Abstract

DNA damage repair is implicated in neurodegenerative diseases; however, the relative contributions of various DNA repair systems to the pathology of these diseases have not been investigated systematically. In this study, we performed a systematic in vivo screen of all available Drosophila melanogaster homolog DNA repair genes, and we tested the effect of their overexpression on lifespan and developmental viability in Spinocerebellar Ataxia Type 1 (SCA1) Drosophila models expressing human mutant Ataxin-1 (Atxn1). We identified genes previously unknown to be involved in CAG-/polyQ-related pathogenesis that function in multiple DNA damage repair systems. Beyond the significance of each repair system, systems biology analyses unraveled the core networks connecting positive genes in the gene screen that could contribute to SCA1 pathology. In particular, RpA1, which had the largest effect on lifespan in the SCA1 fly model, was located at the hub position linked to such core repair systems, including homologous recombination (HR). We revealed that Atxn1 actually interacted with RpA1 and its essential partners BRCA1/2. Furthermore, mutant but not normal Atxn1 impaired the dynamics of RpA1 in the nucleus after DNA damage. Uptake of BrdU by Purkinje cells was observed in mutant Atxn1 knockin mice, suggesting their abnormal entry to the S-phase. In addition, chemical and genetic inhibitions of Chk1 elongated lifespan and recovered eye degeneration. Collectively, we elucidated core networks for DNA damage repair in SCA1 that might include the aberrant usage of HR.

INTRODUCTION

The molecular pathology of neurodegeneration linked to CAG-polyQ expansion is becoming more complex. Investigation of inclusion body components has supported critical roles for protein degradation systems, including the ubiquitin–proteasome and autophagy systems, in the detoxification of polyQ proteins (1–6), and accumulation of insoluble polyQ proteins at the aggresome has been shown to impair the protein degradation activity of the ubiquitin–proteasome system (7,8). The autophagy system is also impaired by interference with the transcription factor pathway, which includes peroxisome proliferator-activated receptor (PPAR)-γ and PPAR-γ coactivator 1 alpha (9,10). On the other hand, analyses of interacting partners of the soluble forms of polyQ proteins unraveled a major contribution of nuclear dysfunctions such as transcription (11–14), splicing (14–16) and DNA repair (17–20) to the pathology of some polyQ diseases. RNA-mediated pathology has been implicated in some types of spinocerebellar ataxia (SCA) (21–24) that are closely related to polyQ diseases with regard to CAG repeat expansion. Nucleolar stress by expanded CAG RNA regardless of the gene has also been proposed (25). Furthermore, quality control of mitochondria has been implicated in Huntington's disease (HD) (26). Consequently, elucidating the crosstalk network among multiple pathological domains and evaluating its relative significance is becoming more important.

SCA1 is one of nine polyQ diseases caused by the expansion of an unstable CAG trinucleotide repeat, located within the coding region of the respective mutant gene (27). Like the other polyglutamine diseases, various biological abnormalities occur in the SCA1 disease pathology. RBM17, possessing an RNA recognition motif, also called Splicing Factor 45 (SPF45), interacts with the SCA1 disease protein Atxn1 in a polyQ-length-dependent manner (14). The 14-3-3 protein also interacts with a similar C-terminal region of Atxn1 when it is phosphorylated by Akt (28). The binding of 14-3-3 to Atxn1 leads to the dephosphorylation of Atxn1 at Ser776 (29) and plays an important role in the binding of RBM17 (14). The transcriptional repressors CIC/capicua, a Sox2-like high-mobility group (HMG) protein (30) and HBP-1, an HMG-box transcription factor interact with the AXH domain of Atxn1 (31). Retinoic acid receptor-related orphan receptor-alpha, which is involved in Purkinje cell development, is also depleted by mutant Atxn1 (32). Polyglutamine-binding protein-1, a component of the spliceosome (33,34), also interacts with the polyQ tract sequence of Atxn1 and is colocalized with Atxn1 in specific nuclear bodies (13). These interacting partners of Atxn1 strongly suggest that cellar dysfunctions in splicing and transcription induce a variety of downstream events and finally lead to the typical SCA1 phenotype (35).

It is well known that DNA damage repair is tightly linked to transcription (36,37) and splicing (38). DNA damage pauses transcription to allow the repair machinery to restore the availability of genomic DNA for such biological processes in the nucleus (39,40) and affects alternative splicing (41). In addition, DNA double-strand breaks (DSBs) are intentionally created during transcription to relax the coiled double-stranded DNA and to make it accessible to the transcription machinery (42). On the other hand, mutant Atxn1 reduced the expression of the DNA architectural proteins HMGB1/2 that are essential for multiple DNA damage repair mechanisms (19). The Drosophila homolog of RBM17, a binding partner of Atxn1 (14), was also implicated in DNA damage repair (43).

However, DNA damage repair is a complex process and includes multiple types such as DNA double-strand break repair (DSBR), single-strand break repair (SSBR), base-excision repair (BER) and nucleotide-excision repair (NER). Thus it is unknown which type of DNA damage repair or which molecule plays a central role in SCA1 pathogenesis. In this study we addressed these questions systematically, combining an in vivo genetic screen of an hSCA1 Drosophila model and in silico analysis based on systems biology, and unraveled the core of the DNA damage repair network that contributes to the SCA1 pathology in which RpA1 is the hub molecule. Finally, we proved that intervention of the core network actually leads to lifespan elongation in the SCA1 Drosophila model.

RESULTS

DNA damage and repair in SCA1

We previously reported that Ku70, an essential molecule for the non-homologous end-joining type of DSB repair, significantly restores a previously reduced life span and motor performance of human HD Drosophila model (44). Furthermore, we found recently that TERA/VCP/p97, another molecule for DSB repair, is disturbed in multiple polyQ diseases and its supplementation rescues the symptoms in Drosophila models (45). These results prompted us to investigate the abovementioned issues regarding DNA damage repair in the SCA1 pathology.

First, we re-examined the DSB type of DNA damage in mammalian cerebellar neurons expressing mutant Atxn1, because DSB is the common final output of various DNA damage cascades (46–48). This was investigated by analyzing histone 2A (H2AX) phosphorylation at Ser139, a well-known marker of DSBs (49,50), in Atxn1-154Q knockin (KI) mice. Purkinje cells and granule cells showed higher speckled signals (Supplementary Material, Fig. S1A), supporting our expectation. Western blot analysis also revealed that H2AX phosphorylation increased before the onset of symptoms (Supplementary Material, Fig. S1B and C). These results were consistent with our previous result that DSBs are increased in cerebellar neurons of the SCA1 mouse model (45).

Therefore, this paper concentrated on identifying the particular types of DNA repair cascades involved in SCA1 pathogenesis. First, we found that a Drosophila SCA1 model showed pathology similar to mammalian SCA1 pathology. A transgenic fly expressing human Atxn1-82Q in motor neurons by the OK6-Gal4/upstream activating sequence (UAS) system showed increased phosphorylation of the Drosophila H2AX homolog, H2Av (Fig. 1; Supplementary Material, Fig. S2). Cells positive for OK6-driven DsRed, whose localization was consistent with the ventral nerve cord (VNC), showed high signals of γH2Av (Fig. 1). Cells positive for OK6-driven DsRed actually expressed mutant Atxn1 (Supplementary Material, Fig. S2). Given that DSB is the final stage of other types of DNA damage, for example single-strand DNA break and oxidative base damage (46–48), the motor neuron model of SCA1 was considered a good tool to screen DNA damage repair cascades that contribute to the SCA1 pathology.

Figure 1.

DNA double-strand breaks in Atxn1-Tg fly. Atxn1-82Q/DsRed or DsRed alone was expressed in motor neurons by the OK6 driver. Double-strand breaks (DSBs) in thoracic motor neurons and the VNC were examined using a DSB marker γH2Av. Left panels show the increase in γH2Av signals in the VNC compared with the control fly expressing DsRed alone. Flies were dissected at 7–10 days.

Figure 1.

DNA double-strand breaks in Atxn1-Tg fly. Atxn1-82Q/DsRed or DsRed alone was expressed in motor neurons by the OK6 driver. Double-strand breaks (DSBs) in thoracic motor neurons and the VNC were examined using a DSB marker γH2Av. Left panels show the increase in γH2Av signals in the VNC compared with the control fly expressing DsRed alone. Flies were dissected at 7–10 days.

We therefore performed an initial in vivo screening of all available Drosophila homolog DNA repair genes, and tested the effect of their overexpression on the viability and lifespan of hSCA1 Drosophila models. For this purpose, the gene search (GS) system combined with the GAL4/UAS system, which allows the specific overexpression of a gene in a particular cell or neuron (51), was employed.

In the GS system, UAS constructs are randomly integrated into the chromosome. Thus, it was not possible to control the exact distance of the UAS construct to the target gene or obtain identical expression levels in all GS lines. However, the GS system is so far the best method to screen multiple genes with relatively similar expression levels of transgenes, compared with the screening method used previously (52).

In vivo screen of SCA1-related DNA repair gene by virtual eclosion rate

Forty-one Drosophila homolog DNA repair genes were identified from the database, including FlyBase (http://flybase.org/) (Table 1). Of the corresponding GS lines, five were not in stock at the Drosophila Genetic Resource Centre (Kyoto, Japan). Thirty-six GS lines in which the UAS element was located on the 2nd or 3rd chromosome, and three lines in which the UAS element was located on X chromosome were used to screen for virtual eclosion rate (VER) (Table 1). Two lines from the stock were unavailable. These genes were tentatively classified by their roles in DNA repair as described in the database (Table 1). However, it is of note that many of them are involved in multiple types of DNA repair, which will be discussed later.

Table 1.

The table shows relationship between human DNA repair genes and their Drosophila homologs

graphic 
graphic 

Multi-functional RpA1 is tentatively classified as an NER protein.

Initially, we screened the modifier genes by the VER assay, calculating the ratio between the number of male and female flies. The underlying theory is that the Atxn1 gene is on X chromosome, and the ratio between diseased females (UAS-Atxn1-82Q/+: OK6-GAL4/gene-X) and control males (Y/+:OK6-GAL4/gene-X) will reflect the effect of gene-X when compared with the positive control (the ratio in the SCA1 fly). This newly developed method was very easy to perform. Using the method, we could overcome a technical limitation that the eclosion rate could not be calculated directly. First, we found a reduction in VER in UAS-Atxn1-82Q/+: OK6-GAL4/+ Drosophila model (Fig. 2, positive control). In the positive control, the VER female:male ratio (0.42) was similar to the corresponding direct eclosion rate in unpublished data (0.5), and the negative control ratios of Atxn1-82Q negative flies were as expected, with an approximate value of 1, signifying non-toxicity (Fig. 2).

Figure 2.

Genetic screening of DNA repair genes modifying SCA1 by eclosion rate. VER of hSCA1 flies with GS cassette was calculated using the average female:male ratio over 7 days. *P < 0.05 compared with the positive control (UAS-Atxn1-82Q/+;OK6-GAL4/+). BER, base excision repair Drosophila genes; NER, nucleotide excision repair Drosophila genes; DSB, double-strand break repair and recombination repair Drosophila genes; CLR, cross-link repair Drosophila genes; MMR, mismatch repair Drosophila genes; Other, Drosophila genes that are involved in multiple types of DNA repair.

Figure 2.

Genetic screening of DNA repair genes modifying SCA1 by eclosion rate. VER of hSCA1 flies with GS cassette was calculated using the average female:male ratio over 7 days. *P < 0.05 compared with the positive control (UAS-Atxn1-82Q/+;OK6-GAL4/+). BER, base excision repair Drosophila genes; NER, nucleotide excision repair Drosophila genes; DSB, double-strand break repair and recombination repair Drosophila genes; CLR, cross-link repair Drosophila genes; MMR, mismatch repair Drosophila genes; Other, Drosophila genes that are involved in multiple types of DNA repair.

We crossed 36 fly lines of candidate genes (Table 1). The effect of GS line overexpression on the viability of the UAS-Atxn1-82Q/+:OK6-GAL4/+ Drosophila model was analyzed using Welch's t-test (Fig. 2). Three GS lines showed a statistically significant effect on VER recovery when compared to the positive control (UAS-Atxn1-82Q/+:OK6-GAL4/+) in RpA1/RpA70 (P = 0.026), RecQ5 (P = 0.004) and Grp/Chk1 (P = 0.049), respectively (Table 2). These GS lines (RpA70, RecQ5 and Grp/Chk1) represent a single DNA repair mechanism, DSBR. VER was not highly reliable in some molecules like chrac-14 and CG8841/Dmc1 that were toxic for larva and/or pupa (Tables 2 and 4). Other limitations of VER are described in Materials and Methods.

Table 2.

Summary of VER screen is shown

graphic 
graphic 

Average female:male ratio of flies that were born from mating of hSCA1 virgin females and GS lines. The P-value of Welch's t-test represents significant difference of the GS line average ratio from that of the positive control UAS-Atxn1-82Q/+;OK6-GAL4/+.

In vivo screen of drosophila DNA repair gene in lifespan assay

We previously reported a reduced life span in the UAS-Htt103Q/+: OK6-GAL4/+ Drosophila model (44). Overexpression of the human DNA repair gene Ku70 was shown to recover the reduced lifespan in the HD model (44). A homologous but improved approach was employed in this study with the UAS-Atxn1-82Q/+: OK6-GAL4/+ Drosophila model and GS lines to screen all available Drosophila homolog DNA repair genes.

The result showed a reduced lifespan of the positive control UAS-Atxn1-82Q/+:OK6-GAL4/+ (OK6 > Atxn1) (Supplementary Material, Fig. S3) in comparison with negative controls (Atxn1/+ or OK6/+). The overexpression of PNKP, RpA-70, Spn-B, XRCC4, DNA polymerase eta, DNA polymerase epsilon, CycH and Per in GS lines recovered reduced lifespan of the SCA1 model fly (Fig. 3A). In most of these genes, the survival rate was improved from young stage to aged stage of adult fly. For instance, at 21 days, 75% of the positive control (UAS-Atxn1-82Q/+: OK6-GAL4/+) flies were alive, whereas in such GS lines demonstrated higher survival percentages: 85% (Spn-B), 92% (XRCC4/CG12728), 86% (DNA polymerase eta) and 83% (CycH), respectively (Fig. 3A, Supplementary Material, Fig. S3). Their survival rates remained higher than that of the SCA1 model fly after 30 days (Fig. 3A). The maximum lifespan was also remarkably elongated by RpA1, Per, Spn-B and XRCC4/CG12728 (Fig. 3A, Supplementary Material, Fig. S3). Statistical evaluation with Wilcoxon's test supported the difference in lifespan (Table 3). Human homolog of these genes are shown in the list (Table 1) and the comparison between VER and lifespan assays are also shown (Table 4). Only RpA1 improved both VER and lifespan phenotypes (Table 4).

Table 3.

Average lifespan of flies co-expressing human Atxn1-82Q and GS line cassette-driven DNA damage repair gene (OK6 > Atxn1-82Q;GS)

graphic 
graphic 

The P-value in Wilcoxon's rank sum test was used to judge difference from OK6 > Atxn1-82Q flies.

Table 4.

Summary of the results in VER and lifespan tests

graphic 
graphic 

The red color indicates improvement and blue color indicates worsening of the phenotype compared with that of OK6 > Atxn1-82Q flies.

Figure 3.

Genetic screening of DNA repair genes modifying SCA1 by lifespan. (A) Survival curves of GS/UAS-Atxn1-82Q/OK6-GAL4 flies that had a longer lifespan than that of the SCA1 model fly (OK6 > Atxn1). (B) Survival curves of GS/UAS-Atxn1-82Q/OK6-GAL4 flies that had a shorter lifespan than that of the SCA1 model fly (OK6 > Atxn1). Positive control: UAS-Atxn1-82Q/+;+/OK6-GAL4;+/+ (OK6 > Atxn1).

Figure 3.

Genetic screening of DNA repair genes modifying SCA1 by lifespan. (A) Survival curves of GS/UAS-Atxn1-82Q/OK6-GAL4 flies that had a longer lifespan than that of the SCA1 model fly (OK6 > Atxn1). (B) Survival curves of GS/UAS-Atxn1-82Q/OK6-GAL4 flies that had a shorter lifespan than that of the SCA1 model fly (OK6 > Atxn1). Positive control: UAS-Atxn1-82Q/+;+/OK6-GAL4;+/+ (OK6 > Atxn1).

GS lines are generally expected to provide a constant expression level of each screened gene. However, UAS cassette was integrated into the genome at random. Hence, by using the database (http://gsdb.biol.se.tmu.ac.jp/~dclust/cgi-bin/site_serch_first.cgi?CLNLIBID=2&UID=2&M_UID=1) we checked the localization of UAS in relevance to the target genes that were selected from our screen (Table 5). Unexpectedly, UAS cassette was located only in the downstream of the RpA70 gene. In this case, three explanations will be possible for the positive effect on lifespan. The first one is that anti-sense RNA was produced by UAS cassette to suppress RpA70. The second one was that GAL4 binding to UAS acted as an enhancer for endogenous promoter of RpA70. The third one was a positional effect of integration that might not be related to RpA70. To test these possibilities, we performed real-time PCR and western blot to analyze mRNA and protein levels of RpA70. The mRNA and protein levels of RpA70 were both increased (Supplementary Material, Fig. S4A–C), indicating that GAL4 enhanced expression of RpA70 from endogenous promoter. In addition, real-time PCR revealed expression of mutant Atxn1 was equivalent in OK6 > Atxn1 fly and OK6 > Atxn1;RpA70 fly (Supplementary Material, Fig. S4D).

Table 5.

Integration sites of P-element-based GS vector in fly lines used for the screen

 Human gene Drosophila gene Chr GS line DGRC no. vector Location Distance from 5′ end of mRNA 
BER MBD4 tou 2R 16 324 206 588 GSV6 Intron, upstream +10 684, −22 512, −21 490 
18 086 200 898 GSV6 Intron, upstream +1478, −317 118, −30 696 
LIG3 lig3 3R 9746 202 035 GSV6 Upstream −134 
PNKP CG9601 3R 21 535 202 883 GSV7 Upstream −6368 
FEN1 (DNaseIV) Fen1 2R 9817 202 099 GSV6 Upstream −786 
NER XPC mus210 2R 13 949 205 625 GSV6 Upstream −32 
ERCC1 Ercc1 2R 20 656 201 743 GSV7 Upstream −3851 
LIG1 DNA-ligI 2R 20 555 201 604 GSV7 Upstream −318 
GTF2H2 Ssl1 3L 20 889 202 070 GSV7 Upstream −941 
GTF2H4 Tfb2 (mrn) 3L 8019 201 318 GSV3 5′UTR +167 
MMS19L (MMS19) Mms19 3R 20 566 201 618 GSV7 Upstream −515 
ERCC5 (XPG) Chrac-14 2L 16 203 206 524 GSV6 Upstream −12 440 
XAB2 (HCNP) CG6197 2R 51 333 207 303 GSV2 Upstream −209 
ERCC2 Xpd 2R 36 200 017 GSV1 5′UTR, upstream +32, −3 
DSBR RPA1 RpA-70 3R 10 684 202 753 GSV6 Downstream +2757 
DMC1 CG8841 2R 10 988 202 983 GSV6 Intron, 5′UTR +23, 0, +166 
RAD50 rad50 2R 7243 205 114 GSV2 Upstream −709 
XRCC3 spn-B 3R 13 042 204 470 GSV6 Upstream −53 
GEN1 Gen 3L 21 003 202 248 GSV7 Upstream −428 
G22P1 (Ku70) Irbp 3R 10 368 202 512 GSV6 Upstream −227 
RECQL5 RecQ5 3L 9658 201 957 GSV6 Upstream −504 
ATM tefu 3R 20 121 201 149 GSV7 Upstream −547 
MUS81 mus81 1026 200 063 GSV1 5′UTR +21 
XRCC4 CG12728 20 801 201 938 GSV7 Upstream −3424 
EME1 (MMS4L) mms4 2R 22 070 203 611 GSV7 Upstream −177 
DSBR + CLR TDP1 gkt 2L 50 611 207 078 GSV2 Upstream −15 151 
MMR PMS2 Pms2 2R 10 168 202 351 GSV6 5′UTR +49 
MSH6 Msh6 3L 13 002 204 438 GSV6 5′UTR +25 
Other PCNA mus209 2R 15 324 206 170 GSV6 5′UTR, upstream +5, −42 
SPO11 mei-W68 2R 10 670 202 741 GSV6 Intron +964 
CCNH CycH 3L 9043 201 479 GSV6 Upstream −48 
CHEK1 grp 2L 22 185 203 748 GSV7 5′UTR, intron, upstream +661, +5792, −9685 
POLD1 DNApol-delta 3L 20 870 202 043 GSV7 Upstream −457 
POLE DNApol-epsilon 3R 9667 201 966 GSV6 Upstream −1111 
POLH DNApol-eta 3L 15 067 206 066 GSV6 Upstream −558 
RAD18 CG5524 3R 21 013 202 255 GSV7 Upstream −482 
UBE2A (RAD6A) UbcD6 3R 22 499 204 073 GSV7 Upstream −16 
PER1 per 20 805 201 949 GSV7 Upstream −25 
OBFC2B CG5181 2L 11 373 205 293 GSV6 Upstream −8877 
BLM MUS309 (Blm) 3R 12 928 204 381 GSV6 Upstream −313 
 Human gene Drosophila gene Chr GS line DGRC no. vector Location Distance from 5′ end of mRNA 
BER MBD4 tou 2R 16 324 206 588 GSV6 Intron, upstream +10 684, −22 512, −21 490 
18 086 200 898 GSV6 Intron, upstream +1478, −317 118, −30 696 
LIG3 lig3 3R 9746 202 035 GSV6 Upstream −134 
PNKP CG9601 3R 21 535 202 883 GSV7 Upstream −6368 
FEN1 (DNaseIV) Fen1 2R 9817 202 099 GSV6 Upstream −786 
NER XPC mus210 2R 13 949 205 625 GSV6 Upstream −32 
ERCC1 Ercc1 2R 20 656 201 743 GSV7 Upstream −3851 
LIG1 DNA-ligI 2R 20 555 201 604 GSV7 Upstream −318 
GTF2H2 Ssl1 3L 20 889 202 070 GSV7 Upstream −941 
GTF2H4 Tfb2 (mrn) 3L 8019 201 318 GSV3 5′UTR +167 
MMS19L (MMS19) Mms19 3R 20 566 201 618 GSV7 Upstream −515 
ERCC5 (XPG) Chrac-14 2L 16 203 206 524 GSV6 Upstream −12 440 
XAB2 (HCNP) CG6197 2R 51 333 207 303 GSV2 Upstream −209 
ERCC2 Xpd 2R 36 200 017 GSV1 5′UTR, upstream +32, −3 
DSBR RPA1 RpA-70 3R 10 684 202 753 GSV6 Downstream +2757 
DMC1 CG8841 2R 10 988 202 983 GSV6 Intron, 5′UTR +23, 0, +166 
RAD50 rad50 2R 7243 205 114 GSV2 Upstream −709 
XRCC3 spn-B 3R 13 042 204 470 GSV6 Upstream −53 
GEN1 Gen 3L 21 003 202 248 GSV7 Upstream −428 
G22P1 (Ku70) Irbp 3R 10 368 202 512 GSV6 Upstream −227 
RECQL5 RecQ5 3L 9658 201 957 GSV6 Upstream −504 
ATM tefu 3R 20 121 201 149 GSV7 Upstream −547 
MUS81 mus81 1026 200 063 GSV1 5′UTR +21 
XRCC4 CG12728 20 801 201 938 GSV7 Upstream −3424 
EME1 (MMS4L) mms4 2R 22 070 203 611 GSV7 Upstream −177 
DSBR + CLR TDP1 gkt 2L 50 611 207 078 GSV2 Upstream −15 151 
MMR PMS2 Pms2 2R 10 168 202 351 GSV6 5′UTR +49 
MSH6 Msh6 3L 13 002 204 438 GSV6 5′UTR +25 
Other PCNA mus209 2R 15 324 206 170 GSV6 5′UTR, upstream +5, −42 
SPO11 mei-W68 2R 10 670 202 741 GSV6 Intron +964 
CCNH CycH 3L 9043 201 479 GSV6 Upstream −48 
CHEK1 grp 2L 22 185 203 748 GSV7 5′UTR, intron, upstream +661, +5792, −9685 
POLD1 DNApol-delta 3L 20 870 202 043 GSV7 Upstream −457 
POLE DNApol-epsilon 3R 9667 201 966 GSV6 Upstream −1111 
POLH DNApol-eta 3L 15 067 206 066 GSV6 Upstream −558 
RAD18 CG5524 3R 21 013 202 255 GSV7 Upstream −482 
UBE2A (RAD6A) UbcD6 3R 22 499 204 073 GSV7 Upstream −16 
PER1 per 20 805 201 949 GSV7 Upstream −25 
OBFC2B CG5181 2L 11 373 205 293 GSV6 Upstream −8877 
BLM MUS309 (Blm) 3R 12 928 204 381 GSV6 Upstream −313 

The GS cassette includes the UAS, core promoter and the marker gene ‘mini-white’.

Controversial effects of Chk1 on VER and lifespan

Unexpectedly, we found that 12 genes further shortened lifespan of the SCA1 model fly (Fig. 3B). These genes were Lig1, Lig3, Fen1, chrac-14, XAB2, Xpd, RecQ5, mus81, EME1, meiW68, mus309/BLM/RecQ2 and grp, and they were not categorized to a specific type of DNA damage repair. Most of the genes were toxic only when they were overexpressed in adult fly (Table 4). However, Grp/Chk1 and RecQ5 improved VER during development but had negative effects on lifespan of adult fly (Tables 3 and 4). It is known that Chk1 ordinarily phosphorylates histone H3-Thr11 to remodel chromatin and activate transcription. When genomic DNA is damaged, Chk1 is phosphorylated by ATR and inactivates transcription (53). Actually by our previous proteome analysis of nuclear proteins, increased phosphorylation of Chk1 was detected in primary neurons under the polyQ disease pathology (19). In this study, we also detected increased DNA damage in motor neurons of the SCA1 model fly (Fig. 1). Therefore, overexpression of Chk1 in mature neurons of adult disease fly might accelerate transcriptional repression and subsequent cellular processes including cell death. On the other hand, non-phosphorylated and cell-protective Chk1 might be more active in immature neurons of larva or pupa.

RecQ family proteins are highly conserved from bacteria to human, which possess 3′–5′ DNA helicase activity. It is of note that two RecQ proteins had a negative effect on lifespan (Fig. 3B) among five members in human: recQ1, mus309/BLM/RecQ2, WRN/RecQ3, RecQ4 and RecQ5. Especially, RecQ5 was shown to have DNA-strand annealing activity that is suppressed by RpA1 (54), consistently with the reverse actions of ReQ5 and RpA70. Together with the finding that two DNA ligases, Lig1 and Lig3, worsened the lifespan shortening (Fig. 3B), accelerated restructuring of genomic DNA in damaged regions seems unfavorable for neurons.

We previously reported therapeutic effect of Ku70 on the lifespan of mutant huntingtin transgenic fly (44). However, Irbp GS line expressing the Ku70 homolog did not substantially recover the lifespan shortening of UAS-Atxn1-82Q/+:OK6-GAL4/+ Drosophila model (Supplementary Material, Fig. S3C, Table 3) although transgenic co-expression of human Ku70 had a small but definitely positive effect on the lifespan of the same model (Supplementary Material, Fig. S5). The discrepant effects of Ku70 on HD and SCA1 models suggested that quantitatively or qualitatively different DNA damage repair molecules are utilized in two polyQ disease pathologies.

Core DNA repair networks of SCA1 elucidated by systems biology

Next, we analyzed the results obtained in the screening using systems biology. We integrated quantitative data in the recovery by DNA repair genes and protein–protein interaction (PPI) data (BIND, BIOGRID, Cognia, DIP, INTACT, Interactome studies, MINT and MIPS) to identify core molecular networks that induced lifespan shortening or elongation in the SCA1 model flies. At the same time, we tried to discover new molecules in the network that could affect the lifespan of Drosophila SCA model flies.

We used two types of algorithm for this purpose. The first network (Network-1) selected protein pathways from the PPI database when two gene products affected the lifespan directly (one segment) or via another protein (two segment). Proteins linked to a higher number of proteins were localized near the center of the map in Network-1. The second network (Network-2) selected closed triangle pathways from the PPI database when one to three lifespan-affecting proteins were components of the triangle protein pathways. The rest of the lifespan-affecting proteins were linked to the deduced network if possible. Using these two methods, we analyzed the functional relationships of lifespan-elongating genes and lifespan-shortening genes selected from DNA damage repair-related genes by our in vivo screening.

The algorithm for Network 1 is useful for accentuating critical gene groups contributing to lifespan elongation. In this lifespan-elongation Network-1 (two-segment), RpA1 was located at the center and linked to multiple DNA damage repair or transcription-related proteins (Fig. 4A). In this analysis, determinant genes are located in the periphery of the network. The genes linked to RpA1 could be classified to several groups that critically regulate specific types of DNA repair or transcription. The first group linked to X-ray repair cross-complementing protein (XRCC) 4 (blue circle in Fig. 4A) were clearly related to non-homologous end-joining (NHEJ). The second group, connected to bifunctional polynucleotide phosphatase/kinases (PNKPs) such as XRCC1, ligase 3 (LIG3) and poly ADP ribose polymerase (PARP), was involved in the backup pathway of NHEJ (B-NHEJ) in addition to SSBR, BER or NER (purple circle in Fig. 4A). Surprisingly, the third group, linked to XRCC3 (red circle in Fig. 4A) was related to homologous recombination (HR), which functions to repair DSBs in the duplicating genome. The connotations of this shall be discussed later.

Figure 4.

Network analysis of lifespan-elongating genes. (A) DNA damage repair network-1 to elongate the lifespan of the SCA1 fly model as predicted by ingenuity-IPA using the human PPI database. Genes linked to RpA1 are classified into three groups: genes related to NHEJ-type DSBR (blue circle), genes related to HR-type DSBR (red circle), genes related to NER and BER (purple circle) and genes related to transcription (green circle). XRCC6 (Ku70) is discriminated in this analysis from the Ku70/Ku80 complex (Ku double circle). In the purple circle, XRCC1 and LIG3 are related to SSBR and BER. PARP1 is related to SSBR and NER. XRCC1, LIG3 and PARP1 are also involved in another type of DSBR (B-NHEJ). (B) DNA damage repair network-2 to elongate the lifespan of the SCA1 fly model as predicted by ingenuity-IPA using the human PPI database.

Figure 4.

Network analysis of lifespan-elongating genes. (A) DNA damage repair network-1 to elongate the lifespan of the SCA1 fly model as predicted by ingenuity-IPA using the human PPI database. Genes linked to RpA1 are classified into three groups: genes related to NHEJ-type DSBR (blue circle), genes related to HR-type DSBR (red circle), genes related to NER and BER (purple circle) and genes related to transcription (green circle). XRCC6 (Ku70) is discriminated in this analysis from the Ku70/Ku80 complex (Ku double circle). In the purple circle, XRCC1 and LIG3 are related to SSBR and BER. PARP1 is related to SSBR and NER. XRCC1, LIG3 and PARP1 are also involved in another type of DSBR (B-NHEJ). (B) DNA damage repair network-2 to elongate the lifespan of the SCA1 fly model as predicted by ingenuity-IPA using the human PPI database.

The fourth group, linked to cyclin H (CCNH; green circle in Fig. 4A), was mainly involved in transcription. Inputs to RpA1 came from multiple proteins, including PARP1, RAD51, TOPBP1, Cdk and Ku70, while the output was only to ATR, suggesting that RpA1 is a functional target of such gene groups and that RpA1 is essential for multiple systems of DSB repair and transcription as a hub molecule. The result was consistent with the notion that RpA1 plays the most critical role in the protection of single-stranded DNA produced during various types of DNA damage repair and transcriptional interruption, and accounted for why RpA1 had the most profound effect on the recovery of SCA1 fly phenotypes.

Network-2 enucleated dense interactions among selected genes from screening (Fig. 4B). The tumor protein TP53, hepatocyte nuclear factor 4 alpha (HNF4A) and Myc were connected to many proteins, and were suggested to be involved in multiple systems that contribute to lifespan elongation. Interestingly, according to the Allen Brain Atlas (http://developingmouse.brain-map.org/data/Hnf4a/100093888/thumnails.html), HNF4A is expressed in the adult cerebellar cortex. HNF4A is a transcription factor that interacts with CREB-binding protein and regulates gene expression, including that of cytochrome P450 3A4 (CYP3A4), which is essential for the metabolism of xenobiotics (55). Hence, HNF4A might regulate many systems that elongate lifespan in the SCA1 model fly (Fig. 4B). However, HNF4A by itself was not positive in the screening, and multiple paths were necessary to the positive genes (Fig. 4B). Hence, HNF4A can be considered an indirect modulator.

In the lifespan-shortening Network-1, FEN1, LIG1, Chk1 and BLM were located at the center and linked to multiple proteins (Fig. 5A). Interestingly, RpA1 was again located at the center and connected to BLM and FEN1, thus RpA1 could be affected by them (Fig. 5A, red circle). In the lifespan-shortening Network-2, similar genes were selected as the main players (Fig. 5B). RPA (a complex including RpA1 and RpA2) sends suppressive signals to FEN1 and LIG1 directly or indirectly, while RpA1 receives feedback from FEN1. ATM, ATR and RNA polymerase II, related to DSB repair, were linked to one or more of FEN1, LIG1, Chk1 and BLM. It is not clear why these DNA repair systems yielded unfavorable effects in the SCA1 model fly. However, one possible explanation is the competitive relationship amongst DNA damage repair systems, as suggested previously (56).

Figure 5.

Network analysis of lifespan-shortening genes. (A) DNA damage repair network-1 to shorten the lifespan of the SCA1 fly model as predicted by Ingenuity-IPA using the human PPI database. Chk1 (blue circle) receives numerous signals from the hub genes worsening the lifespan. RpA1 (red circle) is connected to the hub genes BLM and FEN1. (B) DNA damage repair network-2 to shorten the lifespan of the SCA1 fly model as predicted by ingenuity-IPA using the human PPI database.

Figure 5.

Network analysis of lifespan-shortening genes. (A) DNA damage repair network-1 to shorten the lifespan of the SCA1 fly model as predicted by Ingenuity-IPA using the human PPI database. Chk1 (blue circle) receives numerous signals from the hub genes worsening the lifespan. RpA1 (red circle) is connected to the hub genes BLM and FEN1. (B) DNA damage repair network-2 to shorten the lifespan of the SCA1 fly model as predicted by ingenuity-IPA using the human PPI database.

Involvement of HR-DSBR molecules in SCA1 pathology

Molecular networks of the lifespan-elongating genes predicted from systems biology analyses (Fig. 4A and B) included several new subgroups of DNA damage repair genes that had not been focused on previously. In particular, RpA1 is critical for the protection of naked single-stranded DNA produced after various types of DNA damage, and RpA1-sealed DNA is frequently repaired by HR using BRCA2 and RAD51 (Supplementary Material, Fig. S6). To examine the possible involvement of the RpA1/BRCA2/RAD51 network (Supplementary Material, Fig. S6), the most important pathway for HR-dependent DSBR, in the SCA1 pathology, we tested whether mutant Atxn1 could physically interact with the components of the RpA1 in the BRCA2/RAD51 pathway in a mammalian cell line (Fig. 6A–C, Supplementary Material, Fig. S7).

Figure 6.

Atxn1 interacts with RpA1. IP assays were performed to test the link from Atxn1 to the RpA/BRCA network predicted by systems biology. (A and B) The interaction between Atxn1 and RpA1 was tested by an immunoprecipitation assay. Different sets of plasmids were transfected into HeLa cells (lanes 1–6). In (A), cell lysates were precipitated by the anti-Atxn1 antibody and the precipitates were blotted by anti-RpA1 antibody. In (B), the reverse experiment was performed. (C) Cerebellar tissues from mutant Atxn1-KI (KI) and non-transgenic littermate (Wt) mice were subjected to immunoprecipitation with anti-RpA1 or anti-Atxn1 antibody. The precipitates were blotted with anti-Atxn1 or anti-RpA1 antibody, respectively. Mutant Atxn1 interacted with RpA1 at a higher affinity than normal Atxn1.

Figure 6.

Atxn1 interacts with RpA1. IP assays were performed to test the link from Atxn1 to the RpA/BRCA network predicted by systems biology. (A and B) The interaction between Atxn1 and RpA1 was tested by an immunoprecipitation assay. Different sets of plasmids were transfected into HeLa cells (lanes 1–6). In (A), cell lysates were precipitated by the anti-Atxn1 antibody and the precipitates were blotted by anti-RpA1 antibody. In (B), the reverse experiment was performed. (C) Cerebellar tissues from mutant Atxn1-KI (KI) and non-transgenic littermate (Wt) mice were subjected to immunoprecipitation with anti-RpA1 or anti-Atxn1 antibody. The precipitates were blotted with anti-Atxn1 or anti-RpA1 antibody, respectively. Mutant Atxn1 interacted with RpA1 at a higher affinity than normal Atxn1.

As expected, an immunoprecipitation (IP) assay in HeLa cells revealed that exogenously expressed Atxn1 interacted with co-expressed RpA1 (Fig. 6A and B) and that Atxn1 interacted with endogenous BRCA1 weakly (Supplementary Material, Fig. S7A) and BRCA2 strongly (Supplementary Material, Fig. S7B). The in vivo interaction between Atxn1 and RpA1 was also confirmed using Atxn1-KI and non-transgenic littermate mice (Fig. 6C). Immunohistochemistry of the mutant Atxn1-KI mouse brain also revealed co-localization of RpA1 and Atxn1 (Supplementary Material, Fig. S8) as well as that of BRCA1 and Atxn1 (Supplementary Material, Fig. S9) in Purkinje cells. It has been reported that resistant cortical neurons form inclusion bodies, while vulnerable Purkinje cells do not, in Atxn1-KI mice (57). BRCA1 was sequestered to such inclusion bodies of cortical neurons, while BRCA1 and mutant Atxn1 were homogenously distributed and co-localized in the nuclei of Purkinje cells (Supplementary Material, Fig. S9). BRCA2 and Atxn1 were also partially co-localized in the nuclear foci of Purkinje cells (Supplementary Material, Fig. S10). Interestingly, RpA2, forming the RpA complex with RpA1, was located predominantly in the cytoplasm of neurons (data not shown) like RpA1 (Supplementary Material, Fig. S8) under normal conditions.

These results suggest that mutant Atxn1 might disturb the dynamism of RpA1 and its partner BRCA1/2, thereby impairing their DNA damage repair function (Supplementary Material, Fig. S7D). Therefore, we directly examined the subnuclear dynamism of RpA1 in response to linear DNA DSBs in U2OS cells expressing mutant Atxn1 (Fig. 7A). In comparison with control DsRed-expressing or Atxn1-33Q-DsRed-expressing cells, the accumulation of RpA1-EGFP at the site of linear DNA damage was delayed in Atxn1-86Q-DsRed-expressing cells (Fig. 7A). Interestingly, the signal intensity of RpA1 decreased after 7 min of DNA damage induction, suggesting that RpA1 is stored in two compartments. Presumably, mobilization of RpA1 from the fast compartment is partially inhibited, and release from the late compartment is more profoundly disturbed by interaction with mutant Atxn1. This hypothesis is supported by the finding that RpA1 was sequestered to the nuclear inclusion bodies of Purkinje cells in mutant Atxn1-KI mice (Supplementary Material, Fig. S8). Moreover, RpA1 actually mitigated DSBs by mutant Atxn1 in Drosophila motor neurons without affecting the aggregates of mutant Atxn1 (Supplementary Material, Fig. S11). These results support the notion that mutant Atxn1 impairs the dynamism of the hub molecule RpA1 and influences multiple groups of DNA damage repair molecules.

Figure 7.

Mutant Atxn1 disturbs the recruitment of RpA1 to DNA damage foci. (A) Linear DSB lesions induced by high-energy UVA in U2OS cells expressing Atxn1-86Q-DsRed, and the accumulation of VCP-EGFP to the linear DSB lesion was observed in comparison to Atxn1-33Q-DsRed-expressing cells or DsRed-expressing cells. (B) Quantitative analysis of the EGFP signals in the linear DSB lesion from 0 to 10 min after micro-irradiation. NFU: normalized fluorescence unit.

Figure 7.

Mutant Atxn1 disturbs the recruitment of RpA1 to DNA damage foci. (A) Linear DSB lesions induced by high-energy UVA in U2OS cells expressing Atxn1-86Q-DsRed, and the accumulation of VCP-EGFP to the linear DSB lesion was observed in comparison to Atxn1-33Q-DsRed-expressing cells or DsRed-expressing cells. (B) Quantitative analysis of the EGFP signals in the linear DSB lesion from 0 to 10 min after micro-irradiation. NFU: normalized fluorescence unit.

Inhibition of Chk1-mediated DNA damage signaling recovers lifespan

From the lifespan-shortening gene network (Fig. 3C and D), we found that Chk1 received multiple signals from BLM, FEN1 and LIG1 either directly or indirectly, and that Chk1 enhances lifespan shortening of the SCA1 model fly. The screening and informatics results strongly suggested that Chk1, one of the most important transducers of DNA damage signaling, plays a critical role in SCA1 pathology. Therefore, we finally tested whether inhibition of the Chk1-mediated signal mitigates lifespan shortening in the SCA1 fly.

We used a specific inhibitor of Chk1 (CHIR-124) and added it to the food (corn-meal medium) for adult Drosophila at multiple concentrations. At 0.00016 and 0.02 mg/ml, lifespan shortening of the OK6 > SCA1 fly was improved (Fig. 8A), and the effect was more remarkable at the higher concentration (Fig. 8A).

Figure 8.

Inhibition of Chk1 recovers lifespan shortening and eye degeneration. (A) Chk1 inhibitor (CHIR-124) ameliorates the lifespan shortening of the OK6 > SCA1 fly at 20 μg/ml in food (P = 0.0304). Statistical analysis of the mean lifespan was performed by log-rank test. (B) Genetic interaction of Chk1/grp and Atxn1 was tested by rough eye phenotype. GS line flies or UAS-RNAi transgenic flies were mated with GMR > Atxn1-82Q fly. Chk1 knockdown ameliorated while Chk1 overexpression accelerated eye degeneration. RpA70 overexpression ameliorated and RpA70 knock down accelerated the eye phenotype.

Figure 8.

Inhibition of Chk1 recovers lifespan shortening and eye degeneration. (A) Chk1 inhibitor (CHIR-124) ameliorates the lifespan shortening of the OK6 > SCA1 fly at 20 μg/ml in food (P = 0.0304). Statistical analysis of the mean lifespan was performed by log-rank test. (B) Genetic interaction of Chk1/grp and Atxn1 was tested by rough eye phenotype. GS line flies or UAS-RNAi transgenic flies were mated with GMR > Atxn1-82Q fly. Chk1 knockdown ameliorated while Chk1 overexpression accelerated eye degeneration. RpA70 overexpression ameliorated and RpA70 knock down accelerated the eye phenotype.

These results indicate that the Chk1 inhibitor could mitigate lifespan shortening in the adult SCA1 fly. The 35% longer lifespan in the fly treated with 0.02 mg/ml CHIR-124 provides an adequate rationale to extend our research to mammalian experiments and possibly to human clinical trials in the future.

Moreover, we tested genetic interaction between Chk1/grp and Atxn1 (Fig. 8B). We expressed grp or grp-RNAi together with Atxn1-82Q in photoreceptor cells using the GMR-Gal4 driver. GS line was used for overexpression, while UAS-grp-RNAi transgenic fly was used for knockdown. Grp-RNAi expression mildly ameliorated the phenotype while grp overexpression remarkably accelerated eye degeneration (Fig. 8B).

In parallel, we further tested genetic interaction of RpA1/RpA70 in eye degeneration by mutant Atxn1. We similarly expressed RpA70 or RpA70-RNAi together with Atxn1-82Q in photoreceptor cells using the GMR-Gal4 driver. Co-expression of RpA70 clearly rescued the rough eye phenotype, while the knock down worsened the phenotype (Fig. 8B). As the therapeutic effect of RpA70 is critical for therapeutic development, we further confirmed it with scanning electron microscope (Supplementary Material, Fig. S12). The expression level of Atxn1-82Q was not affected by the steal effect of UAS-RpA70, as we have described (Supplementary Material, Fig. S4).

In summary, these results in wet biological analyses verified the hypothesis obtained from dry systems biology analyses. Hence, we concluded that the systemic study with Drosophila genetics uncovered novel core networks of DNA damage repair genes responsible for the SCA1 disease pathology.

Abnormal cell cycle in Purkinje cells

Finally, we investigated why RpA1 was effective in SCA1 pathology. As shown in Figure 4A, RpA1 is linked to multiple DNA damage repair pathways, which include NHEJ type of DSBR, HR type of DSBR, NER and BER. RpA1 is basically a sealer of naked single-stranded DNA (Supplementary Material, Fig. S6) and contributes to HR, NER and BER, which mainly take place in proliferating cells.

Therefore, possible explanations of the effect of RpA1 would be (i) RpA1 contributes to non-cell-autonomous pathology via glial cells, including Bergmann glia or astrocytes; (ii) RpA1 contributes to stem cell pathology via embryonic or adult stem cells; and (iii) RpA1 contributes to DNA damage repair in Purkinje cells in abnormal cell cycle stages. The first possibility was suspected in analogy to the non-cell-autonomous pathology of amyotrophic lateral sclerosis (58–61) or from the result suggesting the involvement of Bergmann glia in SCA1 pathology (62). The second possibility was also suspected from the previous observation that ROR alpha affects Purkinje cells during development in the SCA1 pathology (32). The third possibility involves the well-known concept of an abnormal cell cycle in neurodegenerative disorders, where affected neurons enter the S phase (63).

To test these three possibilities, we searched for proliferating or S-phase cells in the cerebellum. We injected BrdU into adult mice at 32 weeks and analyzed the uptake in different types of cells. We found that deteriorating Purkinje cells, which were weakly stained by anti-calbindin antibody, took up BrdU (Supplementary Material, Fig. S13), supporting possibility (iii). Regarding possibility (i) and (ii), we performed double staining of BrdU and a stem cell marker Sox2 in order to identify adult neural stem cells in the cerebellum that are not yet clearly understood (64). Interestingly, a few double-positive cells were found in white matter and molecular layer of the cerebellar cortex (Supplementary Material, Fig. S13). Bergmann glia did not take up BrdU. In addition, γH2AX signals were not increased in Sox2-positive Bergmann cells (Supplementary Material, Fig. S14). These results do not support the abovementioned possibilities (i) and (ii). Collectively, we conclude that abnormal entry into the S phase in Purkinje cells might allow extraordinary usage of HR with RpA1 for DNA damage repair in Purkinje cells.

DISCUSSION

In this in vivo screen of DNA damage repair genes, eight genes, including multi-functional RpA70/RpA1 involved in DSBR and NER, BER/NER/DSBR-related CG9601/PNKP, and the XRCC4 DNA ligase homolog CG12728 for NHEJ, were shown to improve the lifespan of an hSCA1 Drosophila model. It was also shown that overexpression of three genes (RpA70, RecQ5 and Grp/Chk1) led to the recovery of the developmental phenotype in the hSCA1 Drosophila model. Considering the basic functions of these positive genes, these experiments show that DSBR, NER and BER are involved in the SCA1 pathology in different ways from the developmental stages to adulthood. Therefore, this is the first report to suggest a relevance for DNA damage repair in the SCA1 disease pathology. The relevance of BER in CAG/polyQ disease has not been reported, although NER has been implicated in CAG triplet repeat instability (65).

Moreover, beyond this simple expectation, this study unraveled a core network and key molecules across these repair systems by integrating the results of an in vivo genetic screen with systems biology. The systematic approach elucidated complex relationships across DNA damage repair molecules and revealed the relative significance of each DNA damage repair system in the SCA1 pathology. Our results confirmed a critical role for DSBR in the SCA1 pathology, consistent with previous findings in the HD pathology (20). Moreover, molecular networks predicted from systems biology analyses revealed that RpA1 is the most important factor exerting multiple DNA repair pathways in the SCA1 pathology (Fig. 4A).

Surprisingly, BRCA2 and RAD51 linked to RpA1 (Fig. 4A) are key players in HR-dependent DSB repair that functions in proliferating cells. Our additional analysis revealed abnormal S-phase entry in Purkinje cells in Atxn1-KI mice (Supplementary Material, Figs S11 and 12) indicating that Purkinje cells might use HR for DNA damage repair. Our experiments revealed that mutant Atxn1 delays the accumulation of RpA1 at DSB foci (Fig. 7). Moreover, mutant Atxn1 also interacts with BRCA2 and BRCA1, which cooperate with RpA1 in HR-dependent DSB repair (Fig. 6, Supplementary Material, Figs S4 and S6–S8). These data strongly suggest that mutant Atxn1 disturbs HR employed to repair DSB of Purkinje cells in SCA1 pathology.

A modified explanation for the use of HR could be that the XRCC3/RAD51 pathway protects the mitochondrial genome rather than nuclear genome in Purkinje cells. It is consistent with the notion that BRCA1 contributes to the maintenance of mitochondrial genome stability (66). The other explanation for the use of HR is non-cell-autonomous pathology. DNA damage in proliferating glia might influence the fate of Purkinje cells. Actually, the support provided by Bergmann glia for Purkinje cells seems be impaired in the SCA1 pathology (62). However, this explanation may not be available given that the DNA damage marker, γH2AX, was not increased in Bergmann glia or other glial cells of mutant Atxn1-KI mice (Supplementary Material, Fig. S14).

XRCC1, Lig3 and PARP, predicted from the RpA1-PNKP (polynucleotide kinase 3′-phosphatase) network involved in the lifespan-elongating gene network (Fig. 4A), are essential not only for direct SSBR (67) but also for indirect SSBR derived from BER and NER (68) or for B-NHEJ (47). In particular, oxidative DNA damage-related NER functions mainly independently of the cell cycle and acts to remove bulky DNA adducts (69). In mammalian NER, RPA1/RPA70 (the mammalian homolog of RpA1/RpA70) forms one of the three damage recognition factors that recruit and cooperatively bind the TFIIH complex to form pre-incision complex 1, which is responsible for the initial unwinding of damaged DNA at the assembly site (70). Interestingly, CycH/CCNH, which showed a positive effect on the lifespan, is also a component of TFIIH. These findings suggest that the detection of DNA damage and transfer of the information to the RNA polymerase II protein complex through TFIIH are critical for the SCA1 pathology. Dysfunction of NER has been linked to a spectrum of disorders involving neurodevelopmental abnormalities; however, RPA70 has not been previously associated with a specific disease pathogenesis (71).

DNA polymerase epsilon-PCNA-DNA polymerase eta (POLH/DNA pol eta) had a beneficial effect on the survival of adult SCA1 flies (Fig. 3A). This finding is also difficult to explain in terms of relevance to DNA repair in non-dividing neurons. These genes are not related to mitochondrial DNA polymerase (DNA polymerase gamma), which is involved in mitochondrial DNA damage repair (72) but is not responsible for quality control of mitochondria. Thus, again the abnormal cell cycle or mitochondrial genome repair of Purkinje cells in the SCA1 pathology would be suitable for explaining the effect of POLH.

Regarding the screening by developmental phenotype (Fig. 2), it is noteworthy that all the identified genes were related to DSBR. RecQ5, which showed a positive effect on embryonic phenotype, is also related to HR-dependent DSBR (Table 1), although RecQ helicases are responsible for the other types of DNA repair, including BER, MMR and replication fork arrest (73). This is also the case with RpA70, which binds to single-stranded DNA and regulates the switch between NHEJ and HR in DSBR (74). Grp/Chk1 also functions in DNA damage repair in DSB by pausing the cell cycle to allow time for repairing genome damage (75). The specific dependence of embryonic SCA1 pathology on DSBR might be interesting from the viewpoint of stem cell proliferation/differentiation.

In this study, we did not investigate the detailed role of RBM17/SPF45, which has Holliday junction-binding activity (43). This is because the worsening effect of RBM17 on mutant Atxn1-induced eye degeneration has already been reported with a Drosophila model (14). As shown here, the overexpression of some DNA repair genes worsens the Drosophila SCA1 phenotype. Therefore, the previous finding with regard to RMB17/SPF45 could be a phenomenon homologous to our results. However, the detailed relationship of RMB17/SPF45 to neurodegeneration via its function in splicing and DNA repair (43,76) should be investigated in the future.

The pathogenesis of several SCAs has been linked to DNA repair (77,78). Ataxia telangiectasia is caused by dysfunction of the ATM gene, the regulator of the signaling network responsible for co-ordinating the repair of DSBs (52). Ataxia with ocular apraxia type 1 (AOA1) is caused by mutations in aprataxin (79,80), a member of the HIT gene superfamily that is mainly involved in SSBR (77,81). AOA2 is associated with mutations in senataxin (82), the ortholog of yeast RNA helicase, which seems to resolve DNA–RNA hybrids formed at the transcriptional pause (83) and may be involved in multiple types of DNA repair, including transcription coupled repair (84). The close homology between such non-polyQ SCAs and SCA1 further confirms the critical role of in DNA repair functions in cerebellar degeneration.

This study also provides new molecular targets for therapeutics for SCA1. RpA1 supplementation remarkably elongated the lifespan of the SCA1 fly (Fig. 3A) and rescued eye degeneration (Fig. 8B, Supplementary Material, Fig. S10). An inhibitor of Chk1, which has been already used in the treatment of human cancer, also elongated the lifespan (Fig. 8A). Other candidate molecules that have been shown in this study may also prove useful for the therapy of SCA1.

In conclusion, this paper reports core networks and key molecules in DNA damage repair in SCA1. These notions would lead to understanding of SCA1 pathology and developing new therapeutic approaches to SCA1 in the future.

MATERIALS AND METHODS

Immunohistochemistry of Drosophila

The proboscis, wings, legs and abdomen were removed from an adult female fly, and the residual head and thorax were fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) for 30 min on ice. The fixed flies were incubated in 30% sucrose in PBS longer than overnight at 4°C. After the heads were frozen in dry ice/n-hexane, 10-mm horizontal sections were made with a cryostat microtome and stained with anti-histone H2Av pSer137 AP09307PU-N antibody (Acris, rabbit, diluted 1:200) or ataxin-1 H21 antibody (Santa Cruz, goat, diluted 1:100) and Alexa Fluor 488- or Cy5-conjugated secondary antibodies (Jackson, diluted 1:50). All preparations were mounted in ‘VectaShield with DAPI’ Mounting Medium (Vector Laboratories, Burlingame, CA, USA).

Immunohistochemistry of mouse

Fresh brains of heterozygous Atxn1-154Q-KI (32 weeks) were fixed in phosphate-buffered 4% paraformaldehyde and embedded in paraffin. Sections (thickness: 5–10 µm) were dewaxed in xylene and rehydrated using a descending ethanol series. Sections were boiled in 10 mm citrate buffer (pH 6.0) in a microwave oven three times and kept at room temperature for 30 min after the final boiling. Incubation in PBS containing 1% bovine serum albumin and 0.01% (v/v) Triton X-100 was performed for 30 min to block nonspecific binding. Samples were incubated overnight at 4°C with a primary antibody, followed by incubation with a secondary antibody for 1 h at room temperature. After a 2-min DAPI treatment, the brains were mounted using Fluoromount and covered using coverslips. Cells were visualized using confocal microscopy (Zeiss LSM510; Carl Zeiss, Oberkochen, Germany).

Primary antibodies and dilution conditions were as follows: anti-CAG antibody (HD1; gift from Dr Wanker, rabbit 1:100), anti-Atxn1 antibody (11NQ, clone N76/8; mouse, 1:100; Millipore, Billerica, MA, USA), anti-RpA1 antibody (H-7, rabbit, 1:100; Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-RpA1 antibody (mouse monoclonal, Calbiochem, 1:100), anti-BRCA1 (C-20; rabbit, 1:100; Santa Cruz Biotechnology), anti-BRCA2 (ab123491; rabbit, 1:100; Abcam, Cambridge, UK) and anti-H2AX (Ser139; mouse, 1:500; Millipore). Secondary antibodies and dilution conditions were as follows: Alexa Fluor 488-conjugated anti-mouse antibody (Molecular Probes, Eugene, OR, USA; 1:1000) and Cy3-conjugated anti-rabbit antibody (Jackson Laboratory, Bar Harbor, ME, USA; 1:1000).

Immunoblotting of Drosophila

For western blot sampling, 25 female flies were dissolved in 50 ml of lysis buffer containing 62.5 mm Tris–HCl (pH 6.8), 2% (w/v) sodium dodecyl sulfate (SDS), 2.5% (v/v) 2-mercaptoethanol, 5% (v/v) glycerin and 0.0025% (w/v) bromophenol blue. Samples were separated by SDS–PAGE, transferred onto Immobilon-P Transfer Membrane (Millipore, Germany) by semi-dry method. The filters were blocked by 5% milk in Tris-buffered saline (TBS) with Tween 20 (TBST) (10 mm Tris–HCl, pH 8.0, 150 mm NaCl, 0.05% Tween 20) and incubated with each primary antibody for overnight at 4°C. Primary antibodies were; mouse anti-RPA-70 (1:200, H-7, Santa Cruz, CA, USA) and mouse anti-actin (1:1000, C4, Chemicon, Millipore, Germany). The filters were then incubated with the horseradish peroxidase (HRP)-conjugated anti-mouse IgG (GE Healthcare, Amersham, UK) at a 1:10 000 dilution for 1 h at room temperature. Finally, target molecules were visualized using Enhanced Chemiluminescence WB detection system (GE Healthcare).

Real-time PCR

Total RNA was prepared from 10 whole flies (3 days old) with RNeasy mini Kit (Qiagen, Germany). To eliminate genomic DNA contamination, on column DNA digestion was carried out for each sample with DNase I (Qiagen). The purified total RNA was reverse-transcribed with superscript VILO (Invitrogen, CA, USA). Quantitative PCR analyses were performed with the 7500 Real-Time PCR System (Applied Biosystems, CA, USA) using the Thunderbird SYBER Green (TOYOBO, Japan) for RpA70, Atxn1 and actin5C. The primer sequences were Act5C, forward primer: CCGAGCGCGGTTACTCTTT and reverse primer: CAACATAGCACAGCTTCTCCTTGAT; RpA70, forward primer: CAAAATGGTCCTGGCATCTT and reverse primer: CCAGCATCGCATAGCTGTTA; and Atxn1, forward primer: GCACTGACATGGAAGCGTCG and reverse primer: AGTTCTCGCTCTTGGGAAGG.

Immunoblotting of primary neurons

For western blot sampling, samples from the culture of cerebellar granular neurons were collected 4 days after infection. Samples were washed three times with ice-cold PBS and dissolved in lysis buffer containing 62.5 mm Tris–HCl, pH 6.8, 2% (w/v) SDS, 2.5% (v/v) 2-mercaptoethanol and 5% (v/v) glycerol. Protein concentration was quantified using the BCA method (Micro BCA Protein Assay Reagent Kit; Pierce Chemical, Rockford, IL, USA).

The dilution conditions of primary and secondary antibodies for immunoblotting were as follows: mouse antiphospho-histone H2AX (γH2AX) (1:750, Ser-139; Millipore), mouse polyglutamine (IC2) (1:2000, MAB1574; Chemicon, Temecula, CA, USA), goat Atxn1 (1:1000, H-21, Santa Cruz Biotechnology), mouse anti-glyceraldehyde phosphate denydrogenase (1:10 000, Millipore), HRP-conjugated anti-mouse IgG (GE Healthcare) and HRP-conjugated anti-goat IgG (1:3000, Dako, Glostrup, Denmark). Antibodies were diluted in TBST with 5% skimmed milk.

Drosophila homolog DNA repair gene search strategy

A comprehensive up-to-date list of human DNA repair genes (‘Human DNA Repair Genes’ available from http://sciencepark.mdanderson.org/labs/wood/dna_repair_genes.html) was compared with NCBI HomoloGene (http://www.ncbi.nlm.nih.gov/homologene) in order to identify all available Drosophila homolog genes. Forty-one available ‘GS lines’ of Drosophila homolog DNA repair genes were identified from FlyBase (http://flybase.org/) (Table 1).

Drosophila models with overexpression of a DNA repair gene

The GS system is a method for the efficient detection and rapid molecular identification of genes in D. melanogaster. A P-element-based GS vector, containing the UAS, core promoter and the marker gene ‘mini-white’, is randomly inserted into the Drosophila Genome. The target gene (in this case a DNA repair gene) is then flanked by the inserted P-element, which drives the gene overexpression when a transgenic fly of the GS line is crossed with flies bearing GAL4 drivers. A novel hSCA1 Drosophila model combining the mutant human Atxn182Q (hAtxn182Q) gene with an OK6-GAL4 driver was used in this study due to its properties of short generation time and quantitative phenotype, making it an appropriate candidate for this initial screen of multiple genes.

Fly stocks and rearing conditions

All flies were raised on corn-meal medium (9.2% corn-meal, 3.85% yeast, 3.8% sucrose, 1.05% potassium tartrate, 0.09% calcium chloride, 7.6% glucose, 2.416% nipagin and 1% agar). All fly stocks were maintained at 25°C and 60 ± 10% humidity under a 12:12-h light–dark cycle unless otherwise noted.

The GS line flies were obtained from the Drosophila Genetic Resource Centre (Kyoto, Japan). The transgenic flies hAtxn1-82Q (y1w1118UAS:atxn1-82Q) and UAS-mKu70 and OK6-Gal4 and their genetic control, Cantonized w1118 strain, w(CS10) which is the parental strain of all transgenic flies used in this study, were the same as those used in previous research (19,44). RNAi lines for RpA70 (9633R-3) and grp (17161R-2) were obtained from National Institute of Genetics (Mishima, Japan). Virgin females for each cross were collected within 8 h of adult clearing and held in maximum numbers of 20 per vial for 3–4 days before being used in the matings.

For life span controls, the genotype of the positive control flies was y1w1118UAS-Atxn1-82Q/+;+/OK6-GAL4;+/+ and that of the negative controls was y1w1118UAS-Atxn1-82Q/+;+/+;+/+ and +/+;+/OK6-GAL4;+/+. All flies were virgin females.

VER of hSCA1 Drosophila

The standard eclosion rate of transgenic Drosophila models expressing hAtxn1-82Q could not be assessed under the control of the OK6-GAL4 driver, due to an inability to assess expression in larvae with the balancers employed, namely Curly O (CyO) and Sternopleural (sp) for 2nd Chromosome-linked GS line genes and TM3 Serrate (TM3 Ser) and Stubble (sb) for third chromosome-linked GS line genes. Therefore, the viability of the genotypes of interest was estimated via a new method labeled VER. In the VER assessment, the ratio of hAtxn1-82Q-expressing GS line females and hAtxn1-82Q non-expressing GS line males was calculated over a period of 7 days starting from the first eclosion. Limitations in using VER include the fact that it does not directly reflect eclosion rate and cannot determine the stage of developmental toxicity of the mutant polyQ protein that was repressed.

The detailed methods of mating flies were different among GS lines that have GS cassette on different chromosomes (control, 2nd, 3rd and X). For positive control experiment, UAS-Atxn1-82Q males and OK6-Gal4 females were simply crossed. Because UAS-Atxn1-82Q is located in X chromosome, the F1 female but not male carries UAS-Atxn1-82Q construct. See the following scheme.

graphic

For the GS lines that have GS cassette on 2nd chromosome, first UAS-Atxn1-82Q; CyO/sp; +/+ females were crossed with +/Y; GS; +/+ males. Then, the resultant F1 males, UAS-Atxn1-82Q/Y; GS/sp; +/+ were crossed with OK6-Gal4 females. We counted F2 flies without sp. See the following scheme.

graphic

For the GS lines that have GS cassette on 3rd chromosome, first UAS-Atxn1-82Q; +/+; TM3 Ser/sb females were crossed with +/Y; +/+; GS males. Then the resultant F1 males, UAS-Atxn1-82Q/Y; +/+; GS/sb were crossed with OK6-Gal4 females. We counted F2 flies without sb. See the following scheme.

graphic

For the GS lines that have GS cassette on X chromosome, we employed OK6:+ ratio instead of female:male ratio. First OK6-Gal4 males were crossed with GS; +/+; +/+ females. Then the resultant F1 males, GS/Y; OK6/+; +/+ were crossed with UAS-Atxn1-82Q females. We counted F2 females with or without OK6. We discriminated these flies based on very red eye of OK6. See the following scheme.

graphic

For mating, all adult flies from the final generations were selected and their phenotype checked under a microscope.

Survival analysis of hSCA1 Drosophila

Life span experiments were performed at 25°C and 60 ± 10% humidity under a 12:12-h light–dark cycle using the same corn medium used for the creation of the final generation. Flies were etherized only on the first day of their lives for selection purposes. Twenty flies were maintained per vial and transferred to new vials with fresh medium every 2–3 days. Two to 3 runs were conducted for each separate experiment with the number of dead flies counted and removed every 2–3 days. Any flies that escaped were eliminated from the experiment.

For each run, the median and mean life spans were calculated and incorporated into life tables. Daily survivorship curves were constructed. No further statistical analysis was undertaken as the full lifespan of flies was not observed due to time constraints on the research.

Systems biology analysis

Systems biology analyses were performed using Ingenuity-IPA software (Ingenuity Systems, Inc., Redwood City, CA, USA) based on human databases, since only the Drosophila genes possessing human homologs were employed for in vivo screening. This is also because no Drosophila database is available for the Ingenuity-IPA software. In path-explorer analysis (shortest +1), a new path appeared when two genes were connected to the same new molecule. Genes found in in vivo screening and path-explorer analyses were further investigated by ‘core analysis’ to deduce the signaling pathway containing the genes at a high frequency. Enrichment analysis was performed by Fisher's exact test with the B–H multiple test correction to calculate q-values. For core analysis, we first employed the eight most popular PPI databases (BIND, BIOGRID, Cognia, DIP, INTACT, Interactome studies, MINT and MIPS) and then included the Ingenuity original database, including ‘indirect interactions’ based on research papers (miRecords, TarBase, TargetScan Human, Clinical Trials .gov, Gene Ontology, GVK Biosciences, KEGG, miRBase, MGD, Obesity Gene Map Database) in addition to the eight PPI databases.

Plasmid construction

pDsRed-monomer C1, Atxn1-86Q-pDsRed, myc-Atxn1-33Q and -86Q were described previously (45). For construction of the EGFP-RpA1, cDNA fragments of full-length RpA1 were amplified by polymerase chain reaction from B6 wild-type mouse embryonic brain RNA and subcloned into pLVSIN-CMV-pur (Takara, Shiga, Japan) between the EcoRI and XhoI sites, and again subcloned into pEGFP-C1 (Takara) with EcoRI–BamHI.

Laser microirradiation

Laser microirradiation and signal acquisition from the damaged area were performed as described previously (45). U2OS cells grown on 25-mm coverslips were co-transfected with RpA1-EGFP and pDsRed-monomer C1 or Atxn1-86Q-pDsRed. After 24 h, cells were treated with 2 μm Hoechst33258 (Dojindo, Kumamoto, Japan) for 20 min to sensitize the cells to DSBs. Using the software (AIM4.2; Carl Zeiss) included in the microscope (LSM510META; Carl Zeiss), rectangle-shaped areas located at the cell nuclei were irradiated by UV laser (maximum power: 30 mW, laser output: 75%, wavelength: 405 nm, iteration: 5, pixel time: 12 μsec: zoom 6), and time-lapse images were obtained every 30 s. Regions of interest (ROIs) matching exactly with the bleached area were determined using Adobe Photoshop CS3, and mean signal intensities per pixel of RpA1 were obtained from the ROIs. Signal intensity was normalized by that of the non-irradiated area, and the data were represented in terms of normalized fluorescence units.

Chemical rescue of hSCA1 Drosophila

A specific inhibitor of Chk1, CHIR-124 (AXON MEDCHEM) was dissolved in 5 mg/ml in 1 N HCl and diluted to multiple concentrations of 0.05 N solution. Three milliliters of the solution were added to 1 g of the Drosophila medium [1:1 mixture of Instant Drosophila Medium D7670 (Sigma–Aldrich, St. Louis, MO, USA) and Formula 4–24 Instant Drosophila Medium (Calolina)] to make the final concentration of the meal described in the figure. For the control, an equal amount of 0.05 N HCl was added to the medium.

Immunoprecipitation

HeLa cells (2 × 106) plated on 10-cm dishes were transfected using Lipofectamine 2000 (Invitrogen) following the commercial protocol and incubated for 36 h. After washing with PBS twice, cells from a dish were homogenized with 2 ml of TNE buffer [10 mm Tris–HCl, pH 7.5; 150 mm NaCl; 1 mm ethylenediaminetetraacetic acid (EDTA); 1% Nonidet P-40] and incubated at 4°C with rotation. Thirty minutes after the rotation, solutions were centrifuged at 1 × 104g for 20 min. The supernatant was incubated with protein G-agarose beads (GE Healthcare) for 2 h at 4°C with rotation. After the beads were removed, the lysates were incubated with 2–10 µg of anti-Myc, anti-RpA1 or anti-BRCA1/2 antibody overnight at 4°C with rotation and with protein G-agarose beads thereafter for 2 h. The beads were washed three times with 500 µl of TNE buffer and resolved using SDS–polyacrylamide gel electrophoresis sample buffer. Mouse brains (20 weeks old) were homogenized in TNE (10 mm Tris–HCl, pH 7.5; 150 mm NaCl; EDTA; 1% Nonidet P-40), and centrifuged at 2000g for 1 min at 4°C. The supernatants were immunoprecipitated using a similar method. Four hundred micrograms of protein were incubated with anti-RpA1 (H-7; Santa Cruz Biotechnology; 1:20) or anti-Atxn1 (11NQ, clone N76/8; Millipore; 1:100). For western blot, primary antibodies, including anti-Myc (9E10; Santa Cruz Biotechnology; 1:500), anti-RpA1 (H-7; Santa Cruz Biotechnology; 1:100), anti-RpA1 (B-10; Santa Cruz Biotechnology; 1:1000 for mouse sample), anti-BRCA1/2 (Abcam; 1:2000) or anti-Atxn1 (11NQ, clone N76/8; Millipore; 1:2000). HRP-conjugated anti-mouse or anti-rabbit IgG (Amersham) was used at a dilution of 1:3000.

Statistical analysis

Comparisons between GS lines and control Drosophila models for VER were evaluated using a two-tailed Welch's t-test, because prior to the start of the experiment, the effect the DNA repair gene overexpression on VER was not known. In addition, it was not possible to determine if the variance of the data between GS lines and controls was equal.

Ethical considerations

This study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Committee on the Animal Experiments of the Tokyo Medical and Dental University (Permit Number: 0140170C) and by the Genetic Modification Safety Committee (2012-001A, 2010-215C4). All surgery was performed under ether of isoflurane anesthesia, and every effort was made to minimize suffering.

SUPPLEMENTARY MATERIAL

Supplementary Material is available at HMG online.

FUNDING

This work was supported by the Strategic Research Program for Brain Sciences (SRPBS), a Grant-in-Aid for Scientific Research on Innovative Areas (Foundation of Synapse and Neurocircuit Pathology) from the Ministry of Education, Culture, Sports, Science and Technology of Japan; CREST from the Japan Science Technology Agency; and a Grant-in Aid from the Research Committee for Ataxic Disease from the Ministry of Health, Labour and Welfare of Japan to H.O.

Acknowledgements

We thank Prof. Huda Y. Zoghbi (Baylor College of Medicine) and Dr Kei Watase (TMDU) for providing Atxn1-KI mice, and Prof. Juan Botas (Baylor College of Medicine) for Atxn1-transgenic flies. We also thank Yasuhiro Kokubu and Tayoko Tajima (TMDU) for technical assistance. The GS fly stocks were obtained from the Drosophila Genetic Resource Center at the Kyoto Institute of Technology.

Conflict of Interest statement. None declared.

REFERENCES

1
Jimenez-Sanchez
M.
Thomson
F.
Zavodszky
E.
Rubinsztein
D.C.
Autophagy and polyglutamine diseases
Prog. Neurobiol.
 , 
2011
, vol. 
97
 (pg. 
67
-
82
)
2
Chan
H.Y.
Warrick
J.M.
Andriola
I.
Merry
D.
Bonini
N.M.
Genetic modulation of polyglutamine toxicity by protein conjugation pathways in Drosophila
Hum. Mol. Genet.
 , 
2002
, vol. 
11
 (pg. 
2895
-
2904
)
3
Bailey
C.K.
Andriola
I.F.
Kampinga
H.H.
Merry
D.E.
Molecular chaperones enhance the degradation of expanded polyglutamine repeat androgen receptor in a cellular model of spinal and bulbar muscular atrophy
Hum. Mol. Genet.
 , 
2002
, vol. 
11
 (pg. 
515
-
523
)
4
Abel
A.
Walcott
J.
Woods
J.
Duda
J.
Merry
D.E.
Expression of expanded repeat androgen receptor produces neurologic disease in transgenic mice
Hum. Mol. Genet.
 , 
2001
, vol. 
10
 (pg. 
107
-
116
)
5
Stenoien
D.L.
Cummings
C.J.
Adams
H.P.
Mancini
M.G.
Patel
K.
DeMartino
G.N.
Marcelli
M.
Weigel
N.L.
Mancini
M.A.
Polyglutamine-expanded androgen receptors form aggregates that sequester heat shock proteins, proteasome components and SRC-1, and are suppressed by the HDJ-2 chaperone
Hum. Mol. Genet.
 , 
1999
, vol. 
8
 (pg. 
731
-
741
)
6
Chai
Y.
Koppenhafer
S.L.
Shoesmith
S.J.
Perez
M.K.
Paulson
H.L.
Evidence for proteasome involvement in polyglutamine disease: localization to nuclear inclusions in SCA3/MJD and suppression of polyglutamine aggregation in vitro
Hum. Mol. Genet.
 , 
1999
, vol. 
8
 (pg. 
673
-
682
)
7
Venkatraman
P.
Wetzel
R.
Tanaka
M.
Nukina
N.
Goldberg
A.L.
Eukaryotic proteasomes cannot digest polyglutamine sequences and release them during degradation of polyglutamine-containing proteins
Mol. Cell
 , 
2004
, vol. 
14
 (pg. 
95
-
104
)
8
Holmberg
C.I.
Staniszewski
K.E.
Mensah
K.N.
Matouschek
A.
Morimoto
R.I.
Inefficient degradation of truncated polyglutamine proteins by the proteasome
EMBO J.
 , 
2004
, vol. 
23
 (pg. 
4307
-
4318
)
9
Weydt
P.
Pineda
V.V.
Torrence
A.E.
Libby
R.T.
Satterfield
T.F.
Lazarowski
E.R.
Gilbert
M.L.
Morton
G.J.
Bammler
T.K.
Strand
A.D.
, et al.  . 
Thermoregulatory and metabolic defects in Huntington's disease transgenic mice implicate PGC-1alpha in Huntington's disease neurodegeneration
Cell Metab.
 , 
2006
, vol. 
4
 (pg. 
349
-
362
)
10
Tsunemi
T.
Ashe
T.D.
Morrison
B.E.
Soriano
K.R.
Au
J.
Roque
R.A.
Lazarowski
E.R.
Damian
V.A.
Masliah
E.
La Spada
A.R.
PGC-1alpha rescues Huntington's disease proteotoxicity by preventing oxidative stress and promoting TFEB function
Sci. Transl. Med.
 , 
2012
, vol. 
4
 pg. 
142ra197
 
11
Shimohata
T.
Nakajima
T.
Yamada
M.
Uchida
C.
Onodera
O.
Naruse
S.
Kimura
T.
Koide
R.
Nozaki
K.
Sano
Y.
, et al.  . 
Expanded polyglutamine stretches interact with TAFII130, interfering with CREB-dependent transcription
Nat. Genet.
 , 
2000
, vol. 
26
 (pg. 
29
-
36
)
12
Hughes
R.E.
Lo
R.S.
Davis
C.
Strand
A.D.
Neal
C.L.
Olson
J.M.
Fields
S.
Altered transcription in yeast expressing expanded polyglutamine
Proc. Natl. Acad. Sci. USA
 , 
2001
, vol. 
98
 (pg. 
13201
-
13206
)
13
Okazawa
H.
Rich
T.
Chang
A.
Lin
X.
Waragai
M.
Kajikawa
M.
Enokido
Y.
Komuro
A.
Kato
S.
Shibata
M.
, et al.  . 
Interaction between mutant ataxin-1 and PQBP-1 affects transcription and cell death
Neuron
 , 
2002
, vol. 
34
 (pg. 
701
-
713
)
14
Lim
J.
Crespo-Barreto
J.
Jafar-Nejad
P.
Bowman
A.B.
Richman
R.
Hill
D.E.
Orr
H.T.
Zoghbi
H.Y.
Opposing effects of polyglutamine expansion on native protein complexes contribute to SCA1
Nature
 , 
2008
, vol. 
452
 (pg. 
713
-
718
)
15
Shibata
H.
Huynh
D.P.
Pulst
S.M.
A novel protein with RNA-binding motifs interacts with ataxin-2
Hum. Mol. Genet.
 , 
2000
, vol. 
9
 (pg. 
1303
-
1313
)
16
Waragai
M.
Junn
E.
Kajikawa
M.
Takeuchi
S.
Kanazawa
I.
Shibata
M.
Mouradian
M.M.
Okazawa
H.
PQBP-1/Npw38, a nuclear protein binding to the polyglutamine tract, interacts with U5–15kD/dim1p via the carboxyl-terminal domain
Biochem. Biophys. Res. Commun.
 , 
2000
, vol. 
273
 (pg. 
592
-
595
)
17
Wang
G.
Sawai
N.
Kotliarova
S.
Kanazawa
I.
Nukina
N.
Ataxin-3, the MJD1 gene product, interacts with the two human homologs of yeast DNA repair protein RAD23, HHR23A and HHR23B
Hum. Mol. Genet.
 , 
2000
, vol. 
9
 (pg. 
1795
-
1803
)
18
Kovtun
I.V.
Liu
Y.
Bjoras
M.
Klungland
A.
Wilson
S.H.
McMurray
C.T.
OGG1 Initiates age-dependent CAG trinucleotide expansion in somatic cells
Nature
 , 
2007
, vol. 
447
 (pg. 
447
-
452
)
19
Qi
M.L.
Tagawa
K.
Enokido
Y.
Yoshimura
N.
Wada
Y.
Watase
K.
Ishiura
S.
Kanazawa
I.
Botas
J.
Saitoe
M.
, et al.  . 
Proteome analysis of soluble nuclear proteins reveals that HMGB1/2 suppress genotoxic stress in polyglutamine diseases
Nat. Cell. Biol.
 , 
2007
, vol. 
9
 (pg. 
402
-
414
)
20
Enokido
Y.
Tamura
T.
Ito
H.
Arumughan
A.
Komuro
A.
Shiwaku
H.
Sone
M.
Foulle
R.
Sawada
H.
Ishiguro
H.
, et al.  . 
Mutant huntingtin impairs Ku70-mediated DNA repair
J. Cell Biol.
 , 
2010
, vol. 
189
 (pg. 
425
-
443
)
21
Koob
M.D.
Moseley
M.L.
Schut
L.J.
Benzow
K.A.
Bird
T.D.
Day
J.W.
Ranum
L.P.
An untranslated CTG expansion causes a novel form of spinocerebellar ataxia (SCA8)
Nat. Genet.
 , 
1999
, vol. 
21
 (pg. 
379
-
384
)
22
Moseley
M.L.
Zu
T.
Ikeda
Y.
Gao
W.
Mosemiller
A.K.
Daughters
R.S.
Chen
G.
Weatherspoon
M.R.
Clark
H.B.
Ebner
T.J.
, et al.  . 
Bidirectional expression of CUG and CAG expansion transcripts and intranuclear polyglutamine inclusions in spinocerebellar ataxia type 8
Nat. Genet.
 , 
2006
, vol. 
38
 (pg. 
758
-
769
)
23
Li
L.B.
Yu
Z.
Teng
X.
Bonini
N.M.
RNA toxicity is a component of ataxin-3 degeneration in Drosophila
Nature
 , 
2008
, vol. 
453
 (pg. 
1107
-
1111
)
24
Sato
N.
Amino
T.
Kobayashi
K.
Asakawa
S.
Ishiguro
T.
Tsunemi
T.
Takahashi
M.
Matsuura
T.
Flanigan
K.M.
Iwasaki
S.
, et al.  . 
Spinocerebellar ataxia type 31 is associated with ‘inserted’ penta-nucleotide repeats containing (TGGAA)n
Am. J. Hum. Genet.
 , 
2009
, vol. 
85
 (pg. 
544
-
557
)
25
Tsoi
H.
Lau
T.C.
Tsang
S.Y.
Lau
K.F.
Chan
H.Y.
CAG expansion induces nucleolar stress in polyglutamine diseases
Proc. Natl. Acad. Sci. USA
 , 
2012
, vol. 
109
 (pg. 
13428
-
13433
)
26
Wang
H.
Lim
P.J.
Karbowski
M.
Monteiro
M.J.
Effects of overexpression of huntingtin proteins on mitochondrial integrity
Hum. Mol. Genet.
 , 
2009
, vol. 
18
 (pg. 
737
-
752
)
27
Banfi
S.
Servadio
A.
Chung
M.Y.
Kwiatkowski
T.J.
Jr
McCall
A.E.
Duvick
L.A.
Shen
Y.
Roth
E.J.
Orr
H.T.
Zoghbi
H.Y.
Identification and characterization of the gene causing type 1 spinocerebellar ataxia
Nat. Genet.
 , 
1994
, vol. 
7
 (pg. 
513
-
520
)
28
Chen
H.K.
Fernandez-Funez
P.
Acevedo
S.F.
Lam
Y.C.
Kaytor
M.D.
Fernandez
M.H.
Aitken
A.
Skoulakis
E.M.
Orr
H.T.
Botas
J.
, et al.  . 
Interaction of Akt-phosphorylated ataxin-1 with 14-3-3 mediates neurodegeneration in spinocerebellar ataxia type 1
Cell
 , 
2003
, vol. 
113
 (pg. 
457
-
468
)
29
Lai
S.
O'Callaghan
B.
Zoghbi
H.Y.
Orr
H.T.
14-3-3 binding to ataxin-1(ATXN1) regulates its dephosphorylation at Ser-776 and transport to the nucleus
J. Biol. Chem.
 , 
2011
, vol. 
286
 (pg. 
34606
-
34616
)
30
Lam
Y.C.
Bowman
A.B.
Jafar-Nejad
P.
Lim
J.
Richman
R.
Fryer
J.D.
Hyun
E.D.
Duvick
L.A.
Orr
H.T.
Botas
J.
, et al.  . 
ATAXIN-1 interacts with the repressor Capicua in its native complex to cause SCA1 neuropathology
Cell
 , 
2006
, vol. 
127
 (pg. 
1335
-
1347
)
31
de Chiara
C.
Giannini
C.
Adinolfi
S.
de Boer
J.
Guida
S.
Ramos
A.
Jodice
C.
Kioussis
D.
Pastore
A.
The AXH module: an independently folded domain common to ataxin-1 and HBP1
FEBS Lett.
 , 
2003
, vol. 
551
 (pg. 
107
-
112
)
32
Serra
H.G.
Duvick
L.
Zu
T.
Carlson
K.
Stevens
S.
Jorgensen
N.
Lysholm
A.
Burright
E.
Zoghbi
H.Y.
Clark
H.B.
, et al.  . 
RORalpha-mediated Purkinje cell development determines disease severity in adult SCA1 mice
Cell
 , 
2006
, vol. 
127
 (pg. 
697
-
708
)
33
Makarov
E.M.
Makarova
O.V.
Urlaub
H.
Gentzel
M.
Will
C.L.
Wilm
M.
Luhrmann
R.
Small nuclear ribonucleoprotein remodeling during catalytic activation of the spliceosome
Science
 , 
2002
, vol. 
298
 (pg. 
2205
-
2208
)
34
Makarova
O.V.
Makarov
E.M.
Urlaub
H.
Will
C.L.
Gentzel
M.
Wilm
M.
Luhrmann
R.
A subset of human 35S U5 proteins, including Prp19, function prior to catalytic step 1 of splicing
EMBO J.
 , 
2004
, vol. 
23
 (pg. 
2381
-
2391
)
35
Orr
H.T.
Cell biology of spinocerebellar ataxia
J. Cell Biol.
 , 
2012
, vol. 
197
 (pg. 
167
-
177
)
36
Hanawalt
P.C.
Spivak
G.
Transcription-coupled DNA repair: two decades of progress and surprises
Nat. Rev. Mol. Cell Biol.
 , 
2008
, vol. 
9
 (pg. 
958
-
970
)
37
Bell
O.
Tiwari
V.K.
Thoma
N.H.
Schubeler
D.
Determinants and dynamics of genome accessibility
Nat. Rev. Genet.
 , 
2011
, vol. 
12
 (pg. 
554
-
564
)
38
Beli
P.
Lukashchuk
N.
Wagner
S.A.
Weinert
B.T.
Olsen
J.V.
Baskcomb
L.
Mann
M.
Jackson
S.P.
Choudhary
C.
Proteomic investigations reveal a role for RNA processing factor THRAP3 in the DNA damage response
Mol. Cell
 , 
2012
, vol. 
46
 (pg. 
212
-
225
)
39
Shanbhag
N.M.
Rafalska-Metcalf
I.U.
Balane-Bolivar
C.
Janicki
S.M.
Greenberg
R.A.
ATM-dependent chromatin changes silence transcription in cis to DNA double-strand breaks
Cell
 , 
2010
, vol. 
141
 (pg. 
970
-
981
)
40
Shanbhag
N.M.
Greenberg
R.A.
Neighborly DISCourse: DNA double strand breaks silence transcription
Cell Cycle
 , 
2010
, vol. 
9
 (pg. 
3635
-
3636
)
41
Munoz
M.J.
Perez Santangelo
M.S.
Paronetto
M.P.
de la Mata
M.
Pelisch
F.
Boireau
S.
Glover-Cutter
K.
Ben-Dov
C.
Blaustein
M.
Lozano
J.J.
, et al.  . 
DNA damage regulates alternative splicing through inhibition of RNA polymerase II elongation
Cell
 , 
2009
, vol. 
137
 (pg. 
708
-
720
)
42
Ju
B.G.
Lunyak
V.V.
Perissi
V.
Garcia-Bassets
I.
Rose
D.W.
Glass
C.K.
Rosenfeld
M.G.
A topoisomerase IIbeta-mediated dsDNA break required for regulated transcription
Science
 , 
2006
, vol. 
312
 (pg. 
1798
-
1802
)
43
Chaouki
A.S.
Salz
H.K.
Drosophila SPF45: a bifunctional protein with roles in both splicing and DNA repair
PLoS Genet.
 , 
2006
, vol. 
2
 pg. 
e178
 
44
Tamura
T.
Sone
M.
Iwatsubo
T.
Tagawa
K.
Wanker
E.E.
Okazawa
H.
Ku70 alleviates neurodegeneration in Drosophila models of Huntington's disease
PLoS ONE
 , 
2011
, vol. 
6
 pg. 
e27408
 
45
Fujita
K.
Nakamura
Y.
Oka
T.
Ito
H.
Tamura
T.
Tagawa
K.
Sasabe
T.
Katsuta
A.
Motoki
K.
Shiwaku
H.
, et al.  . 
A functional deficiency of TERA/VCP/p97 contributes to impaired DNA repair in multiple polyglutamine diseases
Nat. Commun.
 , 
2013
, vol. 
4
 pg. 
1816
 
46
Bohgaki
T.
Bohgaki
M.
Hakem
R.
DNA double-strand break signaling and human disorders
Genome Integr.
 , 
2010
, vol. 
1
 pg. 
15
 
47
Mladenov
E.
Iliakis
G.
Induction and repair of DNA double strand breaks: the increasing spectrum of non-homologous end joining pathways
Mutat. Res.
 , 
2011
, vol. 
711
 (pg. 
61
-
72
)
48
Nowosielska
A.
Marinus
M.G.
DNA mismatch repair-induced double-strand breaks
DNA Repair (Amst)
 , 
2008
, vol. 
7
 (pg. 
48
-
56
)
49
Rogakou
E.P.
Pilch
D.R.
Orr
A.H.
Ivanova
V.S.
Bonner
W.M.
DNA double-stranded breaks induce histone H2AX phosphorylation on serine 139
J. Biol. Chem.
 , 
1998
, vol. 
273
 (pg. 
5858
-
5868
)
50
Rogakou
E.P.
Boon
C.
Redon
C.
Bonner
W.M.
Megabase chromatin domains involved in DNA double-strand breaks in vivo
J. Cell. Biol.
 , 
1999
, vol. 
146
 (pg. 
905
-
916
)
51
Toba
G.
Ohsako
T.
Miyata
N.
Ohtsuka
T.
Seong
K.H.
Aigaki
T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster
Genetics
 , 
1999
, vol. 
151
 (pg. 
725
-
737
)
52
Fernandez-Funez
P.
Nino-Rosales
M.L.
de Gouyon
B.
She
W.C.
Luchak
J.M.
Martinez
P.
Turiegano
E.
Benito
J.
Capovilla
M.
Skinner
P.J.
, et al.  . 
Identification of genes that modify ataxin-1-induced neurodegeneration
Nature
 , 
2000
, vol. 
408
 (pg. 
101
-
106
)
53
Shimada
M.
Niida
H.
Zineldeen
D.H.
Tagami
H.
Tanaka
M.
Saito
H.
Nakanishi
M.
Chk1 is a histone H3 threonine 11 kinase that regulates DNA damage-induced transcriptional repression
Cell
 , 
2008
, vol. 
132
 (pg. 
221
-
232
)
54
Garcia
P.L.
Liu
Y.
Jiricny
J.
West
S.C.
Janscak
P.
Human RECQ5b, a protein with DNA helicase and strand annealing activities in a single polypeptide. Histone H3 threonine 11 kinase that regulates DNA damage-induced transcriptional repression
EMBO J.
 , 
2004
, vol. 
23
 (pg. 
2882
-
2891
)
55
Tirona
R.G.
Lee
W.
Leake
B.F.
Lan
L.B.
Cline
C.B.
Lamba
V.
Parviz
F.
Duncan
S.A.
Inoue
Y.
Gonzalez
F.J.
, et al.  . 
The orphan nuclear receptor HNF4alpha determines PXR- and CAR-mediated xenobiotic induction of CYP3A4
Nat. Med.
 , 
2003
, vol. 
9
 (pg. 
220
-
224
)
56
Johnson-Schlitz
D.M.
Flores
C.
Engels
W.R.
Multiple-pathway analysis of double-strand break repair mutations in Drosophila
PLoS Genet.
 , 
2007
, vol. 
3
 pg. 
e50
 
57
Watase
K.
Weeber
E.J.
Xu
B.
Antalffy
B.
Yuva-Paylor
L.
Hashimoto
K.
Kano
M.
Atkinson
R.
Sun
Y.
Armstrong
D.L.
, et al.  . 
A long CAG repeat in the mouse Sca1 locus replicates SCA1 features and reveals the impact of protein solubility on selective neurodegeneration
Neuron
 , 
2002
, vol. 
34
 (pg. 
905
-
919
)
58
Yamanaka
K.
Chun
S.J.
Boillee
S.
Fujimori-Tonou
N.
Yamashita
H.
Gutmann
D.H.
Takahashi
R.
Misawa
H.
Cleveland
D.W.
Astrocytes as determinants of disease progression in inherited amyotrophic lateral sclerosis
Nat. Neurosci.
 , 
2008
, vol. 
11
 (pg. 
251
-
253
)
59
Yamanaka
K.
Boillee
S.
Roberts
E.A.
Garcia
M.L.
McAlonis-Downes
M.
Mikse
O.R.
Cleveland
D.W.
Goldstein
L.S.
Mutant SOD1 in cell types other than motor neurons and oligodendrocytes accelerates onset of disease in ALS mice
Proc. Natl. Acad. Sci. USA
 , 
2008
, vol. 
105
 (pg. 
7594
-
7599
)
60
Nagai
M.
Re
D.B.
Nagata
T.
Chalazonitis
A.
Jessell
T.M.
Wichterle
H.
Przedborski
S.
Astrocytes expressing ALS-linked mutated SOD1 release factors selectively toxic to motor neurons
Nat. Neurosci.
 , 
2007
, vol. 
10
 (pg. 
615
-
622
)
61
Di Giorgio
F.P.
Carrasco
M.A.
Siao
M.C.
Maniatis
T.
Eggan
K.
Non-cell autonomous effect of glia on motor neurons in an embryonic stem cell-based ALS model
Nat. Neurosci.
 , 
2007
, vol. 
10
 (pg. 
608
-
614
)
62
Shiwaku
H.
Yoshimura
N.
Tamura
T.
Sone
M.
Ogishima
S.
Watase
K.
Tagawa
K.
Okazawa
H.
Suppression of the novel ER protein Maxer by mutant ataxin-1 in Bergman glia contributes to non-cell-autonomous toxicity
EMBO J.
 , 
2010
, vol. 
29
 (pg. 
2446
-
2460
)
63
Herrup
K.
Yang
Y.
Cell cycle regulation in the postmitotic neuron: oxymoron or new biology?
Nat. Rev. Neurosci.
 , 
2007
, vol. 
8
 (pg. 
368
-
378
)
64
Klein
C.
Butt
S.J.
Machold
R.P.
Johnson
J.E.
Fishell
G.
Cerebellum- and forebrain-derived stem cells possess intrinsic regional character
Development
 , 
2005
, vol. 
132
 (pg. 
4497
-
4508
)
65
Hubert
L.
Jr
Lin
Y.
Dion
V.
Wilson
J.H.
Xpa deficiency reduces CAG trinucleotide repeat instability in neuronal tissues in a mouse model of SCA1
Hum. Mol. Genet.
 , 
2011
, vol. 
20
 (pg. 
4822
-
4830
)
66
Aygun
O.
Svejstrup
J.Q.
RECQL5 helicase: connections to DNA recombination and RNA polymerase II transcription
DNA Repair (Amst)
 , 
2010
, vol. 
9
 (pg. 
345
-
353
)
67
Whitehouse
C.J.
Taylor
R.M.
Thistlethwaite
A.
Zhang
H.
Karimi-Busheri
F.
Lasko
D.D.
Weinfeld
M.
Caldecott
K.W.
XRCC1 stimulates human polynucleotide kinase activity at damaged DNA termini and accelerates DNA single-strand break repair
Cell
 , 
2001
, vol. 
104
 (pg. 
107
-
117
)
68
Caldecott
K.W.
Single-strand break repair and genetic disease
Nat. Rev. Genet.
 , 
2008
, vol. 
9
 (pg. 
619
-
631
)
69
Kulkarni
A.
Wilson
D.M.
3rd
The involvement of DNA-damage and -repair defects in neurological dysfunction
Am. J. Hum. Genet.
 , 
2008
, vol. 
82
 (pg. 
539
-
566
)
70
Sancar
A.
Lindsey-Boltz
L.A.
Unsal-Kacmaz
K.
Linn
S.
Molecular mechanisms of mammalian DNA repair and the DNA damage checkpoints
Annu. Rev. Biochem.
 , 
2004
, vol. 
73
 (pg. 
39
-
85
)
71
Cleaver
J.E.
Lam
E.T.
Revet
I.
Disorders of nucleotide excision repair: the genetic and molecular basis of heterogeneity
Nat. Rev. Genet.
 , 
2009
, vol. 
10
 (pg. 
756
-
768
)
72
Kaguni
L.S.
DNA polymerase gamma, the mitochondrial replicase
Annu. Rev. Biochem.
 , 
2004
, vol. 
73
 (pg. 
293
-
320
)
73
Brosh
R.M.
Jr
Bohr
V.A.
Human premature aging, DNA repair and RecQ helicases
Nucleic Acids Res.
 , 
2007
, vol. 
35
 (pg. 
7527
-
7544
)
74
Ciccia
A.
Elledge
S.J.
The DNA damage response: making it safe to play with knives
Mol. Cell
 , 
2010
, vol. 
40
 (pg. 
179
-
204
)
75
Chen
Y.
Sanchez
Y.
Chk1 in the DNA damage response: conserved roles from yeasts to mammals
DNA Repair (Amst)
 , 
2004
, vol. 
3
 (pg. 
1025
-
1032
)
76
Horikoshi
N.
Morozumi
Y.
Takaku
M.
Takizawa
Y.
Kurumizaka
H.
Holliday junction-binding activity of human SPF45
Genes Cells
 , 
2010
, vol. 
15
 (pg. 
373
-
383
)
77
Rass
U.
Ahel
I.
West
S.C.
Defective DNA repair and neurodegenerative disease
Cell
 , 
2007
, vol. 
130
 (pg. 
991
-
1004
)
78
Gueven
N.
Chen
P.
Nakamura
J.
Becherel
O.J.
Kijas
A.W.
Grattan-Smith
P.
Lavin
M.F.
A subgroup of spinocerebellar ataxias defective in DNA damage responses
Neuroscience
 , 
2007
, vol. 
145
 (pg. 
1418
-
1425
)
79
Date
H.
Onodera
O.
Tanaka
H.
Iwabuchi
K.
Uekawa
K.
Igarashi
S.
Koike
R.
Hiroi
T.
Yuasa
T.
Awaya
Y.
, et al.  . 
Early-onset ataxia with ocular motor apraxia and hypoalbuminemia is caused by mutations in a new HIT superfamily gene
Nat. Genet.
 , 
2001
, vol. 
29
 (pg. 
184
-
188
)
80
Moreira
M.C.
Barbot
C.
Tachi
N.
Kozuka
N.
Uchida
E.
Gibson
T.
Mendonca
P.
Costa
M.
Barros
J.
Yanagisawa
T.
, et al.  . 
The gene mutated in ataxia-ocular apraxia 1 encodes the new HIT/Zn-finger protein aprataxin
Nat. Genet.
 , 
2001
, vol. 
29
 (pg. 
189
-
193
)
81
Date
H.
Igarashi
S.
Sano
Y.
Takahashi
T.
Takahashi
T.
Takano
H.
Tsuji
S.
Nishizawa
M.
Onodera
O.
The FHA domain of aprataxin interacts with the C-terminal region of XRCC1
Biochem. Biophys. Res. Commun.
 , 
2004
, vol. 
325
 (pg. 
1279
-
1285
)
82
Moreira
M.C.
Klur
S.
Watanabe
M.
Nemeth
A.H.
Le Ber
I.
Moniz
J.C.
Tranchant
C.
Aubourg
P.
Tazir
M.
Schols
L.
, et al.  . 
Senataxin, the ortholog of a yeast RNA helicase, is mutant in ataxia-ocular apraxia 2
Nat. Genet.
 , 
2004
, vol. 
36
 (pg. 
225
-
227
)
83
Skourti-Stathaki
K.
Proudfoot
N.J.
Gromak
N.
Human senataxin resolves RNA/DNA hybrids formed at transcriptional pause sites to promote Xrn2-dependent termination
Mol. Cell
 , 
2011
, vol. 
42
 (pg. 
794
-
805
)
84
Suraweera
A.
Lim
Y.
Woods
R.
Birrell
G.W.
Nasim
T.
Becherel
O.J.
Lavin
M.F.
Functional role for senataxin, defective in ataxia oculomotor apraxia type 2, in transcriptional regulation
Hum. Mol. Genet.
 , 
2009
, vol. 
18
 (pg. 
3384
-
3396
)

Author notes

These authors contributed equally to this work.

Supplementary data