Abstract

Chromosome missegregation leads to chromosomal instability (CIN), thought to play a role in cancer development. As cohesin functions in guaranteeing correct chromosome segregation, increasing data suggest its involvement in tumorigenesis. In a screen of a large series of early colorectal adenomas, a precocious step during colorectal tumorigenesis, we identified 11 mutations in SMC1A core cohesin subunit. In addition, we sequenced the SMC1A gene in colorectal carcinomas and we found only one mutation. Finally, the transfection of the SMC1A mutations identified in early adenomas and wild-type SMC1A gene silencing in normal human fibroblasts led to CIN. Our findings that SMC1A mutations decrease from early adenomas to colorectal cancers and that mutations lead to CIN suggest that mutant cohesin could play a pivotal role during colorectal cancer development.

INTRODUCTION

Chromosomal instability (CIN) was proposed as the major cause of cancer development >100 years ago (1,2). However, this proposal had remained unproven due to the complexity of generating aneuploidy without other DNA damage. Despite its importance, the molecular mechanisms underlying CIN have not yet been completely defined. In recent years, there has been increasing interest in the expanding role of cohesin complex. Cohesin is a conserved multi-subunit protein complex comprising four core members: SMC1A, SMC3, RAD21 and STAG1/2. It ensures correct chromosome segregation, i.e. the fidelity of delivery to each daughter cell of one copy of every chromosome. In addition, cohesin also takes part in many additional biological processes such as gene expression regulation, DNA repair and genome stability maintenance (3–6).

Colorectal cancer is a useful model for investigating the role of cohesin in carcinogenesis. Notwithstanding the improvement in survival outcome of patients, colorectal cancer is a big killer cancer with over 1 million cases worldwide and 27 deaths per 100 000 population in high-income countries (data updated to 2011, from www.who.int). Colorectal cancer develops over the course of many years as a consequence of the accumulation of specific mutations in both oncogenes and tumor suppressor genes. These mutations arise within normal tissue in a characteristic sequence leading to early adenoma/dysplastic crypt, late adenoma and carcinoma (7). Two types of genomic instability have been identified. The more common, CIN, is present in ∼85% of colorectal cancer while the remaining 15% shows microsatellite instability (MSI) with a diploid chromosome set (8–10). Patients with CIN have a worse prognosis, whereas MSI is associated with a better prognosis. In this regard, the identification of gene that gives rise to a CIN phenotype at an early stage of colorectal cancer development has been challenging. Here, we perform mutational screening of the SMC1A core cohesin gene in both early colorectal adenomas, a precocious step during colorectal cancer development and colorectal cancers. Among cohesin complex members, SMC1A is a target of ATM and ATR protein kinases and it takes part in a signal transduction pathway that brings out a checkpoint response to DNA damage for maintaining genome stability (11–14). We show that SMC1A mutations decrease during colon cancer development from 22.9 to 5% in early adenomas and colorectal cancers, respectively. Furthermore, we demonstrate that SMC1A mutations identified in precancerous lesions lead to CIN. In this regard, CIN could provide few cells a peculiar chromosome content allowing the acquisition of the full malignant phenotype.

RESULTS

SMC1A mutations in early colorectal adenomas

DNA was isolated from 48 early colorectal adenomas (Supplementary Material, Fig. S1) for amplifying the coding sequences of the SMC1A gene. PCR was performed for each exon (primer pairs are listed in Supplementary Material, Table S1). All identified variants were reamplified and resequenced by using both forward and reverse primers to exclude sequence artifacts. By this approach, we identified 11 somatic mutations in SMC1A gene (Table 1; Supplementary Material, Fig. S2A–K) with a frequency of 22.9% (11 of 48). Nine of them were missense mutations (c.40 T>C, c.620 A>G, c.734 A>G, c.1360 A>C, c.1957 T>C, c.2210 T>C, c.2662 A>G, c.3106 G>A and c.3421 C>T) leading to amino acid changes, whereas two mutations (c.101delA and c.2479 C>T) caused a premature codon stop (Table 1). SMC1A mutations were equally distributed between genders (five females and six males). Furthermore, though SMC1A maps on X chromosome, male patients showed two peaks in correspondence of mutation site (Supplementary Material, Fig. S2A, D, F, H, I). It is likely that two different cell populations co-exist in the adenoma, the first one with cells carrying the mutated gene and the second one with the wild-type gene. However, the amplification of normal surrounding tissue is another alternative.

Table 1.

SMC1A mutations identified in human early colorectal adenomas

Patient Gender Exon Nucleotide changea Amino acid change 
c.40 T>C p.S14P 
c.101delA p.N34MfsX16 
c.620 A>G p.D207G 
c.734 A>G p.K245R 
c.1360 A>C p.K454Q 
12 c.1957 T>C p.S653P 
14 c.2210 T>C p. L737P 
16 c.2479 C>T p.Q827X 
17 c.2662 A>G p.N888D 
10 20 c.3106 G>A p.D1036N 
11 22 c.3421 C>T p.L1141F 
Patient Gender Exon Nucleotide changea Amino acid change 
c.40 T>C p.S14P 
c.101delA p.N34MfsX16 
c.620 A>G p.D207G 
c.734 A>G p.K245R 
c.1360 A>C p.K454Q 
12 c.1957 T>C p.S653P 
14 c.2210 T>C p. L737P 
16 c.2479 C>T p.Q827X 
17 c.2662 A>G p.N888D 
10 20 c.3106 G>A p.D1036N 
11 22 c.3421 C>T p.L1141F 

aNG_006988.2 (numbered with A of ATG as nucleotide 1).

Next, we sequenced the SMC1A gene in 20 colorectal cancers in order to investigate whether SMC1A mutation also occurred in tissue cancers. We identified only one mutation, the 2027A>G missense mutation leading to D207G amino acid change (data not shown) showing that the frequency of SMC1A mutation is ∼5% in colorectal cancer (1 of 20) confirming previous data (15). This finding suggests that the mutation rate of SMC1A is higher in precancerous lesions with respect to colorectal cancers.

SMC1A mutations lead to chromosome instability

The effect of mutations on SMC1A protein has been predicted using the Sorting Intolerant from Tolerant program (SIFT, http://sift-dna.org). Among the nine identified missense mutations, five of them resulted to be non-tolerated and damaging for protein activity (Table 2). Furthermore, the analysis of protein sequences for human and animal models (Pan troglodytes, Bos Taurus, Sus scrofa, Canis lupus familiaris, Mus musculus, Macaca mulatta, Gallus gallus and Xenopus laevis), aligned by the ClustalW method (http://www.ebi.ac.uk/Tools/msa/clustalw2) demonstrated that the mutated residue affects evolutionarily conserved amino acids (data not shown). The strong conservation throughout evolution combined with prediction effect of mutations supports the idea that SMC1A mutations could affect cohesion activity leading to CIN. Most mutations fall within the coil-coiled domain (Fig. 1A) that is crucial for the correct folding of SMC1A protein and the formation of the head domain within the cohesin ring. To investigate whether SMC1A interacts with the other cohesin subunits, we performed co-IP with RAD21 and SMC1A proteins using early colorectal adenoma extracts. Both SMC1A and SMC3 co-precipitated with IP-RAD21 (Fig. 2A) and both SMC3 and RAD21 were detected in IP-SMC1A (Fig. 2C). No SMC1A, SMC3 or RAD21 signal was detected in control western blotting using IgG-coated beads (Fig. 2B and D). To determine whether SMC1A mutations caused CIN and aneuploidy, we began by looking at the effects of the identified mutations in a human primary fibroblast cell line. We tested the mutation identified in colorectal cancer and two SMC1A mutations detected in early colorectal adenomas, c.2027 A>G, c.3421 C>T and c.2479 C>T, respectively. The first two mutations caused an amino acid change, whereas the last one gave a premature stop codon. At first, we performed the site-directed mutagenesis and all mutations were confirmed by direct sequencing (data not shown). In order to investigate the effects of SMC1A mutations, human fibroblasts were transfected with the mutated vectors. Transfection efficiency was comparable among SMC1A wild-type and mutants carrying vectors and ranged ∼80–90% (data not shown). Quantitative PCR showed a strong SMC1A expression 24 h after the transfections (Fig. 1B). Overexpression of mutated SMC1A proteins does not affect their incorporation into cohesin complex since co-IP experiments showed that SMC1A interacted with SMC3 (Supplementary Material, Fig. S3). Cells were treated with nocodazole to induce mitotic arrest and Giemsa-stained metaphase spreads were analyzed in a blinded fashion. Transfection with mutated SMC1A vectors induced chromosome aneuploidy, although to a different extent. In fact, the frequency of aneuploid cells ranges from 8% with c. 2027 A>G to 29% with c.2479 C>T (Fig. 1C). Both untreated and wild-type SMC1A vector-transduced cells showed 3% of aneuploidy, suggesting that overexpression of wild-type SMC1A is not enough to induce CIN per se. To further characterize the effects of SMC1A mutations, we investigated the outcome of c.101delA SMC1A mutation that leads to a premature stop codon. Since this mutation causes the translation, if any, of a short protein (50 amino acids), it is likely that the mutation is not tolerated. We postulated that c.101delA mutation led to a haploinsufficiency with the reduced level of wild-type protein. We therefore used the siRNA approach to decrease SMC1A wild-type protein in human fibroblasts. The downregulation of SMC1A was observed 48 h after siRNA treatment (Fig. 1D). Cytogenetic analysis showed that the SMC1A silencing led to chromosome aneuploidy, 32 versus 3% of mock cells (Fig. 1E). Next, we investigated additional markers to further corroborate the view that SMC1A mutations led to CIN. In addition to chromosome gain and loss (Fig. 3A), micronuclei formation can arise as a consequence of missegregation. Imaging of both transfected and siRNA-treated cells revealed the presence of abnormal figures, such as micronuclei (Fig. 3B; Supplementary Material, Fig. S4A), lobated nuclei with micronuclei (Fig. 3B) and rare anucleated cells (Supplementary Material, Fig. S4B). Collectively, the frequency of abnormal anaphases was higher in treated cells when compared with control cells (P < 0.05, Fig. 3C). Together, these results demonstrate that SMC1A mutations identified in early adenomas can cause CIN and aneuploidy.

Table 2.

Prediction of mutation effects on SMC1A protein

Patient Amino acid change SIFT Effect 
p.S14P 0.00 Damaging 
p.N101MfsX49 STOP  
p.D207G 0.04 Damaging 
p.K245R 0.22 Tolerated 
p.K454Q 0.76 Tolerated 
p.S653P 0.04 Damaging 
p.L737P 0.05 Damaging 
p.Q827X STOP  
p.N888D 0.6 Tolerated 
10 p.D1036N 0.36 Tolerated 
11 p.L1141F 0.00 Damaging 
Patient Amino acid change SIFT Effect 
p.S14P 0.00 Damaging 
p.N101MfsX49 STOP  
p.D207G 0.04 Damaging 
p.K245R 0.22 Tolerated 
p.K454Q 0.76 Tolerated 
p.S653P 0.04 Damaging 
p.L737P 0.05 Damaging 
p.Q827X STOP  
p.N888D 0.6 Tolerated 
10 p.D1036N 0.36 Tolerated 
11 p.L1141F 0.00 Damaging 
Figure 1.

SMC1A core cohesin gene is frequently mutated in colorectal precancerous lesions. (A) Diagram of SMC1A protein domains with identified mutations. (B) Transfections with vectors carrying the c.2027 A>G, c.2479 C>T and c.3421 C>T SMC1A mutations lead to the overexpression of SMC1A protein 24 h after the transfection. (C) Transfected cells were arrested in mitosis by nocodazole and Giemsa stained and assayed for the occurrence of CIN. (D) siRNA against SMC1A causes the downregulation of SMC1A synthesis. (E) SMC1A silencing leads to high frequency of aneuploidy cells when compared with mock cells.

Figure 1.

SMC1A core cohesin gene is frequently mutated in colorectal precancerous lesions. (A) Diagram of SMC1A protein domains with identified mutations. (B) Transfections with vectors carrying the c.2027 A>G, c.2479 C>T and c.3421 C>T SMC1A mutations lead to the overexpression of SMC1A protein 24 h after the transfection. (C) Transfected cells were arrested in mitosis by nocodazole and Giemsa stained and assayed for the occurrence of CIN. (D) siRNA against SMC1A causes the downregulation of SMC1A synthesis. (E) SMC1A silencing leads to high frequency of aneuploidy cells when compared with mock cells.

Figure 2.

Mutated SMC1A co-immunoprecipitates with the other cohesin subunit in early colorectal adenomas. (A) RAD21 was found to be co-precipitated with both SMC1A and SMC3. (B) No SMC1A and SMC3 signal was detected in the IPs using IgG-coated beads. (C) In addition, SMC1A co-precipitated with RAD21 and SMC3. (D) No SMC3 and RAD21 signal was detected in the IPs using IgG-coated beads.

Figure 2.

Mutated SMC1A co-immunoprecipitates with the other cohesin subunit in early colorectal adenomas. (A) RAD21 was found to be co-precipitated with both SMC1A and SMC3. (B) No SMC1A and SMC3 signal was detected in the IPs using IgG-coated beads. (C) In addition, SMC1A co-precipitated with RAD21 and SMC3. (D) No SMC3 and RAD21 signal was detected in the IPs using IgG-coated beads.

Figure 3.

SMC1A mutations identified in colorectal early adenomas lead to CIN. (A) Examples of metaphase spreads showing gain or chromosome loss following transfection with a vector containing the c.2479 C>T mutation. (B) Imaging of micronuclei and lobated nucleus with a micronucleus in cells transfected with a vector containing the c.3421 C>T mutation. (C) Quantification of abnormal anaphases in both transfected and siRNA-treated cells. *P < 0.05.

Figure 3.

SMC1A mutations identified in colorectal early adenomas lead to CIN. (A) Examples of metaphase spreads showing gain or chromosome loss following transfection with a vector containing the c.2479 C>T mutation. (B) Imaging of micronuclei and lobated nucleus with a micronucleus in cells transfected with a vector containing the c.3421 C>T mutation. (C) Quantification of abnormal anaphases in both transfected and siRNA-treated cells. *P < 0.05.

DISCUSSION

Chromosome missegregation results in loss or gain of chromosomes and it is thought that CIN accelerates the acquisition of a mutator phenotype promoting tumorigenesis (16–18). Here, we identified 11 mutations in the SMC1A gene when the mutational screening was performed in early colorectal adenomas, a precocious step during colorectal cancer development. This is the first evidence that cohesin gene mutations occur in precancerous lesions with high frequency. The observation that mutated SMC1A proteins co-IP with SMC3 and RAD21 cohesin members (Fig. 2A and C) suggests that SMC1A proteins are normally incorporated into the cohesin complex. The majority of identified SMC1A mutations are missense and since SMC1A is an X-linked gene, cohesin dysregulation requires only a single mutational event. In fact, cohesin mutations may contribute to cancer development by acting in a dominant-negative effect manner. As cohesin plays its role as a ring, mutated SMC1A protein can assemble with the other cohesin members to give rise to an inactive cohesin complex.

Notably, mutations in genes that regulate sister chromatid cohesion have been recently identified in human cancers including colorectal carcinoma and myeloid neoplasms (15,19–21). However, by and large, as shown by our colorectal cancer screening and previously published reports, the frequency of cohesin gene mutations was small, ∼5% or less (15,19–21). The observation that SMC1A mutations decreases from early adenomas to colorectal cancers supports the ‘hit and run’ hypothesis according to which cohesin mutations play a role in early stages of tumorigenesis and are not necessary for the maintenance of the malignant phenotype. We propose that the high rate of SMC1A mutations may drive tumorigenesis by triggering additional genetic and epigenetic changes which allow a growth advantage. In addition, we showed that SMC1A mutations cause CIN and aneuploidy, providing a direct link between cohesin mutations, aneuploidy and cancer. In this regard, CIN could be the first determinant of cancer development, permitting different combinations of chromosomes to take place hence providing a substrate for further selection based on a specific set of chromosome content. In summary, we have been able to provide new insight into the role of cohesin in cancer development, and due to its role in chromosome segregation, this pathway is undoubtedly relevant for tumorigenesis.

MATERIALS AND METHODS

Histopathology

Forty-eight early colorectal adenomas and 20 colorectal cancers were retrospectively selected from the files of both the Unit of Surgical Pathology of the Azienda Ospedaliero-Universitaria Pisana and Humanitas Clinical and Research Center. Specimens were surgically obtained and fixed in 10% neutral-buffered formaldehyde and embedded in paraffin. Routine Hematoxylin and Eosin staining was performed on the microtomic section for histopathological examination. Histological diagnosis and pathological features were reviewed independently by experienced pathologists (A.S., F.G., L.L. and P.B.). Histological diagnoses were formulated according to the 2010 World Health Organization (WHO) Classification (4th edition). According to this classification adenomas are defined by the presence of dysplastic epithelium. Dysplasia can be low- or high-grade depending on the degree of architectural complexity, extent of nuclear stratification and severity of abnormal nuclear morphology (22). The most representative paraffin block for each lesion was selected and genomic DNA was isolated from 10 μm sections for amplifying the coding sequences of SMC1A gene. Approval was granted by Azienda Ospedaliero-Universitaria Pisana Ethics Committee.

Mutation analysis for SMC1A

DNA was extracted from embedded paraffin samples by the NucleoSpin® Tissue kit (Macherey-Nagel) according to the manufacturer's protocol. Primer pairs (listed in Supplementary Material, Table S1) were designed to amplify exons, exon–intron boundaries and short flanking intronic sequences. Amplified PCR products were purified (Sigma) and sequenced.

Cell culture

Human primary fibroblasts were grown in Dulbecco's modified Eagle's medium (DMEM, Gibco BRL) supplemented with 10% fetal calf serum and antibiotics in a humidified 5% CO2 atmosphere.

SMC1A cDNA mutagenesis and transfection

The site-directed mutagenesis of the cDNA clone containing SMC1A (OriGene) was performed with QuikChange Site-Directed Mutagenesis Kit (Stratagene) according to the manufacturer's instructions. By this approach, we introduced the c.2027 A>G, c.2479 C>T and c.3421 C>T SMC1A mutations. All mutations were confirmed by sequencing. Transfections were performed by Lipofectamine LTX according to the manufacturer's protocol.

siRNA treatment

Smart pool siRNA against SMC1A was purchased from Dharmacon. Cells (at 40–60% confluence) were transfected with 20 nm si-SMC1A RNA by using Oligofectamine Reagent (Invitrogen). Cells were analyzed for aneuploidy and genome stability 48 h posttransfection.

Cytogenetic analysis

Nocodazole was added to the cultures for 90 min, followed by a 20-min incubation in 0.075 m KCl at 37°C and multiple changes of Carnoy's fixative. Cells were dropped onto cleaned and wet slides. One hundred metaphases were analyzed. Micronuclei, chromosome aneuploidy and aberrations were visualized by staining slides in Giemsa or Propidium Iodide and detected by direct microscope visualization.

Immunocytochemistry

Cells were fixed in 2% paraformaldehyde for 10 min, permeabilized for 5 min on ice in 0.2% Triton X-100 and blocked in PBS with 1% BSA for 30 min at room temperature. Thereafter, cells were incubated with anti-tubulin antibody (Abcam) for 1 h, washed in PBS, 1% BSA and incubated with Alexa Fluor 488-conjugated goat anti-rabbit secondary antibody (Molecular Probes) for 1 h. Nuclei were stained with DAPI.

Co-immunoprecipitation

Whole proteins were extracted from early colorectal adenomas by Qproteome FFPE Tissue kit (Qiagen). Co-IP experiments were performed as previously described (23). Briefly, proteins from total cell extracts were dissolved in 1 ml of incubation buffer. The solution was precleared with 20 μl Dynabeads protein G (Invitrogen) for 1 h. The supernatants were then incubated with 3 μg of anti-SMC1A or RAD21 antibodies coupled to the 40 μl Dynabeads protein G. The loaded suspensions were precipitated, washed four times with incubation buffer and then resuspended in SDS-loading buffer.

Western blotting

Commercially available antibodies used in this study are as follows: anti-SMC1A (Bethyl Laboratories), anti-SMC3 (Bethyl Laboratories), anti-RAD21 (Bethyl Laboratories) and anti-actin (Santa Cruz Biotechnology). Samples were boiled in sample buffer and separated by SDS–PAGE. The proteins were transferred to nitrocellulose membrane (Amersham) and incubated with the primary antibody. After removal of the unbound primary antibody, membranes were incubated with secondary antibody–peroxidase conjugate (Sigma) and processed for detection by chemiluminescence (Amersham) and imaged on Biomax film (Kodak). Actin antibody was used as internal control.

Quantitative real-time PCR analysis

Quantitative real-time PCR (qPCR) was performed using QuantiTecT SYBR Green PCR mix (Qiagen) on the Rotor Gene 3000 (Corbett). Each sample was run in duplicate and repeated at least three times. The primers for qPCR amplifications of the SMC1A were 5′CCAAGCGGCGTATTGATGAA3′ (forward) and 5′ GCATCCATGTTCTTGCCCAA3′ (reverse). HPRT was used as an internal control. The primers for HPRT were 5′AGCCAGACTTTGTTGGATTTG3′ (forward) and 5′TACTAAGCAGATGGCCACAGA3′ (reverse). The results are expressed as fold enrichment relative to control untreated cells.

Statistical analysis

Results were analyzed by Student's t-test. P-values of <0.05 were considered statistically significant.

SUPPLEMENTARY MATERIAL

Supplementary Material is available at HMG online.

Conflict of Interest statement. None declared.

FUNDING

This work was supported by grants from Istituto Toscano Tumori and Associazione Italiana Ricerca sul Cancro to A.M.

REFERENCES

1
Boveri
T
Ueber mehrpolige Mitosen als Mittel zur Analyse des Zellkerns
 , 
1902
 
Vehr. d. phys. med. Ges. zu Wurzburg, N.F available in English translation athttp://8e.devbio.com/article.php?ch=4&id=24 Bd.35
2
Boveri
T.
Gustav Fischer
J.
English Translation the Origin of Malignant Tumors by Boveri
 , 
1914
Baltimore
M. Williams and Wilkins
 
Zur Frage der Entstehung maligner Tumoren 1929
3
Mannini
L.
Menga
S.
Musio
A.
The expanding universe of cohesin functions: a new genome stability caretaker involved in human disease and cancer
Hum Mutat.
 , 
2010
, vol. 
31
 (pg. 
623
-
630
)
4
Xu
H.
Tomaszewski
J.M.
McKay
M.J.
Can corruption of chromosome cohesion create a conduit to cancer?
Nat. Rev. Cancer.
 , 
2011
, vol. 
11
 (pg. 
199
-
210
)
5
Dorsett
D.
Merkenschlager
M.
Cohesin at active genes: a unifying theme for cohesin and gene expression from model organisms to humans
Curr. Opin. Cell Biol.
 , 
2013
, vol. 
25
 (pg. 
327
-
333
)
6
Dorsett
D.
Strom
L.
The ancient and evolving roles of cohesin in gene expression and DNA repair
Curr. Biol.
 , 
2012
, vol. 
22
 (pg. 
R240
-
R250
)
7
Hammoud
S.S.
Cairns
B.R.
Jones
D.A.
Epigenetic regulation of colon cancer and intestinal stem cells
Curr. Opin. Cell Biol.
 , 
2013
, vol. 
25
 (pg. 
177
-
183
)
8
Pino
M.S.
Chung
D.C.
The chromosomal instability pathway in colon cancer
Gastroenterology
 , 
2010
, vol. 
138
 (pg. 
2059
-
2072
)
9
Boland
C.R.
Goel
A.
Microsatellite instability in colorectal cancer
Gastroenterology
 , 
2010
, vol. 
138
 (pg. 
2073
-
2087
e3
10
Heinimann
K.
Toward a molecular classification of colorectal cancer: the role of microsatellite instability status
Front. Oncol.
 , 
2013
, vol. 
3
 pg. 
272
 
11
Kim
S.T.
Xu
B.
Kastan
M.B.
Involvement of the cohesin protein, Smc1, in Atm-dependent and independent responses to DNA damage
Genes Dev.
 , 
2002
, vol. 
16
 (pg. 
560
-
570
)
12
Yazdi
P.T.
Wang
Y.
Zhao
S.
Patel
N.
Lee
E.Y.
Qin
J.
SMC1 is a downstream effector in the ATM/NBS1 branch of the human S-phase checkpoint
Genes Dev.
 , 
2002
, vol. 
16
 (pg. 
571
-
582
)
13
Musio
A.
Montagna
C.
Mariani
T.
Tilenni
M.
Focarelli
M.L.
Brait
L.
Indino
E.
Benedetti
P.A.
Chessa
L.
Albertini
A.
, et al.  . 
SMC1 involvement in fragile site expression
Hum. Mol. Genet.
 , 
2005
, vol. 
14
 (pg. 
525
-
533
)
14
Kitagawa
R.
Bakkenist
C.J.
McKinnon
P.J.
Kastan
M.B.
Phosphorylation of SMC1 is a critical downstream event in the ATM-NBS1-BRCA1 pathway
Genes Dev.
 , 
2004
, vol. 
18
 (pg. 
1423
-
1438
)
15
Barber
T.D.
McManus
K.
Yuen
K.W.
Reis
M.
Parmigiani
G.
Shen
D.
Barrett
I.
Nouhi
Y.
Spencer
F.
Markowitz
S.
, et al.  . 
Chromatid cohesion defects may underlie chromosome instability in human colorectal cancers
Proc. Natl. Acad. Sci. USA
 , 
2008
, vol. 
105
 (pg. 
3443
-
3448
)
16
Musio
A.
Montagna
C.
Zambroni
D.
Indino
E.
Barbieri
O.
Citti
L.
Villa
A.
Ried
T.
Vezzoni
P.
Inhibition of BUB1 results in genomic instability and anchorage-independent growth of normal human fibroblasts
Cancer Res.
 , 
2003
, vol. 
63
 (pg. 
2855
-
2863
)
17
Torres
E.M.
Williams
B.R.
Amon
A.
Aneuploidy: cells losing their balance
Genetics
 , 
2008
, vol. 
179
 (pg. 
737
-
746
)
18
Kolodner
R.D.
Cleveland
D.W.
Putnam
C.D.
Cancer. Aneuploidy drives a mutator phenotype in cancer
. Science
 , 
2011
, vol. 
333
 (pg. 
942
-
943
)
19
Solomon
D.A.
Kim
T.
Diaz-Martinez
L.A.
Fair
J.
Elkahloun
A.G.
Harris
B.T.
Toretsky
J.A.
Rosenberg
S.A.
Shukla
N.
Ladanyi
M.
, et al.  . 
Mutational inactivation of STAG2 causes aneuploidy in human cancer
Science
 , 
2011
, vol. 
333
 (pg. 
1039
-
1043
)
20
Welch
J.S.
Ley
T.J.
Link
D.C.
Miller
C.A.
Larson
D.E.
Koboldt
D.C.
Wartman
L.D.
Lamprecht
T.L.
Liu
F.
Xia
J.
, et al.  . 
The origin and evolution of mutations in acute myeloid leukemia
Cell
 , 
2012
, vol. 
150
 (pg. 
264
-
278
)
21
Kon
A.
Shih
L.Y.
Minamino
M.
Sanada
M.
Shiraishi
Y.
Nagata
Y.
Yoshida
K.
Okuno
Y.
Bando
M.
Nakato
R.
, et al.  . 
Recurrent mutations in multiple components of the cohesin complex in myeloid neoplasms
Nat. Genet.
 , 
2013
, vol. 
45
 (pg. 
1232
-
1237
)
22
Bosman
F.T.
Carneiro
F.
Hruban
R.H.
Theise
N.D.
WHO Classification of Tumours of the Digestive System, 4 edn
 , 
2010
WHO Press, Geneva, Switzerland
23
Gimigliano
A.
Mannini
L.
Bianchi
L.
Puglia
M.
Deardorff
M.A.
Menga
S.
Krantz
I.D.
Musio
A.
Bini
L.
Proteomic profile identifies dysregulated pathways in Cornelia de Lange syndrome cells with distinct mutations in SMC1A and SMC3 genes
J. Proteome Res.
 , 
2012
, vol. 
11
 (pg. 
6111
-
6123
)

Supplementary data