F″) are merged images. Note the lack of nesprin-1 immunolabeling in patient (B′) when compared with control (A′). In contrast, no difference in either emerin or lamin A/C immunolabeling is found between control and patient. Scale bar: 100 µm.

Figure 4.

Immunolabeling experiments of nesprin-1, emerin and lamin A/C in control and patient fibroblasts. Cultures of fibroblasts derived from control (AA″, CC″, EE″) and patients (BB″, DD″, FF″) were immunolabeled using anti-nesprin-1 (A′, B′, AN1), emerin (C′, D′, MANEM5-8A1) or lamin A/C (E′, F′, MANLAC1-4A7) antibodies. Nuclei were stained with Dapi (A–F). (A″–F″) are merged images. Note the lack of nesprin-1 immunolabeling in patient (B′) when compared with control (A′). In contrast, no difference in either emerin or lamin A/C immunolabeling is found between control and patient. Scale bar: 100 µm.

DISCUSSION

Genome-wide linkage analysis of a single inbred consanguineous family suffering from an autosomal recessive arthrogryposis revealed a single locus on chromosome 6p25. The deleterious effect of a splice acceptor site mutation in the SYNE-1 gene leading to aberrant intronic retention, premature stop codons and a putative truncating protein lacking the C-terminal KASH domain of nesprin-1 establishes SYNE-1 as the defective gene in this family. In its full length form, SYNE-1 gene encodes a protein of 8797 amino acids characterized by the presence of a N-terminal actin binding site (amino acids 1–289), 31 spectrin repeats and the C-terminal transmembrane domain KASH (8738–8797). Alternative promoters and splicing events produce multiple isoforms sharing the same C-terminal KASH domain. Recently, Puckelwartz et al. (2) generated mice lacking the KASH domain of nesprin-1 (Δ/ΔKASH). Δ/ΔKASH mutant mice exhibit 50% perinatal lethality. Surviving mice have a progressive muscle wasting disorder that is associated with an abnormal gait, hindlimb muscle weakness, kyphoscoliosis and cardiac conduction defects. The phenotype is characterized by an increase in centrally placed nuclei in mutant muscle, significantly smaller fibers and the nuclei are no longer associated with the neuromuscular junctions. Interestingly, nesprin-1α is localized at the nuclear envelope in both wild-type and Δ/ΔKASH mice, suggesting that the KASH domain is not required for the normal localization of nesprin-1 to the nuclear membrane. The severity of the phenotype found in our family is similar to that of Δ/ΔKASH mouse phenotype. The mutation found in this family is leading to the lack of the KASH domain, a defect similar to that generated in Δ/ΔKASH mice. The presence of a truncated protein lacking the KASH domain in our family remains to be clarified. In term of medical applications, these results should greatly improve diagnostic testing and genetic counseling options. Autosomal recessive AMC is a group of genetically heterogeneous disorders. Importantly, SYNE-1 gene should be investigated in patients suffering from autosomal recessive AMC of myogenic origin in order to get an accurate estimation of disease prevalence.

Nesprin-1 has been shown to be involved in anchoring specialized myonuclei underneath neuromuscular junctions (3). These nuclei are specialized and express high amount of synaptic components such as acetylcholine receptor subunit genes. In addition, nesprin-1 binds lamin A and emerin both in vitro and in vivo (6). By binding to lamin and emerin, nesprins link the nucleoskeleton and inner nuclear membrane to the outer nuclear membrane and cytoskeleton by forming a bridge. The interaction between nesprin-1α and lamin A does not require nesprin KASH domain (6). Nesprin-1 also interacts with the cytoplasmic domain of MuSK (3), a critical component of the agrin receptor which is concentrated in the post-synaptic membrane. Its location and structure raise the possibility that nesprin-1 might be involved in the formation or maintenance of nuclear aggregates at the neuromuscular junction (3). Nesprin-1 belongs also to the LINC complex linking the nuclear lamina to the actin cytoskeleton in the cytoplasm (9). This complex includes nesprin proteins (1 and 2) that bind actin, SUN proteins in the perinuclear space of the nuclear envelope and lamins in the nucleus. The data presented here further support an important function of the nesprin-1 KASH domain in muscle development and maintenance in both human and mouse. One hypothesis to explain the phenotype of KASH deleted mice implicates the formation of a dysfunctional LINC complex. The KASH deleted protein is able to occupy its position at the nuclear membrane preventing nesprin-2, thought to compensate from the lack of nesprin-1 in Syne-1−/− mice (10), from participating in a functional LINC complex and therefore causes muscle diseases. A similar pathogenic mechanism may account for the severity of the phenotype in the human disease.

Mutations in the EMD or LMNA gene encoding emerin and lamin A/C, respectively, are responsible for Emery Dreifuss muscular dystrophy (EDMD). EDMD is a neuromuscular disorder characterized by early contractures, slowly progressive skeletal muscle wasting and weakness and cardiomyopathy usually presenting as heart block. The interaction of nesprin-1 with lamin A and emerin has lead SYNE-1 to be regarded as a candidate gene in EDMD unlinked to LMNA or EMD genes. In a series of 190 EDMD and EDMD-like patients, mutation screening of the SYNE-1 and -2 genes was performed (11). A total of four unique variants not present in 384 control alleles were identified in nesprin-1α. One is located in the 5′-UTR and three resulted in amino acid changes (R257H, V572L and E646K). The missense mutations found in SYNE-1 occurred at position that are highly conserved evolutionarily and that lie within the lamin and emerin binding domains of nesprin-1. Causality for these missense mutations in EDMD cannot be confirmed from this study because of the small number and size of the pedigree which hampers the segregation analysis of genotype with the disease phenotype.

Interestingly, mutations in the Lamin A gene (LMNA) cause other disease phenotypes known as laminopathies that included autosomal limb girdle muscular dystrophy type 1B, dilated cardiomyopathy with conduction defect, Charcot–Marie–Tooth neuropathy type 2B1, Dunningan's familial partial lipodystrophy, mandibuloacral dysplasia, premature aging syndromes. Many issues have yet to be resolved regarding the correlation of the genotypes of laminopathies with the growing list of rare and distinct diseases (12). Similarly, non-sense mutations or mutations leading to premature stop codon in SYNE-1 exons 56, 71, 93, 118, 126 or in introns 81 and 84 have been identified in a late onset autosomal recessive cerebellar ataxia in French-Canadian families (ARCA1), (13,14). These mutations are located in the N-terminal regions outside the emerin and lamin binding domains and likely result in severe loss-of-function of the larger isoforms which may also affect brain specific isoforms. In the present study, we show that mutations of SYNE-1 gene, encoding a protein interacting with lamin A, may lead to a severe myopathic phenotype suggesting that distinct mutations of the same gene may lead to at least two distinct human disease phenotypes, myopathic or neurological, a feature similar to that found in laminopathies extending the concept of laminopathies to the other components of the nuclear lamina interacting with lamin A/C.

MATERIALS AND METHODS

Patients

After informed consent of the participants, blood samples were obtained from affected and unaffected individuals. DNA was extracted by using standard methods. Molecular genetic studies in rare neuromuscular diseases were approved by the Hadassah Ethical Review Committee.

Genome-wide linkage analysis

Whole genome screening has been performed using 250K SNP microarray (Affymetrix) following standard protocol. Briefly, 250 ng of DNA was digested by using Nsp1 restriction enzyme, followed by ligation to Nsp1 adaptors. PCR amplification of ligated products was performed using primers specific to adaptors on an ABI PCR amplification system (GeneAmp® 9700, Applied Biosystem). After purification of the PCR products, DNA fragmentation was performed before labeling using TdT then hybridized to 250K SNP microarray chip. After overnight hybridization, SNP microarrays were washed, stained then scanned. More than 95% calls were obtained for each DNA sample. Multipoint linkage analysis of SNP data applied to the whole genome has been performed using Alohomora software (15) and Merlin software (16) with the following parameters: autosomal recessive inheritance, 100% penetrance and disease gene frequency in the population of 1:1000. Microsatellite markers mapping to the candidate region were selected from public genomic databases (D6S1637, D6S1654, D6S1687, D6S420, D6S290, D6S441, D6S425, D6S1577, D6S442, Map Viewer and Genethon Genetic maps, Table 1) (17).

Sequence analysis and screening of the mutation

PCR primer pairs were designed from genomic DNA to amplify each exon of the isoform α of the SYNE-1 gene including the flanking exon–intron junctions (Table 1). PCR amplification was carried out using 1.6 mm MgCl2, 0.5 U BIOTAQ™ DNA Polymerase (Bioline), 0.2 µm each primer and 50 ng DNA. After an initial cycle of denaturation at 94°C for 5 min, 30 cycles were performed consisting of denaturation at 95°C for 30 s, annealing at the appropriate Tm for 1 min and extension at 72°C for 30 s and final extension 10 min at 72°C, in a ABI 2720 Thermal Cycler (Applied Biosystem). The PCR products were then purified on P100 columns (Bio-Gel P-2 Gel fine, BioRad). The purified PCR products were sequenced using the forward and reverse primers of each amplicon using a Big Bye Terminator V3.1 Cycle sequencing kit (Applied Biosystem). The sequencing reaction products were purified on G50 columns (Sephadex G-50 Superfine, GE Healthcare) and then migrated on an automated fluorescent DNA sequencing (ABI Prism® 3100 Genetic analyzer, Applied Biosystem). The obtained DNA sequences were compared with published sequences by the use of BLAST.

The A to G mutation creates MspI restriction site in the genomic sequence. PCR amplification of DNA including the intron 136 and exon 137 junction of SYNE-1 gene was performed followed by digestion using MspI restriction enzyme (primers Syne-1 ex137 MspI, Table 1). MLH1 exon 18 that contains MspI restriction was co-amplified and used as internal control for MspI digestion (primers MLH1 ex18, Table 1).

Cell culture and RNA analysis

Fibroblasts from patient and control individual were obtained from skin biopsies after informed consent. Fibroblasts were maintained at 37°C in a humidified incubator containing 5% CO2 in Dulbecco's modified Eagle's medium supplemented with 10% calf bovine serum and 0.1% gentamycin. Total RNA was extracted from fibroblasts using the Trizol RNA isolation procedure (Invitrogen). After removing the culture medium and two washes in PBSX1, Trizol was directly added to the culture plate. First-strand cDNA synthesis was performed from 300 ng of total RNA by using oligo(dT) primers and SuperScript™ II Reverse Transcriptase (Invitrogen).

To determine the effect of the splice site acceptor mutation in intron 136 of SYNE-1 gene, PCR amplification analysis of single-strand cDNA was performed using forward and reverse primers (Syne-1 exons 136–138, Table 1) chosen in SYNE-1 exons 136 and 138, respectively. As internal control for PCR amplification, β-actin cDNA was co-amplified (Table 1). PCR amplification of exons 133–135 was performed from the same cDNA samples (SYNE-1 exons 133–135 primers, Table 1). RT–PCR products were separated by agarose gel electrophoresis and labeled with ethidium bromide and sequenced as described above. PCR amplification was carried out using 1.5 mm MgCl2, 2 U BIOTAQ™ DNA Polymerase (Bioline), 0.2 µm each primer and 2 µl cDNA. After an initial cycle of denaturation at 94°C for 5 min, 30 cycles were performed consisting of denaturation at 94°C for 15 s, annealing at 65°C for 15 s and extension at 72°C for 15 s, followed by a final extension for 5 min at 72°C, in a ABI 2720 Thermal Cycler (Applied Biosystem).

Immunolabeling experiments

Cultures of fibroblasts were fixed with 4% paraformaldehyde for 10 min at 37°C, permeabilized with 0.1% Triton for 5 min, incubated with 5% serum in 3% BSA in PBS during 1 h at room temperature then incubated with lamin A/C (MANLAC1-4A7, 1:100) (7), or emerin monoclonal antibodies (MANEM5-8A1, 1:100) (8), overnight at 4°C. For nesprin-1 immunolabeling, the cells were fixed with ice cold methanol for 2 min. After permeabilization with 0.1% Triton for 1 h and blocking, the cells were incubated with nesprin-1 polyclonal antibodies (AN1, 1:50, 5). After three washes in PBS, the cells were incubated with secondary antibodies (Rhodamin donkey anti-rabbit for nesprin and Cy3 goat anti-mouse for emerin and lamin A/C, Jackson Immunoresearch) then washed three times in PBS. Cells were then mounted with Vectashield-DAPI (Vector Laboratories, Burlingame, CA, USA) and observed under Leica DMRXA2 Microscope (Leica).

FUNDING

This project was supported by a grant from the Association Française contre les Myopathies; the Bettencourt Schueller Foundation and Hadassah International to J.M. R.A. is a recipient of an International Volunteer-Scientific Researcher contract of the French Embassy.

ACKNOWLEDGEMENTS

The authors thank the family members for their entire cooperation. We greatly thank Professor S. Mitrani-Rosenbaum and Professor E. Galun for fruitful support, Professor V. Meiner who contributed her time to this family, Professor G.E. Morris for providing us with antibodies specific to lamin A/C and emerin from the MDA Monoclonal Antibody Resource. We thank Bella Meidan for technical help in cell culture and Liat Ben Avi for technical advice for microsatellite analysis.

Conflict of Interest statement. None declared.

REFERENCES

1
Pakkasjärvi
N.
Ritvanen
A.
Herva
R.
Peltonen
L.
Kestilä
M.
Ignatius
J.
Lethal congenital contracture syndrome (LCCS) and other lethal arthrogryposes in Finland—an epidemiological study
Am. J. Med. Genet. A
 , 
2006
, vol. 
140
 (pg. 
1834
-
1839
)
2
Puckelwartz
M.J.
Kessler
E.
Zhang
Y.
Hodzic
D.
Randles
K.N.
Morris
G.
Earley
J.U.
Hadhazy
M.
Holaska
J.M.
Mewborn
S.K.
, et al.  . 
Disruption of nesprin-1 produces an Emery Dreifuss muscular dystrophy-like phenotype in mice
Hum. Mol. Genet.
 , 
2009
, vol. 
18
 (pg. 
607
-
620
)
3
Apel
E.D.
Lewis
R.M.
Grady
R.M.
Sanes
J.R.
Syne-1, a dystrophin- and Klarsicht-related protein associated with synaptic nuclei at the neuromuscular junction
J. Biol. Chem.
 , 
2000
, vol. 
275
 (pg. 
31986
-
31995
)
4
Zhang
Q.
Skepper
J.N.
Yang
F.
Davies
J.D.
Hegyi
L.
Roberts
R.G.
Weissberg
P.L.
Ellis
J.A.
Shanahan
C.M.
Nesprins: a novel family of spectrin-repeat-containing proteins that localize to the nuclear membrane in multiple tissues
J. Cell Sci.
 , 
2001
, vol. 
114
 (pg. 
4485
-
4498
)
5
Mislow
J.M.
Kim
M.S.
Davis
D.B.
McNally
E.M.
Myne-1, a spectrin repeat transmembrane protein of the myocyte inner nuclear membrane, interacts with lamin A/C
J. Cell Sci.
 , 
2002
, vol. 
115
 (pg. 
61
-
70
)
6
Mislow
J.M.
Holaska
J.M.
Kim
M.S.
Lee
K.K.
Segura-Totten
M.
Wilson
K.L.
McNally
E.M.
Nesprin-1alpha self-associates and binds directly to emerin and lamin A in vitro
FEBS Lett.
 , 
2002
, vol. 
525
 (pg. 
135
-
140
)
7
Manilal
S.
Randles
K.N.
Aunac
C.
Nguyen
M.
Morris
G.E.
A lamin A/C beta-strand containing the site of lipodystrophy mutations is a major surface epitope for a new panel of monoclonal antibodies
Biochim. Biophys. Acta
 , 
2004
, vol. 
1671
 (pg. 
87
-
92
)
8
Manilal
S.
Sewry
C.A.
Pereboev
A.
Man
N.
Gobbi
P.
Hawkes
S.
Love
D.R.
Morris
G.E.
Distribution of emerin and lamins in the heart and implications for Emery-Dreifuss muscular dystrophy
Hum. Mol. Genet.
 , 
1999
, vol. 
8
 (pg. 
353
-
359
)
9
Crisp
M.
Liu
Q.
Roux
K.
Rattner
J.B.
Shanahan
C.
Burke
B.
Stahl
P.D.
Hodzic
D.
Coupling of the nucleus and cytoplasm: role of the LINC complex
J. Cell Biol.
 , 
2006
, vol. 
172
 (pg. 
41
-
53
)
10
Zhang
X.
Xu
R.
Zhu
B.
Yang
X.
Ding
X.
Duan
S.
Xu
T.
Zhuang
Y.
Han
M.
Syne-1 and Syne-2 play crucial roles in myonuclear anchorage and motor neuron innervation
Development
 , 
2007
, vol. 
134
 (pg. 
901
-
908
)
11
Zhang
Q.
Bethmann
C.
Worth
N.F.
Davies
J.D.
Wasner
C.
Feuer
A.
Ragnauth
C.D.
Yi
Q.
Mellad
J.A.
Warren
D.T.
, et al.  . 
Nesprin-1 and -2 are involved in the pathogenesis of Emery Dreifuss muscular dystrophy and are critical for nuclear envelope integrity
Hum. Mol. Genet.
 , 
2007
, vol. 
16
 (pg. 
2816
-
2833
)
12
Capell
B.C.
Collins
F.S.
Human laminopathies: nuclei gone genetically awry
Nat. Rev. Genet.
 , 
2006
, vol. 
7
 (pg. 
940
-
952
)
13
Gros-Louis
F.
Dupré
N.
Dion
P.
Fox
M.A.
Laurent
S.
Verreault
S.
Sanes
J.R.
Bouchard
J.P.
Rouleau
G.A.
Mutations in SYNE1 lead to a newly discovered form of autosomal recessive cerebellar ataxia
Nat. Genet.
 , 
2007
, vol. 
39
 (pg. 
80
-
85
)
14
Dupré
N.
Gros-Louis
F.
Chrestian
N.
Verreault
S.
Brunet
D.
de Verteuil
D.
Brais
B.
Bouchard
J.P.
Rouleau
G.A.
Clinical and genetic study of autosomal recessive cerebellar ataxia type 1
Ann. Neurol.
 , 
2007
, vol. 
62
 (pg. 
93
-
98
)
15
Ruschendorf
F.
Nurnberg
P.
ALOHOMORA: a tool for linkage analysis using 10K SNP array data
Bioinformatics
 , 
2005
, vol. 
21
 (pg. 
2123
-
2125
)
16
Abecasis
G.R.
Cherny
S.S.
Cookson
W.O.
Cardon
L.R.
Merlin-rapid analysis of dense genetic maps using sparse gene flow trees
Nat. Genet.
 , 
2002
, vol. 
30
 (pg. 
97
-
101
)
17
Dib
C.
Fauré
S.
Fizames
C.
Samson
D.
Drouot
N.
Vignal
A.
Millasseau
P.
Marc
S.
Hazan
J.
Seboun
E.
, et al.  . 
A comprehensive genetic map of the human genome based on 5,264 microsatellites
Nature
 , 
1996
, vol. 
380
 (pg. 
152
-
154
)

Author notes

Present address: Inserm Unit 788 and University of Paris 11, Bicetre Hospital, Gregory Pincus Building, 78 rue du Général Leclerc, Le Kremlin-Bicêtre 94275, France.