Abstract

Huntington's disease (HD) is an autosomal-dominant neurodegenerative disorder caused by a polyglutamine expansion in the amino-terminal region of the huntingtin protein, which promotes progressive neuronal cell loss, neurological symptoms and death. In the present study, we show that blockade of mGluR5 with MTEP promotes increased locomotor activity in both control (HdhQ20/Q20) and mutant HD (HdhQ111/Q111) mice. Although acute injection of MTEP increases locomotor activity in both control and mutant HD mice, locomotor activity is increased in only control mice, not mutant HD mice, following the genetic deletion of mGluR5. Interestingly, treatment of mGluR5 knockout mice with either D1 or D2 dopamine antagonists eliminates the increased locomotor activity of mGluR5 knockout mice. Amphetamine treatment increases locomotor activity in control mice, but not mGluR5 null mutant HD mice. However, the loss of mGluR5 expression improves rotarod performance and decreases the number of huntingtin intranuclear inclusions in mutant HD mice. These adaptations may be due to mutant huntingtin-dependent alterations in gene expression, as microarray studies have identified several genes that are altered in mutant, but not wild-type HD mice lacking mGluR5 expression. qPCR experiments confirm that the mRNA transcript levels of dynein heavy chain, dynactin 3 and dynein light chain-6 are altered following the genetic deletion of mGluR5 in mutant HD mice, as compared with wild-type mutant HD mice. Thus, our data suggest that mutant huntingtin protein and mGluR5 exhibit a functional interaction that may be important for HD-mediated alterations in locomotor behavior and the development of intranuclear inclusions.

INTRODUCTION

Huntington's disease (HD) is an autosomal-dominant neurodegenerative disorder caused by a progressive neuronal cell loss in the caudate-putamen, which leads to involuntary body movement, loss of cognitive function, psychiatric disturbance and death (1,2). HD patients typically exhibit hyperkinesia such as chorea, which is characterized by involuntary, abrupt and irregular movements (1–3). The mutated form of the huntingtin (Htt) protein, exhibiting >37 polyglutamines in the amino-terminal region, is proposed as the cause of the neuronal cell loss observed in the caudate-putamen (striatum in rodents) and neocortical regions of HD patients (4). The striatum is composed mainly (85%) of medium-sized spiny neurons (MSNs), which are GABAergic neurons, but also of interneurons, including cholinergic neurons (5). Although MSNs are the first neurons to be affected during HD progression, cholinergic neurons are spared (6,7).

Striatal neurons receive input from different areas of the basal ganglia and also glutamatergic input from thalamus and cortex (8,9). Moreover, dopaminergic neurons from the substantia nigra pars compacta (SNc) receive both GABAergic input from MSNs and glutamatergic input from the cortex (10,11). Thus, glutamate plays a major role in basal ganglia–thalamus–cortical circuits. A number of reports have demonstrated that the metabotropic glutamate receptor 5 (mGluR5) is involved in locomotor activity (12,13). mGluR5 is coupled to the activation of Gαq/11 proteins, which stimulate the activation of phospholipase Cβ1 resulting in diacylglycerol and inositol-1,4,5-triphosphate formation, release of Ca2+ from intracellular stores and the activation of protein kinase C. mGluR5 also activates cell signaling pathways important for cell survival/proliferation (14–16). Moreover, it has been demonstrated that mGluR5 binds to Htt and that mGluR5 G protein signaling is selectively reduced, whereas Akt and extracellular signal-regulated kinase 1/2 (ERK1/2) signaling are increased, in a mouse model of HD, HdhQ111/Q111 knock-in mice, as compared with HdhQ20/Q20 control knock-in mice (17). Treatment of a HD transgenic mouse model with MPEP, which is a mGluR5 antagonist, slightly increases survival of the mutant mice (18). In addition, mGluR5-positive allosteric modulators prevent neuronal cell death of striatal neurons from a BACHD mouse model of HD and increase Akt signalling in the absence of increases in intracellular Ca2+ concentrations (19). However, despite of all this evidence, it is still not clear whether mGluR5 plays a role in HD. To shed some light on this issue, we have crossed mGluR5−/− mice with HdhQ111/Q111 and HdhQ20/Q20 mice and performed a series of molecular and in vivo studies.

In the present study, we demonstrate that both control and HD mutant mice treated with MTEP, as well as control mice lacking mGluR5 expression, exhibit increased locomotor activity. However, in mice expressing mutant huntingtin protein (HdhQ111/Q111), genetic deletion of mGluR5 does not result in a hyperlocomotor phenotype. Interestingly, D1 and D2 dopamine antagonists are capable of eliminating the increase in locomotor activity promoted by the genetic deletion of mGluR5. Moreover, mGluR5 knockout also improves rotarod performance and decreases huntingtin intranuclear inclusions in mutant HD mice. In addition, microarray studies indicate that mutated huntingtin protein can alter the expression of a number of genes that are involved in the modulation of locomotor activity in mice lacking mGluR5. Thus, our data clearly support the notion that mGluR5 plays an important role in HD pathology and motor symptoms.

RESULTS

To test whether mGluR5 had a role in locomotor activity, we submitted mGluR5 knockout (mGluR5−/−) mice to an open-field arena. mGluR5−/− mice were more active in the arena than mGluR5+/+ mice as evidenced by the total distance traveled (Fig. 1A and B), confirming that mGluR5 was important for movement control. Moreover, the locomotor activity lines for wild-type and mGluR5 knockout mice have the same slope (Fig. 1A), which indicates that both mouse lines habituate at the same rate.

Figure 1.

mGluR5−/− mice exhibit increased locomotor activity. Graph shows total distance traveled by wild-type (mGluR5+/+) (n = 11) and mGluR5 knockout (mGluR5−/−) (n = 12) mice measured at 5-min intervals (A) or cumulatively >120 min (B). Each animal was monitored for 120 min in open-field apparatus. Data represent the means ± SEM. * indicates significant difference as compared with mGluR5+/+ mice (P < 0.05).

Figure 1.

mGluR5−/− mice exhibit increased locomotor activity. Graph shows total distance traveled by wild-type (mGluR5+/+) (n = 11) and mGluR5 knockout (mGluR5−/−) (n = 12) mice measured at 5-min intervals (A) or cumulatively >120 min (B). Each animal was monitored for 120 min in open-field apparatus. Data represent the means ± SEM. * indicates significant difference as compared with mGluR5+/+ mice (P < 0.05).

Abnormal movements including hyperkinesia and chorea are the most typical symptoms observed in HD patients, and we previously demonstrated that mGluR5 signaling was altered in mutant HD (HdhQ111/Q111) mice (1–3,20). Therefore, to further study the role of mGluR5 in HD, we investigated the locomotor activity of control (HdhQ20/Q20) and mutant HD mice that were crossed with mGluR5 knockout mice. At 3 months of age, mGluR5 null control mice (HdhQ20/Q20/mGluR5−/−) traveled much further in the open-field arena than wild-type control mice, wild-type mutant HD mice or mGluR5 null mutant HD mice (HdhQ111/Q111/mGluR5−/−) (Fig. 2A). To determine whether the hyperlocomotor phenotype was influenced by age, we also submitted the same groups of mice at the ages of 6, 9, 12, 15, 18, 21 and 24 months to the open-field arena (Fig. 3B). Statistical analysis [two-way analysis of variance (ANOVA)] indicated that there is an interaction between age and genotype [±(21.3) = 2.02, P = 0.005]. Moreover, both genotype [±(3.3) = 114.1, P < 0.0001] and age [±(7.3) = 2.65, P = 0.0115] affect locomotor activity, although age did not seem to play a major role. Locomotor activity of mGluR5 null control mice remained higher than that of mGluR5 null mutant HD mice, and Bonferroni posttests indicated that this difference was significant at the ages of 3, 6, 15 and 24 months (Fig. 2B). Moreover, the locomotor activity of the mGluR5 null mutant HD mice was significantly different from that of wild-type control mice at the ages of 9, 12 and 15 months (Fig. 2B). Interestingly, although the distance traveled by mGluR5 null control mice was higher than that of mGluR5 null mutant HD mice, time spent in the center of the arena was not different between the two lines of mice (Fig. 2C and D), indicating that mutant huntingtin affects locomotor activity specifically, but did not appear to affect anxiety behavior. Moreover, the four tested mouse lines did not display differences in weight gain (data not shown) or in huntingtin mRNA and protein expression levels (Supplementary Material, Fig. S1). In addition, the tested mouse lines did not exhibit any kind of stereotypical behavior when allocated either in their home cage or in the open-field arena (Supplementary Material, Fig. S2). Together, these data suggest that the expression of mutated huntingtin protein in mGluR5 null mutant mice might be activating compensatory mechanisms that prevented the increase in locomotor activity.

Figure 2.

Mutant huntingtin abrogates mGluR5−/−-induced increased locomotor activity. Graphs show total distance traveled (A) and time spent in the center of the apparatus (C) by control (HdhQ20/Q20/mGluR5+/+) (n = 11), mGluR5 null control (HdhQ20/Q20/mGluR5−/−) (n = 11), mutant HD (HdhQ111/Q111/mGluR5+/+) (n = 12) and mGluR5 null mutant HD (HdhQ111/Q111/mGluR5−/−) mice (n = 11) at 3 months of age measured at 5-min intervals. Each animal was monitored for 120 min. Data represent the means ± SEM. Graphs show total distance traveled (B) and time spent in the center (D) by HdhQ20/Q20/mGluR5+/+ (n = 9–11), HdhQ20/Q20/mGluR5−/− (n = 6–11), HdhQ111/Q111/mGluR5+/+ (n = 9–12) and HdhQ111/Q111/mGluR5−/− mice (n = 6–11) tested at 3, 6, 9, 12, 15, 18, 21 and 24 months of age. Each animal was monitored for 120 min in the open-field apparatus. Data represent means ± SEM. * indicates significant differences as compared with HdhQ111/Q111/mGluR5−/− mice (P < 0.05).

Figure 2.

Mutant huntingtin abrogates mGluR5−/−-induced increased locomotor activity. Graphs show total distance traveled (A) and time spent in the center of the apparatus (C) by control (HdhQ20/Q20/mGluR5+/+) (n = 11), mGluR5 null control (HdhQ20/Q20/mGluR5−/−) (n = 11), mutant HD (HdhQ111/Q111/mGluR5+/+) (n = 12) and mGluR5 null mutant HD (HdhQ111/Q111/mGluR5−/−) mice (n = 11) at 3 months of age measured at 5-min intervals. Each animal was monitored for 120 min. Data represent the means ± SEM. Graphs show total distance traveled (B) and time spent in the center (D) by HdhQ20/Q20/mGluR5+/+ (n = 9–11), HdhQ20/Q20/mGluR5−/− (n = 6–11), HdhQ111/Q111/mGluR5+/+ (n = 9–12) and HdhQ111/Q111/mGluR5−/− mice (n = 6–11) tested at 3, 6, 9, 12, 15, 18, 21 and 24 months of age. Each animal was monitored for 120 min in the open-field apparatus. Data represent means ± SEM. * indicates significant differences as compared with HdhQ111/Q111/mGluR5−/− mice (P < 0.05).

Figure 3.

Acute MTEP injection induces increased locomotor activity in both HdhQ20/Q20 and HdhQ111/Q111 mice. (A and B) Graphs show total distance traveled by control (HdhQ20/Q20) (MTEP n = 8 and saline n = 7) and mutant HD (HdhQ111/Q111) (MTEP n = 8 and saline n = 7) mice. Animals were placed in the open-field box and injected at an injection point of 5 min with either saline or MTEP (i.p. 5 mg/Kg). Each animal was monitored for 120 min, and total distance was measured at 5-min intervals (A) or cumulatively >120 min (B). (C and D) Graphs show total distance traveled by HdhQ20/Q20 (MTEP n = 8 and saline n = 7) and HdhQ111/Q111 (MTEP n = 8 and saline n = 7) mice. Animals were placed in the open-field box and injected at an injection point of 60 min with either saline or MTEP (i.p. 5 mg/Kg). Each animal was monitored for 120 min, and total distance was measured at 5-min intervals (C) or cumulatively >120 min (D). Data represent the means ± SEM. * indicates significant differences as compared with matched genotype injected with saline (P < 0.05).

Figure 3.

Acute MTEP injection induces increased locomotor activity in both HdhQ20/Q20 and HdhQ111/Q111 mice. (A and B) Graphs show total distance traveled by control (HdhQ20/Q20) (MTEP n = 8 and saline n = 7) and mutant HD (HdhQ111/Q111) (MTEP n = 8 and saline n = 7) mice. Animals were placed in the open-field box and injected at an injection point of 5 min with either saline or MTEP (i.p. 5 mg/Kg). Each animal was monitored for 120 min, and total distance was measured at 5-min intervals (A) or cumulatively >120 min (B). (C and D) Graphs show total distance traveled by HdhQ20/Q20 (MTEP n = 8 and saline n = 7) and HdhQ111/Q111 (MTEP n = 8 and saline n = 7) mice. Animals were placed in the open-field box and injected at an injection point of 60 min with either saline or MTEP (i.p. 5 mg/Kg). Each animal was monitored for 120 min, and total distance was measured at 5-min intervals (C) or cumulatively >120 min (D). Data represent the means ± SEM. * indicates significant differences as compared with matched genotype injected with saline (P < 0.05).

To test whether the observed increase in locomotor activity caused by mGluR5 knockout could be recapitulated pharmacologically in control and mutant HD mice, we assessed the effects of mGluR5 antagonist MTEP on the locomotor activity of both mouse lines. To do this, we injected mice with MTEP (i.p. 5 mg/kg) 10 min after introducing the mice to the open-field arena. Both control and mutant HD mice injected with MTEP traveled much further in the arena than saline-injected mice, and no differences in the locomotor activity of both mouse lines was observed following acute pharmacological blockade of mGluR5 (Fig. 3A and B). However, it was not clear whether mGluR5 blockage caused hyperactivity or a lack of habituation. In order to investigate this, we introduced control and mutant HD mice to the open-field arena, waited 60 min for habituation to the new environment and then injected the mice with MTEP (i.p. 5 mg/kg). Both mouse lines showed an increase in locomotor activity, measured by distance traveled, following MTEP injection, indicating that mGluR5 blockage promotes hyperactivity as opposed to prevention of habituation (Fig. 3C and D).

The mechanism underlying the increase in locomotor activity promoted by mGluR5 blockage is unknown. Therefore, we investigated whether this increase in locomotor activity was dopamine dependent. Thus, mGluR5 null control and mutant HD mice were injected with either saline or the D2 dopamine receptor antagonist haloperidol (i.p. 0.5 mg/kg). Haloperidol caused the levels of locomotor activity, as measured by total distance, in the mGluR5 null control mice to go down to levels observed for mGluR5 null mutant HD mice (Fig. 4A and B). Similar results were observed when mGluR5 null control mice were injected with the D1 dopamine receptor antagonist SCH23390 (i.p. 0.5 mg/kg), as the levels of distance traveled by mGluR5 null control mice treated with SCH23390 were not different than those of mGluR5 null mutant HD mice (Fig. 4C and D). Interestingly, the distance traveled by mutant HD following either haloperidol or SCH23390 treatment was not different than that of saline-treated mutant HD mice that express mGluR5 (Fig. 4A–D). In addition, amphetamine (i.p. 2 mg/kg) treatment promoted a further increase in locomotor activity for mGluR5 null control mice, but had no effect on the locomotor activity of mGluR5 null mutant HD mice (Fig. 4E and F). These data suggested that the increase in locomotor activity observed following genetic deletion of mGluR5 in control mice was dopamine dependent. The lack of effect of amphetamine treatment on mGluR5 null mutant HD mice suggested that polyglutamine-expanded mutant huntingtin protein might activate a developmentally compensatory mechanism that appears to block the hyperactivity induced by both mGluR5 deletion and dopamine stimulation.

Figure 4.

Role of mutated huntingtin protein in locomotor activity involves both mGluR5 and dopamine neurotransmission. (A and B) Graphs show total distance traveled by mGluR5 null control (HdhQ20/Q20/mGluR5−/−)(haloperidol (haloper) n = 11 and saline n = 10) and mGluR5 null mutant HD (HdhQ111/Q111/mGluR5−/−) (haloperidol n = 7 and saline n = 7) mice. Animals were placed in the open-field box and injected at an injection point of 10 min with either saline or haloperidol (i.p. 0.5 mg/kg). Each animal was monitored for 120 min, and total distance was measured at 5-min intervals (A) or cumulatively >120 min (B). (C and D) Graphs show total distance traveled by HdhQ20/Q20/mGluR5−/− (SCH23390 (SCH) n = 9 and saline n = 10) and HdhQ111/Q111/mGluR5−/− (SCH23390 n = 11 and saline n = 10) mice. Animals were placed in the open-field box and injected at an injection point of 10 min with either saline or SCH23390 (i.p. 0.5 mg/kg). Each animal was monitored for 120 min, and total distance was measured at 5-min intervals (C) or cumulatively >120 min (D). (E and F) Graphs show total distance traveled by HdhQ20/Q20/mGluR5−/− (amphetamine (amphet) n = 21 saline n = 15) and HdhQ111/Q111/mGluR5−/− (amphetamine n = 21 and saline n = 15) mice. Animals were placed in the open-field box and injected at an injection point of 10 min with either saline or amphetamine (i.p. 2 mg/kg). Each animal was monitored for 120 min, and total distance was measured at 5-min intervals (E) or cumulatively >120 min (F). Data represent means ± SEM. * indicates significant differences as compared with matched genotype injected with saline (P < 0.05).

Figure 4.

Role of mutated huntingtin protein in locomotor activity involves both mGluR5 and dopamine neurotransmission. (A and B) Graphs show total distance traveled by mGluR5 null control (HdhQ20/Q20/mGluR5−/−)(haloperidol (haloper) n = 11 and saline n = 10) and mGluR5 null mutant HD (HdhQ111/Q111/mGluR5−/−) (haloperidol n = 7 and saline n = 7) mice. Animals were placed in the open-field box and injected at an injection point of 10 min with either saline or haloperidol (i.p. 0.5 mg/kg). Each animal was monitored for 120 min, and total distance was measured at 5-min intervals (A) or cumulatively >120 min (B). (C and D) Graphs show total distance traveled by HdhQ20/Q20/mGluR5−/− (SCH23390 (SCH) n = 9 and saline n = 10) and HdhQ111/Q111/mGluR5−/− (SCH23390 n = 11 and saline n = 10) mice. Animals were placed in the open-field box and injected at an injection point of 10 min with either saline or SCH23390 (i.p. 0.5 mg/kg). Each animal was monitored for 120 min, and total distance was measured at 5-min intervals (C) or cumulatively >120 min (D). (E and F) Graphs show total distance traveled by HdhQ20/Q20/mGluR5−/− (amphetamine (amphet) n = 21 saline n = 15) and HdhQ111/Q111/mGluR5−/− (amphetamine n = 21 and saline n = 15) mice. Animals were placed in the open-field box and injected at an injection point of 10 min with either saline or amphetamine (i.p. 2 mg/kg). Each animal was monitored for 120 min, and total distance was measured at 5-min intervals (E) or cumulatively >120 min (F). Data represent means ± SEM. * indicates significant differences as compared with matched genotype injected with saline (P < 0.05).

Previously, rotarod performance of mutant HD (Q111) mice was shown to not to be impaired when compared with that of control mice (21). Moreover, it was shown that MTEP had no effect on rotarod performance (22). To determine whether mGluR5 knockout could alter control and mutant HD mouse motor coordination, mice were trained and submitted to testing sections on the rotarod. Rotarod learning curves were not different among tested genotypes (Fig. 5A and B). In agreement to previously published data, the latency of control and mutant HD mice that express mGluR5 to fall from rotarod was not different from one another (Fig. 5C). The knockout of mGluR5 did not change the performance of control mice on the rotarod (Fig. 5C). However, genetic deletion of mGluR5 significantly improved the performance of mutant HD mice on the rotarod, when compared with all other genotypes (Fig. 5C). Statistical analysis (two-way ANOVA) indicates that both genotype [±(3.3) = 27.6, P < 0.0001] and age [±(7.3) = 20.1, P < 0.0001] affected rotarod performance. Moreover, Bonferroni posttests indicate that the rotarod performance of mGluR5 null mutant HD mice was better than that of wild-type control mice at the ages of 3, 6 and 21 months (Fig. 5C). These data further support the notion that mGluR5 is intrinsically implicated in the motor alterations promoted by mutated Htt protein.

Figure 5.

mGluR5 knockout improves HdhQ111/Q111 rotarod performance. (A and B) Graphs show rotarod learning curve represented as latency to fall from accelerating rotarod by control (HdhQ20/Q20/mGluR5+/+)(n = 9–11), mGluR5 null control (HdhQ20/Q20/mGluR5−/−) (n = 6–11), mutant HD (HdhQ111/Q111/mGluR5+/+) (n = 9–12) and mGluR5 null mutant HD (HdhQ111/Q111/mGluR5−/−) (n = 6–11) mice that were 3 (A) and 24 (B) months old. Each animal was trained for 10 min in six trials performed every day for five consecutive days. (C) Graph shows latency to fall from accelerating rotarod by HdhQ20/Q20/mGluR5+/+ (n = 9–11), HdhQ20/Q20/mGluR5−/− (n = 6–11), HdhQ111/Q111/mGluR5+/+ (n = 9–12) and HdhQ111/Q111/mGluR5−/− (n = 6–11) mice tested at 3, 6, 9, 12, 15, 18, 21 and 24 months of age. Each animal was tested in three trials, and the average latency to fall was determined. Data represent means ± SEM. * indicates significant differences as compared with HdhQ20/Q20/mGluR5+/+ mice (P < 0.05).

Figure 5.

mGluR5 knockout improves HdhQ111/Q111 rotarod performance. (A and B) Graphs show rotarod learning curve represented as latency to fall from accelerating rotarod by control (HdhQ20/Q20/mGluR5+/+)(n = 9–11), mGluR5 null control (HdhQ20/Q20/mGluR5−/−) (n = 6–11), mutant HD (HdhQ111/Q111/mGluR5+/+) (n = 9–12) and mGluR5 null mutant HD (HdhQ111/Q111/mGluR5−/−) (n = 6–11) mice that were 3 (A) and 24 (B) months old. Each animal was trained for 10 min in six trials performed every day for five consecutive days. (C) Graph shows latency to fall from accelerating rotarod by HdhQ20/Q20/mGluR5+/+ (n = 9–11), HdhQ20/Q20/mGluR5−/− (n = 6–11), HdhQ111/Q111/mGluR5+/+ (n = 9–12) and HdhQ111/Q111/mGluR5−/− (n = 6–11) mice tested at 3, 6, 9, 12, 15, 18, 21 and 24 months of age. Each animal was tested in three trials, and the average latency to fall was determined. Data represent means ± SEM. * indicates significant differences as compared with HdhQ20/Q20/mGluR5+/+ mice (P < 0.05).

To further characterize the consequences of polyglutamine-expanded huntingtin expression in an mGluR5 null genetic background, we performed immunohistochemistry experiments using EM48 antibody to determine the pattern of mutated huntingtin aggregation in the striatum of 12-month-old mice. Control mice that either express or do not express mGluR5 did not display any huntingtin aggregates (Fig. 6A and B). However, mutant HD mice that express mGluR5 exhibited high levels of diffuse EM48 labeling in the striatum, as well as darkly stained puncta (Fig. 6C and E), which has been characterized as ubiquitin-positive intranuclear inclusions (23). Interestingly, although diffuse EM48 labeling could be observed in the striatum of mGluR5 null mutant HD mice, intranuclear inclusions were mostly absent in the striata of these mice (Fig. 6D and F). Quantification of these data and statistical analysis demonstrate that both diffuse EM48 labeling (Fig. 6G) and intranuclear inclusions (Fig. 6H) were robustly reduced in mGluR5 null mutant HD mouse striatum as compared with that of wild-type HD mutant mice (Fig. 6E), strongly indicating that mGluR5 is involved in huntingtin aggregation. Statistical analysis (unpaired t-test) indicates a significant effect of genotype (P < 0.0001).

Figure 6.

The number of huntingtin (EM48) intranuclear inclusions is reduced by the knockout of mGluR5 in HdhQ111/Q111/mGluR5−/− mice. Shown are representative images for EM48 immunostaining from (A) control (HdhQ20/Q20/mGluR5+/+), (B) mGluR5 null control (HdhQ20/Q20/mGluR5−/−), (C) mutant HD (HdhQ111/Q111/mGluR5+/+) and (D) mGluR5 null mutant HD (HdhQ111/Q111/mGluR5−/−) striatal slices. Previous panels were enlarged to show intranuclear inclusions present in HdhQ111/Q111/mGluR5+/+ (E) and HdhQ111/Q111/mGluR5−/− (F) striatal slices. Graphs show quantification of diffuse EM48 staining (G) and number of Huntingtin aggregates (intranuclear inclusions) (G) found per 900 × 900 μm2. Data represent the means ± SEM for three independent experiments. Asterisks indicate significant differences (unpaired t-test) as compared with HdhQ111/Q111/mGluR5+/+ mice (P < 0.05). Scale bar = 150 µm.

Figure 6.

The number of huntingtin (EM48) intranuclear inclusions is reduced by the knockout of mGluR5 in HdhQ111/Q111/mGluR5−/− mice. Shown are representative images for EM48 immunostaining from (A) control (HdhQ20/Q20/mGluR5+/+), (B) mGluR5 null control (HdhQ20/Q20/mGluR5−/−), (C) mutant HD (HdhQ111/Q111/mGluR5+/+) and (D) mGluR5 null mutant HD (HdhQ111/Q111/mGluR5−/−) striatal slices. Previous panels were enlarged to show intranuclear inclusions present in HdhQ111/Q111/mGluR5+/+ (E) and HdhQ111/Q111/mGluR5−/− (F) striatal slices. Graphs show quantification of diffuse EM48 staining (G) and number of Huntingtin aggregates (intranuclear inclusions) (G) found per 900 × 900 μm2. Data represent the means ± SEM for three independent experiments. Asterisks indicate significant differences (unpaired t-test) as compared with HdhQ111/Q111/mGluR5+/+ mice (P < 0.05). Scale bar = 150 µm.

To further investigate the mechanism behind the observed adaptive phenotype of mGluR5 null mutant HD mice, we decided to analyze whether mutated huntingtin expression in an mGluR5 null background was altering the expression of genes that might be involved in the pattern of huntingtin aggregation and HD-related locomotor alterations. Thus, we performed a microarray assay to compare mRNA expression levels between wild-type control mice, mGluR5 null control mice, wild-type mutant HD mice and mGluR5 null mutant HD mice. As expected, mGluR5 expression was down-regulated in both mouse lines lacking mGluR5 expression when compared with wild-type control and mutant HD mice (data not shown). These data support the assumption that the microarray assay was performed properly and was capable of detecting gene expression variations. To identify pathways and networks of genes significantly altered in mGluR5 null mutant HD mice versus wild-type mutant HD mice, we analyzed the microarray data using ingenuity pathway analysis (IPA). The microarray analysis indicated that the expression of many genes encoding for animal motility, cell transport, vesicular trafficking proteins, brain development and protein aggregation was altered in mGluR5 null mutant HD when compared with wild-type mutant HD mice (Tables 1 and 2 and Supplementary Material, Fig. S3). The expression of these genes was neither different nor altered when we compared wild-type control and mutant HD mice (data not shown).

Table 1.

Genes up-regulated in HdhQ111/Q111/mGluR5−/− versus HdhQ20/Q20/mGluR5−/− mice that are not up-regulated in HdhQ111/Q111/mGluR5+/+ versus HdhQ20/Q20/mGluR5+/+ mice

Gene name Gene symbol RefSeq Transcript ID Fold change P-value 
Dynein, axonemal, heavy chain 6 Dnahc6 ENSMUS00000T114038 10545502 6.00 1.33E-07 
5′ nucleotidase domain containing 3 Nt5dc3 NM_175331 10365518 3.38 3.04E-06 
Serine (or cysteine) peptidase inhibitor Serpina3n NM_009252 10398075 3.03 1.12E-07 
Vomeronasal 1 receptor V1rc15 NM_134170 10545111 2.77 0.000827765 
Secreted phosphoprotein 1 Spp1 NM_009263 10523717 2.38 0.00137286 
Phospholipase A2 PLA2g4e NM_177845 10486403 2.11 1.78E-05 
Protocadherin beta 8 Pcdhb8 NM_053133 10455078 1.79 0.00190443 
Trafficking protein particle complex 2-like Trappc2l NM_021502 10576152 1.75 0.000105982 
Dynein light chain Tctex, type 1 Dynlt1 NM_009342 10548785 1.75 0.000488174 
Iduronidase, alpha-L- Idua NM_008325 10524034 1.67 5.08E-05 
Double homeobox B-like Duxbl NM_183389 10413255 1.66 9.54E-05 
WD repeat and FYVE domain containing 1 Wdfy1 NM_001111279 10355974 1.65 7.18E-05 
Aryl hydrocarbon receptor nuclear translocator-like 2 Arntl2 NM_172309 10542764 1.63 6.59E-06 
Serine/threonine kinase 10 Stk10 NM_009288 10375083 1.59 4.62E-05 
Filamin, beta Flnb NM_134080 10412562 1.58 3.26E-05 
Hippocalcin-like 1 Hpcal1 NM_016677 10399671 1.55 0.000205577 
Solute carrier family 35, member F3 Slc35f3 NM_175434 10576586 1.52 4.60E-05 
Integrator complex subunit 7 Ints7 NM_178632 10352735 1.51 0.000138663 
Matrilin 2 Matn2 NM_016762 10423599 1.47 0.000223666 
Natriuretic peptide precursor type A Nppa NM_008725 10510265 1.37 5.04E-05 
Exonuclease 3′–5′ domain containing 1 Exd1 NM_172857 10486241 1.35 0.000212041 
Ectonucleoside triphosphate diphosphohydrolase 2 Entpd2 NM_009849 10470014 1.33 2.82E-05 
Rho GTPase activating protein 4 Arhgap4 NM_138630 10605143 1.30 0.000340499 
Tubby like protein 4 Tulp4 NM_054040 10441497 1.25 0.000128779 
Gene name Gene symbol RefSeq Transcript ID Fold change P-value 
Dynein, axonemal, heavy chain 6 Dnahc6 ENSMUS00000T114038 10545502 6.00 1.33E-07 
5′ nucleotidase domain containing 3 Nt5dc3 NM_175331 10365518 3.38 3.04E-06 
Serine (or cysteine) peptidase inhibitor Serpina3n NM_009252 10398075 3.03 1.12E-07 
Vomeronasal 1 receptor V1rc15 NM_134170 10545111 2.77 0.000827765 
Secreted phosphoprotein 1 Spp1 NM_009263 10523717 2.38 0.00137286 
Phospholipase A2 PLA2g4e NM_177845 10486403 2.11 1.78E-05 
Protocadherin beta 8 Pcdhb8 NM_053133 10455078 1.79 0.00190443 
Trafficking protein particle complex 2-like Trappc2l NM_021502 10576152 1.75 0.000105982 
Dynein light chain Tctex, type 1 Dynlt1 NM_009342 10548785 1.75 0.000488174 
Iduronidase, alpha-L- Idua NM_008325 10524034 1.67 5.08E-05 
Double homeobox B-like Duxbl NM_183389 10413255 1.66 9.54E-05 
WD repeat and FYVE domain containing 1 Wdfy1 NM_001111279 10355974 1.65 7.18E-05 
Aryl hydrocarbon receptor nuclear translocator-like 2 Arntl2 NM_172309 10542764 1.63 6.59E-06 
Serine/threonine kinase 10 Stk10 NM_009288 10375083 1.59 4.62E-05 
Filamin, beta Flnb NM_134080 10412562 1.58 3.26E-05 
Hippocalcin-like 1 Hpcal1 NM_016677 10399671 1.55 0.000205577 
Solute carrier family 35, member F3 Slc35f3 NM_175434 10576586 1.52 4.60E-05 
Integrator complex subunit 7 Ints7 NM_178632 10352735 1.51 0.000138663 
Matrilin 2 Matn2 NM_016762 10423599 1.47 0.000223666 
Natriuretic peptide precursor type A Nppa NM_008725 10510265 1.37 5.04E-05 
Exonuclease 3′–5′ domain containing 1 Exd1 NM_172857 10486241 1.35 0.000212041 
Ectonucleoside triphosphate diphosphohydrolase 2 Entpd2 NM_009849 10470014 1.33 2.82E-05 
Rho GTPase activating protein 4 Arhgap4 NM_138630 10605143 1.30 0.000340499 
Tubby like protein 4 Tulp4 NM_054040 10441497 1.25 0.000128779 
Table 2.

Genes down-regulated in HdhQ20/Q20/mGluR5−/− versus HdhQ111/Q111/mGluR5−/− mice that are not down-regulated in HdhQ20/Q20/mGluR5+/+ versus HdhQ111/Q111/mGluR5+/+ mice

Gene name Gene symbol RefSeq Transcript ID Fold change P-value 
Protein phosphatase 1, inhibitor subunit 2 Gm5972 NR_003650 10467003 −4.21 5.98E-07 
Pituitary tumor-transforming gene 1 Pttg1 NM_013917 10385325 −3.53 1.02E-06 
Retinoic acid early transcript beta Raet1b BC132022 10362097 −3.07 0.000186535 
Ubiquitin-like domain containing CTD phosphatase 1 Ublcp1 NM_024475 10385361 −2.34 1.67E-05 
Activin A receptor, type II-like 1 Acvrl1 NM_009612 10426999 −2.24 3.32E-07 
Heat shock protein 8 Hspa8 NM_031165 10584572 −2.22 2.14E-06 
Hematological and neurological expressed 1-like Hn1l EF651808 10417359 −2.12 1.68E-05 
Interphotoreceptor matrix proteoglycan 1 Impg1 NM_022016 10595306 −2.11 0.000146534 
Chemokine (C-C motif) ligand 28 Ccl28 NM_020279 10598203 −2.05 0.000876406 
Progressive myoclonic epilepsy, type 2 gene Epm2a NM_010146 10361754 −1.95 0.000169655 
Dynactin 3 Dynactin 3 NM_016890 10512291 −1.87 0.000101524 
Retinol binding protein 1 Rbp1 NM_011254 10588037 −1.83 0.00083148 
Chromobox homolog 7 Cbx7 NM_144811 10430649 −1.79 0.000629588 
Nucleoporin 35 Nup35 NM_027091 10567131 −1.78 0.00012699 
Carbonic anyhydrase 12 Car12 NM_178396 10586591 −1.78 0.000179906 
Holliday junction recognition protein Hjurp NM_198652 10356461 −1.78 4.66E-06 
Solute carrier family 7 (cationic amino acid transporter) Slc7a11 NM_011990 10498024 −1.76 0.000298727 
Hydroxysteroid (17-beta) dehydrogenase 7 Hsd17b7 NM_010476 10359917 −1.73 0.000364903 
Abhydrolase domain containing 10 Abhd10 NM_172511 10439701 −1.70 0.000383236 
Transmembrane protein 44 Tmem44 NM_172614 10438942 −1.65 0.000222186 
Midline 1 Mid1 NM_010797 10603208 −1.64 0.000202454 
N-acetylneuraminate pyruvate lyase Npl NM_028749 10358879 −1.63 0.000374456 
Toll-like receptor 1 Tlr1 NM_030682 10530145 −1.62 0.000611089 
Tensin 1 Tns1 NM_027884 10355536 −1.24 7.99E-05 
EPM2A (laforin) interacting protein 1 Epm2aip NM_175266 10589756 −1.60 0.000285304 
Hedgehog interacting protein-like 1 Hhipl1 NM_001044380 10398211 −1.58 1.17E-06 
Disintegrin-like and metallopeptidase (reprolysin) Adamts3 NM_001081401 10531193 −1.55 0.000446511 
PTPRF interacting protein, binding protein 1 (liprin) Ppfibp1 NM_026221 10542791 −1.55 1.99E-05 
Formin 2 Fmn2 NM_019445 10351971 −1.54 0.000206781 
Serine peptidase inhibitor, Kazal, type 8 Spink8 NM_183136 10589407 −1.54 4.04E-05 
Cysteine-rich secretory protein LCCL domain containing Crispld1 NM_031402 10344990 −1.50 9.61E-06 
Leucine carboxyl methyltransferase 2 Lcmt2 NM_177846 10486710 −1.25 0.000273002 
FAT tumor suppressor homolog 4 Fat4 NM_183221 10491732 −1.26 0.000220214 
Purkinje cell protein 4-like 1 Pcp4l1 NM_025557 10360053 −1.27 2.36E-05 
Solute carrier family 6 (neurotransmitter transporter) Slc6a20a NM_139142 10597960 −1.29 0.000147968 
Glutamate receptor, metabotropic 7 Grm7 NM_177328 10540509 −1.37 0.000221335 
Deoxyguanosine kinase Dguok NM_013764 10545697 −1.38 0.000331795 
Protein tyrosine phosphatase, receptor, type B Ptprb NM_029928 10366476 −1.39 0.000361865 
Xanthine dehydrogenase Xdh NM_011723 10452815 −1.41 0.000301857 
Thrombospondin 2 Thbs2 NM_011581 10447951 −1.42 8.54E-06 
Gene name Gene symbol RefSeq Transcript ID Fold change P-value 
Protein phosphatase 1, inhibitor subunit 2 Gm5972 NR_003650 10467003 −4.21 5.98E-07 
Pituitary tumor-transforming gene 1 Pttg1 NM_013917 10385325 −3.53 1.02E-06 
Retinoic acid early transcript beta Raet1b BC132022 10362097 −3.07 0.000186535 
Ubiquitin-like domain containing CTD phosphatase 1 Ublcp1 NM_024475 10385361 −2.34 1.67E-05 
Activin A receptor, type II-like 1 Acvrl1 NM_009612 10426999 −2.24 3.32E-07 
Heat shock protein 8 Hspa8 NM_031165 10584572 −2.22 2.14E-06 
Hematological and neurological expressed 1-like Hn1l EF651808 10417359 −2.12 1.68E-05 
Interphotoreceptor matrix proteoglycan 1 Impg1 NM_022016 10595306 −2.11 0.000146534 
Chemokine (C-C motif) ligand 28 Ccl28 NM_020279 10598203 −2.05 0.000876406 
Progressive myoclonic epilepsy, type 2 gene Epm2a NM_010146 10361754 −1.95 0.000169655 
Dynactin 3 Dynactin 3 NM_016890 10512291 −1.87 0.000101524 
Retinol binding protein 1 Rbp1 NM_011254 10588037 −1.83 0.00083148 
Chromobox homolog 7 Cbx7 NM_144811 10430649 −1.79 0.000629588 
Nucleoporin 35 Nup35 NM_027091 10567131 −1.78 0.00012699 
Carbonic anyhydrase 12 Car12 NM_178396 10586591 −1.78 0.000179906 
Holliday junction recognition protein Hjurp NM_198652 10356461 −1.78 4.66E-06 
Solute carrier family 7 (cationic amino acid transporter) Slc7a11 NM_011990 10498024 −1.76 0.000298727 
Hydroxysteroid (17-beta) dehydrogenase 7 Hsd17b7 NM_010476 10359917 −1.73 0.000364903 
Abhydrolase domain containing 10 Abhd10 NM_172511 10439701 −1.70 0.000383236 
Transmembrane protein 44 Tmem44 NM_172614 10438942 −1.65 0.000222186 
Midline 1 Mid1 NM_010797 10603208 −1.64 0.000202454 
N-acetylneuraminate pyruvate lyase Npl NM_028749 10358879 −1.63 0.000374456 
Toll-like receptor 1 Tlr1 NM_030682 10530145 −1.62 0.000611089 
Tensin 1 Tns1 NM_027884 10355536 −1.24 7.99E-05 
EPM2A (laforin) interacting protein 1 Epm2aip NM_175266 10589756 −1.60 0.000285304 
Hedgehog interacting protein-like 1 Hhipl1 NM_001044380 10398211 −1.58 1.17E-06 
Disintegrin-like and metallopeptidase (reprolysin) Adamts3 NM_001081401 10531193 −1.55 0.000446511 
PTPRF interacting protein, binding protein 1 (liprin) Ppfibp1 NM_026221 10542791 −1.55 1.99E-05 
Formin 2 Fmn2 NM_019445 10351971 −1.54 0.000206781 
Serine peptidase inhibitor, Kazal, type 8 Spink8 NM_183136 10589407 −1.54 4.04E-05 
Cysteine-rich secretory protein LCCL domain containing Crispld1 NM_031402 10344990 −1.50 9.61E-06 
Leucine carboxyl methyltransferase 2 Lcmt2 NM_177846 10486710 −1.25 0.000273002 
FAT tumor suppressor homolog 4 Fat4 NM_183221 10491732 −1.26 0.000220214 
Purkinje cell protein 4-like 1 Pcp4l1 NM_025557 10360053 −1.27 2.36E-05 
Solute carrier family 6 (neurotransmitter transporter) Slc6a20a NM_139142 10597960 −1.29 0.000147968 
Glutamate receptor, metabotropic 7 Grm7 NM_177328 10540509 −1.37 0.000221335 
Deoxyguanosine kinase Dguok NM_013764 10545697 −1.38 0.000331795 
Protein tyrosine phosphatase, receptor, type B Ptprb NM_029928 10366476 −1.39 0.000361865 
Xanthine dehydrogenase Xdh NM_011723 10452815 −1.41 0.000301857 
Thrombospondin 2 Thbs2 NM_011581 10447951 −1.42 8.54E-06 

In order to confirm the microarray results, we performed quantitative real-time PCR (qPCR) to determine the expression of genes of interest, including the mGluR5 null mutant HD mouse up-regulated genes, dynein heavy chain 6 (Dnahc6) and dynein light Tctex chain-type 1B (Dynlt1), and the mGluR5 null mutant HD mouse down-regulated gene dynactin 3 (Dctn3). The qPCR results confirmed that Dnahc6 and Dynlt1 were up-regulated in mGluR5 null mutant HD mouse versus mGluR5 null control mice (Fig. 7A and B). Moreover, in agreement with the microarray results, Dctn3 was down-regulated in mGluR5 null mutant HD mouse versus mGluR5 null control mice (Fig. 7C). To determine whether the observed expression alterations were gene specific, we performed qPCR to measure expression levels of related genes that did not appear altered in the microarray assay. The microarray results did not indicate any changes in dynein light chain LC8-type 1 (Dynll1) and dynactin 6 (Dctn6) expression levels in mGluR5 null mutant HD mouse versus mGluR5 null control mice. Supporting these results, qPCR data also indicated that the expression of Dynll1 and Dctn6 was not different between mGluR5 null mutant HD mouse versus mGluR5 null control mice (Fig. 7D and E).

Figure 7.

Gene expression changes between HdhQ20/Q20/mGluR5−/− versus HdhQ111/Q111/mGluR5−/− mice. Graph shows mRNA levels of dynein heavy chain axonemal 6 (Dnahc6), NM_001164669.1 (A), dynactin 3, NM_016890 (B), dynein light Tctex chain-type 1B (Dynlt1b), NM_009342 (C), dynactin 6, NM_011722 (D), and dynein light chain LC8-type 1 (Dynll1), NM_019682 (D) determined by quantitative RT-PCR. mRNA was extracted from the striatum of age-matched mGluR5 null mutant HD (HdhQ111/Q111/mGluR5−/−) and mGluR5 null control (HdhQ20/Q20/mGluR5−/−) mice. qPCR reaction was performed in triplicate and normalized to actin mRNA levels. Data represent the means ± SEM of four independent experiments. * indicates significant differences as compared with HdhQ20/Q20/mGluR5−/− mice (P < 0.05).

Figure 7.

Gene expression changes between HdhQ20/Q20/mGluR5−/− versus HdhQ111/Q111/mGluR5−/− mice. Graph shows mRNA levels of dynein heavy chain axonemal 6 (Dnahc6), NM_001164669.1 (A), dynactin 3, NM_016890 (B), dynein light Tctex chain-type 1B (Dynlt1b), NM_009342 (C), dynactin 6, NM_011722 (D), and dynein light chain LC8-type 1 (Dynll1), NM_019682 (D) determined by quantitative RT-PCR. mRNA was extracted from the striatum of age-matched mGluR5 null mutant HD (HdhQ111/Q111/mGluR5−/−) and mGluR5 null control (HdhQ20/Q20/mGluR5−/−) mice. qPCR reaction was performed in triplicate and normalized to actin mRNA levels. Data represent the means ± SEM of four independent experiments. * indicates significant differences as compared with HdhQ20/Q20/mGluR5−/− mice (P < 0.05).

DISCUSSION

Chorea-like movements are the most characteristic symptoms of HD patients. Currently, these abnormal hyperkinetic movements are treated with antidopaminergic neuroleptic drugs, which are not very efficacious in the case of HD and may promote extrapyramidal side effects (24,25). A better understanding of the neural circuits and alterations promoted by mutated huntingtin will help to develop new therapeutic strategies to treat chorea-like HD symptoms. In the present study, we demonstrate that mGluR5 blockage promotes increased locomotor activity and that this increase is abrogated by D1 and D2 dopamine antagonists. mGluR5 null control (Q20/Q20) mice, as well as wild-type control mice treated with MTEP, exhibit increased locomotor activity as compared with control. However, although MTEP acute injection increases mutant HD mouse locomotor activity, knockout of mGluR5 in mutant HD mice does not promote augmented locomotor activity. Moreover, mGluR5 null mutant HD mice exhibit improved rotarod performance as compared with that of wild-type control, mGluR5 null control and mutant HD mice. In addition to these behavioral alterations, mutated huntingtin aggregation appears to be influenced by mGluR5 as huntingtin intranuclear inclusions observed in mutant HD mouse striatum are significantly reduced in mGluR5 null mutant HD mice. It is possible that mutated huntingtin protein could alter gene expression differently in the absence of mGluR5, which could account for these adaptations. Supporting this hypothesis, our microarray study indicates that mutated huntingtin protein can alter the expression of a number of genes that could be important for the locomotor adaptations and decrease in huntingtin intranuclear inclusions observed in mGluR5 null mutant HD mice. Importantly, qPCR experiments confirmed that the mRNA transcript levels of Dnahc6 and Dynlt1, and dynactin 3 are altered in mGluR5 null mutant HD mice, as compared with mGluR5 null control mice, although these alteration are not observed when we compare wild-type control and mutant HD mice.

mGluR5 is highly expressed in the striatum, which is the main region affected in HD (26,27). Our group has established a link between mGluR5 and HD by showing that group I mGluRs interact with the huntingtin protein (17). Moreover, mutant huntingtin protein can alter mGluR5 signaling, decreasing inositol-1,4,5-triphosphate (IP3) formation and increasing ERK1/2 and AKT activation (20). A number of reports have demonstrated that mGluR5 blockage can induce hyperkinetic movements (12,13). In agreement with these findings, our data demonstrate that mGluR5 knockout or mGluR5 blockage induce hyperkinesia in mice, suggesting that mGluR5 could contribute to HD chorea.

It is still unknown how mGluR5 blockage induces hyperkinesia and which neuronal circuits are involved in this regulation. We show that the hyperkinesia exhibited by the mGluR5 knockout mice is abolished by D1 and D2 dopamine receptor antagonists, haloperidol and SCH23390, respectively. It is well known that the glutamatergic and dopaminergic systems physically interact in certain brain regions, including the striatum, nucleus accumbens and prefrontal cortex, and that this interaction is important for the control of both cognition and movement (28–31). Interestingly, striatum and cortex are the primary affected areas in HD (6,7). Importantly, our data demonstrate that mutated Huntingtin expression abolishes increased locomotor activity promoted by both mGluR5 knockout and amphetamine, further supporting the idea that mGluR5 blockage in the striatum and cortex could be involved in hyperkinesia. The striatum is mainly composed of GABAergic inhibitory MSNs, which express high levels of mGluR5 and project to different areas of the brain, including the SNc, which is mainly composed of dopaminergic projection neurons that up-regulate locomotor activity via cortical and nigrostriatal stimulation (10,32). We hypothesize that the increase in locomotor activity observed in mGluR5 knockout mice is because of the decreased stimulation of MSNs by glutamatergic cortical projection neurons, which in wild-type mice can occur via mGluR5 activation (8,9). Decreased stimulation of MSNs lessens the inhibition of SNc neurons, leading to dopaminergic disinhibition and increased thalamocortical stimulation, which can increase locomotor activity. Further experiments, including brain region-specific injections of MTEP, will be important to confirm this hypothesis.

Motor coordination deficit can be typically observed in HD patients, and this feature is also present in most HD mouse models, such as R6/2, YAC128 and BACHD, which can be assessed by submitting the animals to the rotarod task (21). However, knock-in mouse models of HD with <150 polyglutamines, such as HdhQ111/Q111 mice, do not exhibit any impairment in rotarod performance, as compared with control (21,33). It has also been shown that mGluR5 blockage with MTEP does not improve rotarod performance (22). However, we show here that the knockout of mGluR5 in a mouse expressing mutated huntingtin, but not wild-type huntingtin, improves rotarod performance. One potential hypothesis to explain these finding is that mGluR5 blockage facilitates motor coordination but that improvement in motor coordination in mGluR5 null control mice is abrogated by hyperactivity. Thus, because the mGluR5 null mutant HD mice do not exhibit increased locomotor activity, improvement in rotarod performance can be detected in these mice. Further experiments, including crossing a HD mouse model that exhibit rotarod deficiency to mGluR5 knockout mice, will be necessary to test this hypothesis and determine whether mGluR5 blockage can improve motor coordination in HD. Moreover, the knockout of mGluR5 in a HD mouse model that has a short life span will be important to determine whether the lack of mGluR5 could increase mouse longevity.

MTEP acute injection was sufficient to augment locomotor activity in both control and mutant HD mice. However, lack of mGluR5 expression during the whole life span as in mGluR5 knockout mice fails to increase locomotor activity in mutant huntingtin expressing mice, although mGluR5 null control mice exhibit increased locomotor activity. These data indicate that following the developmental loss of mGluR5 expression, the mutated huntingtin protein might activate compensatory mechanisms that abrogate mGluR5-induced hyperkinesia. Understanding these mechanisms could contribute to a better comprehension of mutant Huntingtin-induced chorea. A number of reports indicate that the mutated Huntingtin protein can alter gene expression (34,35). Moreover, mGluR5 stimulation can also modify gene expression (36,37). Thus, we investigated whether mutated Huntingtin-induced gene expression alterations in an mGluR5 null background could help to explain the lack of hyperkinesia, improved rotarod performance and decreased intranuclear inclusions observed in mGluR5 null mutant HD, as compared with mGluR5 null control mice. In agreement with this hypothesis, we found that the mRNA transcript levels correspondent to a number of genes were altered in mGluR5 null mutant HD, as compared with mGluR5 null control mice, but not in mGluR5 null control versus wild-type mice. These data indicate that there is a functional interaction between the glutamatergic system and mutated huntingtin in terms of controlling gene expression. In agreement with this assumption, it has been shown that the knockout of GluN3A, which is an NMDA receptor subunit, leads to normalization of NMDAR currents, prevention of synapse degeneration and striatal cell death, as well as reversion of motor and cognitive decline exhibited by YAC128 mice (38).

qPCR experiments confirmed that Dnahc6 and Dynlt1 genes were up-regulated and that dynactin 3 gene was down-regulated in mGluR5 null mutant HD, as compared with mGluR5 null control mice. Mutation and/or altered expression of proteins involved in axonal transport, such as dynein heavy chain, dynein light chain and dynactin, contribute to pathogenesis in multiple neurodegenerative diseases (39). Dyneins are microtubule motors that move cargo from the distal ends of axons toward neuronal cell bodies. It has been shown that decreased dynein function impairs autophagic clearance of aggregate-prone proteins, such as mutated Huntingtin, leading to increased huntingtin toxicity and enhanced phenotype in mouse and fly models of HD (40). A mouse model of HD expressing mutated Dnhc1 exhibited higher levels of tremor, worse performance in the grip strength and accelerating rotarod, compromised gait and a shorter lifespan, as compared with HD mouse that express wild-type Dnhc1 (40). Moreover, Caenorhabditis elegans expressing mutant proteins that are part of the dynein–dynactin complex, including dynein heavy chain, dynein light chain and dynactin, misaccumulate synaptic proteins at the ends of neuronal processes and exhibit progressive motor neuron disease symptoms (41). As these mutant C. elegans age, neuronal misaccumulations increase in size and frequency, locomotion becomes progressively slower and life span is shortened (41). Another study demonstrates that a mouse model that presents a point mutation in the dynein light intermediate chain 1 (Dync1li1) displays abnormal neuronal development, increased anxiety and lower levels of spontaneous locomotor activity, as compared with wild-type littermates (42). Thus, mutated huntingtin-mediated alterations could contribute to the phenotypic adaptations, including the diminished levels of huntingtin intranuclear inclusions and the motor alterations, observed in mGluR5 null mutant HD mice.

In conclusion, our data indicate that mutated huntingtin protein and mGluR5 exhibit a functional interaction that might be implicated in HD-related symptoms. Both mutated huntingtin and mGluR5 can regulate gene expression levels, which could account for the changes in motor behavior and pattern of huntingtin aggregation observed in mGluR5 null mutant HD mice. However, although mGluR5 knockout in mutant HD mice decreased huntingtin aggregation, it is still not clear whether mGluR5 antagonists could ameliorate HD-related symptoms. Future experiments will be important to further investigate the mechanisms underlying the alterations observed in mGluR5 null mutant HD mice.

MATERIALS AND METHODS

Materials

TRIzol, Nuclease-Free Water and Power SYBR® Green PCR Master Mix were purchased from Life Technologies (Foster City, CA, USA). Mouse anti-Huntingtin EM48 antibody was purchased from Millipore (Billerica, MA, USA). MTEP was kindly provided by Merck & Co., Inc. (Rahway, NJ, USA), haloperidol (Cat. H1512) was purchased from Sigma–Aldrich (St. Louis, MO, USA), SCH23390 (cat. 0925) and D-amphetamine (cat. 2813) were purchased from Tocris Bioscience (Bristol, UK). All other biochemical reagents were purchased from Sigma–Aldrich.

Mouse model

STOCK-Htttm2Mem/J (HdhQ20/Q20) and STOCK-Htttm5Mem/J (HdhQ111/Q111) knock-in mice (43) and mGluR5 knockout mice B6;129-Grm5tm1Rod/J (mGluR5−/−) (44) were purchased from Jackson Laboratory (Bar Harbor, ME, USA). HdhQ111/Q111/mGluR5−/− and HdhQ111/Q111/mGluR5+/+ mice were obtained by crossing HdhQ111/Q111 and mGluR5−/− mice. HdhQ20/Q20/mGluR5−/− and HdhQ20/Q20/mGluR5+/+ mice were obtained by crossing HdhQ20/Q20 and mGluR5−/− mice. Mice were housed in an animal care facility at 23°C on a 12 h light/12 h dark cycle with food and water provided ad libitum. Animal care was in accordance with The University of Western Ontario Animal Care Committee.

Open field

Eight VersaMax Animal Activity Monitors (AccuScan Instruments, Inc., Columbus, OH, USA) were used to measure locomotor activity. Experiments were performed during the light cycle of the mice and between the hours of 08:0 and 14:00. Mice were allowed to explore the open-field boxes (20 × 20 cm) for 120 min during which time movement was measured at 5-min intervals using beam breaks converted to cm. During drug studies, mice were allowed to explore the open-field boxes for 10 min after which an injection of either saline or drug was administered and the activity was monitored for additional 110 min. Measurement of total activity and time spent in the center of the arena were calculated,, and statistical analyses were performed using GraphPad Prism software.

Rotarod test

The training and testing of the mice on the rotarod treadmill system (Diego Instruments, Sand Diego, CA, USA) occurred during the light cycle between the hours of 08:00 and 14:00. Mice were habituated to the testing room for 15–20 min. To introduce the mice to the rotarod apparatus, mice were placed on the rotarod and left at rest for 5 min on the first day of training before beginning the accelerating protocol. Mice were then trained for a maximum of 10 min in six trials at an accelerating speed (from 4 to 40 RPM in 600 s) for five consecutive days with 10-min breaks between each trial. If mice fell in the first 20 s of training, they were placed back on the apparatus immediately, up to three times. Mice were returned to their home cages at the end of training day 5 and rested for 2 days. On day 8, mice were tested in three trials with accelerating speed separated by a 30-min inter-trial interval. The latency to fall from the rod was recorded, and the average obtained from the three trials was used for analysis. Mice remaining on the rod for >600 s were removed and their time scored as 600 s.

EM48 immunohistochemistry

Mice were transcardially perfused with 4% paraformaldehyde (PFA) in PBS. Brains were then dissected out and stored in 4% PFA in PBS. Prior to sectioning, brains were put into 30% sucrose in PBS overnight at 4°C. Brains were dissected into left and right hemisphere, with the right hemisphere used for histology. Brains were coronally sectioned through the striatum, from +1.18 to −0.4 mm bregma. Immunohistochemistry was performed on 40-µm free-floating sections using a peroxidase-based immunostaining protocol. In brief, endogenous peroxidase activity was quenched using 0.1% hydrogen peroxide, after which the membranes were permeabilized using 1% Triton X-100. Non-specific binding was blocked using 1.5% normal horse serum, followed by incubation in primary antibody (1:100, anti-Huntingtin protein, mouse monoclonal EM48 antibody) overnight at 4°C. Sections were washed in PBS and then incubated in secondary antibody (biotinylated horse anti-mouse, 1:400, Vector Elite ABC kit mouse) for 90 min at 4°C. Finally, sections were incubated in an avidin–biotin enzyme reagent (Vector Elite ABC kit mouse, PK-6102, Vector Laboratories). Immunostaining was visualized using a chromogen (Vector SG substrate). Sections were mounted on slides and visualized using a Zeiss LSM-510 META multiphoton laser scanning microscope with a Zeiss 10× lens, representative 900 × 900-µm areas of striatum were imaged for analysis. The number of EM48-positive cells was analyzed using the multi-threshold plugin on Image J, whereas the number of EM48-positive puncta per image was counted using the cell counter tool in Image J (NIH, USA). The difference in numbers between genotypes was analyzed using unpaired t-test.

Microarray hybridization and analysis

Microarray labeling and hybridization were performed at the London Regional Genomics Centre (Robarts Research Institute, London, ON, CA). To prepare 5.5 μg of cDNA using GeneChip® WT Terminal Labeling Kit (Affymetrix, Santa Clara, CA, USA), 20 μg of isolated RNA from striatum extracts was used. cDNAs were then labeled and hybridized in Mouse Gene 1.0 ST chips using GeneChip® WT Terminal Labeling Kit and GeneChip® Hybridization Wash and Stain kit (Affymetrix). The arrays were incubated for 17 ± 1 h, scanned with the GeneChip Scanner 3000 7G (Affymetrix) using Command Console v1.1, and probe set signals were calculated with the multi-array average algorithm. We used Partek Genomics Suite v6.5 (Partek, St. Louis, MO, USA) to determine differences in gene expression levels. Networks were generated through the use of IPA software (Ingenuity Pathway Analysis, Ingenuity Systems). Genotype effects were considered significant based of the following criteria: (i) ANOVA P-values < 0.05 and (ii) 1.5-fold increase or decrease. Considering that HdhQ111/Q111 is a knock-in mice, we used mGluR5 expression as an internal control for the microarray assay.

Quantitative RT-PCR

RNA was isolated using Trizol reagent as per manufacture's instructions (Invitrogen, Burlington, ON, USA). RNA was re-suspended in 20 μl of RNase-free water, and its concentration and quality were analyzed by NanoDrop™ (Thermo Scientific, Wilmington, USA) and gel electrophoresis, respectively. cDNAs were prepared from 40 ng of total RNA extracted in a 20 µl final reverse transcription reaction. Quantitative PCR was performed using the Power SYBR® Green PCR Master Mix and the ABI PRISM 7900HT Sequence Detection System platform (Applied Biosystems, Foster City, CA, USA). Quantitative RT-PCR (qPCR) was performed to quantify mRNA levels of the following genes: dynein light chain LC8-type 1—Dynll1 (NM_019682); dynactin 6—Dctn6 (NM_011722); dynein heavy chain axonemal 6—Dnahc6 (NM_001164669); dynactin 3—Dctn3 (NM_016890); dynein light Tctex chain-type 1B—Dynlt1b (NM_009342). Primers were designed using Primer3Plus Program: Dynll1 (forward: 5′ TTTGTCCCTGCCAAGTACTG 3′; reverse: 5′ CTTAACTGCCCTATCTGTGGTC 3′); Dctn6 (forward: 5′ TGATCCACCCTAAAGCACG 3′; reverse: 5′ ATAGGTTTGGGCTCTGTATCTTC 3′); Dnahc6 (forward: 5′ CGCAAGGAAGATGACACAGA 3′; reverse: 5′ TTAGAGACCCAGCCATGACC 3′); Dctn3 (forward: 5′ CAGATCCACATCCAGCAGCA 3′; reverse: 5′ ACCCTTCCAGGAGAGCCTTA 3′); Dynlt1b (forward: 5′ TCATGCAGAAGAACGGTGCT 3′; reverse: 5′ TCTGTGGAGCTGTCCCAGAA 3′). Samples were prepared in triplicate, and changes in gene expression were determined with the 2−ΔCT method using actin for normalization. All RT-qPCRs showed good quality of amplification, and the specificity and efficiency of primers were tested and confirmed by the serial dilution method.

Data analysis

Means ± SEM are shown for the number of independent experiments indicated in Figure Legends. GraphPad Prism software was used to analyze data for statistical significance and for curve fitting. Statistical significance was determined by ANOVA testing followed by post hoc Multiple Comparison testing.

SUPPLEMENTARY MATERIAL

Supplementary Material is available at HMG online.

FUNDING

This work was supported by the Canadian Institutes of Health Research (grant number: MOP-119437) and the Huntington's Society of Canada to S.S.G.F., FAPEMIG and CNPq grant to F.M.R. and FAPES grant to R.G.W.P.

ACKNOWLEDGEMENTS

S.S.G.F. holds a Tier I Canada Research Chair in Molecular Neurobiology and is a Career Investigator of the Heart and Stroke Foundation of Ontario.

Conflict of Interest statement. None declared.

REFERENCES

1
Li
S.H.
Li
X.J.
Huntingtin-protein interactions and the pathogenesis of Huntington's disease
TIGS
 , 
2004
, vol. 
20
 (pg. 
146
-
154
)
2
Young
A.B.
Huntingtin in health and disease
J. Clin. Invest.
 , 
2003
, vol. 
111
 (pg. 
299
-
302
)
3
DeLong
M.R.
Primate models of movement disorders of basal ganglia origin
TINS
 , 
1990
, vol. 
13
 (pg. 
281
-
285
)
4
THsDCR
G.
A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes. The Huntington's Disease Collaborative Research Group
Cell
 , 
1993
, vol. 
72
 (pg. 
971
-
983
)
5
Vincent
S.R.
Staines
W.A.
Fibiger
H.C.
Histochemical demonstration of separate populations of somatostatin and cholinergic neurons in the rat striatum
Neurosci. Lett.
 , 
1983
, vol. 
35
 (pg. 
111
-
114
)
6
Ferrante
R.J.
Kowall
N.W.
Richardson
E.P.
Jr
Bird
E.D.
Martin
J.B.
Topography of enkephalin, substance P and acetylcholinesterase staining in Huntington's disease striatum
Neurosci. Lett.
 , 
1986
, vol. 
71
 (pg. 
283
-
288
)
7
Ferrante
R.J.
Beal
M.F.
Kowall
N.W.
Richardson
E.P.
Jr
Martin
J.B.
Sparing of acetylcholinesterase-containing striatal neurons in Huntington's disease
Brain Res.
 , 
1987
, vol. 
411
 (pg. 
162
-
166
)
8
Parent
A.
Extrinsic connections of the basal ganglia
TINS
 , 
1990
, vol. 
13
 (pg. 
254
-
258
)
9
Joel
D.
Weiner
I.
The organization of the basal ganglia-thalamocortical circuits: open interconnected rather than closed segregated
Neurosci.
 , 
1994
, vol. 
63
 (pg. 
363
-
379
)
10
Smith
Y.
Bevan
M.D.
Shink
E.
Bolam
J.P.
Microcircuitry of the direct and indirect pathways of the basal ganglia
Neurosci.
 , 
1998
, vol. 
86
 (pg. 
353
-
387
)
11
Galvan
A.
Kuwajima
M.
Smith
Y.
Glutamate and GABA receptors and transporters in the basal ganglia: what does their subsynaptic localization reveal about their function?
Neurosci.
 , 
2006
, vol. 
143
 (pg. 
351
-
375
)
12
Gray
L.
van den Buuse
M.
Scarr
E.
Dean
B.
Hannan
A.J.
Clozapine reverses schizophrenia-related behaviours in the metabotropic glutamate receptor 5 knockout mouse: association with N-methyl-D-aspartic acid receptor up-regulation
Int. J. Neuropsychopharmacol.
 , 
2009
, vol. 
12
 (pg. 
45
-
60
)
13
McGeehan
A.J.
Janak
P.H.
Olive
M.F.
Effect of the mGluR5 antagonist 6-methyl-2-(phenylethynyl)pyridine (MPEP) on the acute locomotor stimulant properties of cocaine, D-amphetamine, and the dopamine reuptake inhibitor GBR12909 in mice
Psychopharmacol.
 , 
2004
, vol. 
174
 (pg. 
266
-
273
)
14
Rong
R.
Ahn
J.Y.
Huang
H.
Nagata
E.
Kalman
D.
Kapp
J.A.
Tu
J.
Worley
P.F.
Snyder
S.H.
Ye
K.
PI3 kinase enhancer-Homer complex couples mGluRI to PI3 kinase, preventing neuronal apoptosis
Nat. Neurosci.
 , 
2003
, vol. 
6
 (pg. 
1153
-
1161
)
15
Hou
L.
Klann
E.
Activation of the phosphoinositide 3-kinase-Akt-mammalian target of rapamycin signaling pathway is required for metabotropic glutamate receptor-dependent long-term depression
J. Neurosci.
 , 
2004
, vol. 
24
 (pg. 
6352
-
6361
)
16
Mao
L.
Yang
L.
Tang
Q.
Samdani
S.
Zhang
G.
Wang
J.Q.
The scaffold protein Homer1b/c links metabotropic glutamate receptor 5 to extracellular signal-regulated protein kinase cascades in neurons
J. Neurosci.
 , 
2005
, vol. 
25
 (pg. 
2741
-
2752
)
17
Anborgh
P.H.
Godin
C.
Pampillo
M.
Dhami
G.K.
Dale
L.B.
Cregan
S.P.
Truant
R.
Ferguson
S.S.G.
Inhibition of metabotropic glutamate receptor signaling by the huntingtin-binding protein optineurin
J. Biol. Chem.
 , 
2005
, vol. 
280
 (pg. 
34840
-
34848
)
18
Schiefer
J.
Sprunken
A.
Puls
C.
Luesse
H.G.
Milkereit
A.
Milkereit
E.
Johann
V.
Kosinski
C.M.
The metabotropic glutamate receptor 5 antagonist MPEP and the mGluR2 agonist LY379268 modify disease progression in a transgenic mouse model of Huntington's disease
Brain Res.
 , 
2004
, vol. 
1019
 (pg. 
246
-
254
)
19
Doria
J.
Silva
F.
de Souza
J.
Vieira
L.
Carvalho
T.
Reis
H.
Pereira
G.
Dobransky
T.
Ribeiro
F.
Metabotropic glutamate receptor 5 positive allosteric modulators are neuroprotective in a mouse model of Huntington's disease
Br. J. Pharmacol.
 , 
2013
, vol. 
169
 (pg. 
909
-
921
)
20
Ribeiro
F.M.
Paquet
M.
Ferreira
L.T.
Cregan
T.
Swan
P.
Cregan
S.P.
Ferguson
S.S.G.
Metabotropic glutamate receptor-mediated cell signaling pathways are altered in a mouse model of Huntington's disease
J. Neurosci.
 , 
2010
, vol. 
30
 (pg. 
316
-
324
)
21
Menalled
L.
El-Khodor
B.F.
Patry
M.
Suarez-Farinas
M.
Orenstein
S.J.
Zahasky
B.
Leahy
C.
Wheeler
V.
Yang
X.W.
MacDonald
M.
, et al.  . 
Systematic behavioral evaluation of Huntington's disease transgenic and knock-in mouse models
Neurobiol. Dis.
 , 
2009
, vol. 
35
 (pg. 
319
-
336
)
22
Busse
C.S.
Brodkin
J.
Tattersall
D.
Anderson
J.J.
Warren
N.
Tehrani
L.
Bristow
L.J.
Varney
M.A.
Cosford
N.D.
The behavioral profile of the potent and selective mGlu5 receptor antagonist 3-[(2-methyl-1,3-thiazol-4-yl)ethynyl]pyridine (MTEP) in rodent models of anxiety
Neuropsychopharmacol.
 , 
2004
, vol. 
29
 (pg. 
1971
-
1979
)
23
Wheeler
V.C.
White
J.K.
Gutekunst
C.A.
Vrbanac
V.
Weaver
M.
Li
X.J.
Li
S.H.
Yi
H.
Vonsattel
J.P.
Gusella
J.F.
, et al.  . 
Long glutamine tracts cause nuclear localization of a novel form of huntingtin in medium spiny striatal neurons in HdhQ92 and HdhQ111 knock-in mice
Hum. Mol. Genet.
 , 
2000
, vol. 
9
 (pg. 
503
-
513
)
24
Adam
O.R.
Jankovic
J.
Symptomatic treatment of Huntington disease
Neurotherapeutics
 , 
2008
, vol. 
5
 (pg. 
181
-
197
)
25
Bonelli
R.M.
Hofmann
P.
A systematic review of the treatment studies in Huntington's disease since 1990
Exp. Opin. Pharm.
 , 
2007
, vol. 
8
 (pg. 
141
-
153
)
26
Testa
C.M.
Standaert
D.G.
Young
A.B.
Penney
J.B.
Jr
Metabotropic glutamate receptor mRNA expression in the basal ganglia of the rat
J. Neurosci.
 , 
1994
, vol. 
14
 (pg. 
3005
-
3018
)
27
Ribeiro
F.M.
Ferreira
L.T.
Paquet
M.
Cregan
T.
Ding
Q.
Gros
R.
Ferguson
S.S.G.
Phosphorylation-independent regulation of metabotropic glutamate receptor 5 desensitization and internalization by G protein-coupled receptor kinase 2 in neurons
J. Biol. Chem.
 , 
2009
, vol. 
284
 (pg. 
23444
-
23453
)
28
Carlsson
M.
Carlsson
A.
Interactions between glutamatergic and monoaminergic systems within the basal ganglia-implications for schizophrenia and Parkinson's disease
TIPS
 , 
1990
, vol. 
13
 (pg. 
272
-
276
)
29
Carr
D.B.
Sesack
S.R.
Hippocampal afferents to the rat prefrontal cortex: synaptic targets and relation to dopamine terminals
J. Comp. Neurol.
 , 
1996
, vol. 
369
 (pg. 
1
-
15
)
30
Scott
L.
Aperia
A.
Interaction between N-methyl-D-aspartic acid receptors and D1 dopamine receptors: an important mechanism for brain plasticity
Neurosci.
 , 
2009
, vol. 
158
 (pg. 
62
-
66
)
31
Sesack
S.R.
Pickel
V.M.
In the rat medial nucleus accumbens, hippocampal and catecholaminergic terminals converge on spiny neurons and are in apposition to each other
Brain Res.
 , 
1990
, vol. 
527
 (pg. 
266
-
279
)
32
Meltzer
L.T.
Christoffersen
C.L.
Serpa
K.A.
Modulation of dopamine neuronal activity by glutamate receptor subtypes
Neurosci. Biobehav. Rev.
 , 
1997
, vol. 
21
 (pg. 
511
-
518
)
33
Lin
C.H.
Tallaksen-Greene
S.
Chien
W.M.
Cearley
J.A.
Jackson
W.S.
Crouse
A.B.
Ren
S.
Li
X.J.
Albin
R.L.
Detloff
P.J.
Neurological abnormalities in a knock-in mouse model of Huntington's disease
Hum. Mol. Genet.
 , 
2001
, vol. 
10
 (pg. 
137
-
144
)
34
Cha
J.H.
Transcriptional dysregulation in Huntington's disease
TIPS
 , 
2000
, vol. 
23
 (pg. 
387
-
392
)
35
Sugars
K.L.
Rubinsztein
D.C.
Transcriptional abnormalities in Huntington disease
TIGS
 , 
2003
, vol. 
19
 (pg. 
233
-
238
)
36
Huber
K.M.
Kayser
M.S.
Bear
M.F.
Role for rapid dendritic protein synthesis in hippocampal mGluR-dependent long-term depression
Science
 , 
2000
, vol. 
288
 (pg. 
1254
-
1257
)
37
Vanderklish
P.W.
Edelman
G.M.
Dendritic spines elongate after stimulation of group 1 metabotropic glutamate receptors in cultured hippocampal neurons
Proc. Natl. Acad. Sci. USA.
 , 
2002
, vol. 
99
 (pg. 
1639
-
1644
)
38
Marco
S.
Giralt
A.
Petrovic
M.M.
Pouladi
M.A.
Martinez-Turrillas
R.
Martinez-Hernandez
J.
Kaltenbach
L.S.
Torres-Peraza
J.
Graham
R.K.
Watanabe
M.
, et al.  . 
Suppressing aberrant GluN3A expression rescues synaptic and behavioural impairments in Huntington's disease models
Nat. Med.
 , 
2013
, vol. 
19
 (pg. 
1030
-
1038
)
39
Chevalier-Larsen
E.
Holzbaur
E.L.
Axonal transport and neurodegenerative disease
Biochim. Biophys. Acta.
 , 
2006
, vol. 
1762
 (pg. 
1094
-
1108
)
40
Ravikumar
B.
Acevedo-Arozena
A.
Imarisio
S.
Berger
Z.
Vacher
C.
O'Kane
C.J.
Brown
S.D.
Rubinsztein
D.C.
Dynein mutations impair autophagic clearance of aggregate-prone proteins
Nat. Genet.
 , 
2005
, vol. 
37
 (pg. 
771
-
776
)
41
Koushika
S.P.
Schaefer
A.M.
Vincent
R.
Willis
J.H.
Bowerman
B.
Nonet
M.L.
Mutations in Caenorhabditis elegans cytoplasmic dynein components reveal specificity of neuronal retrograde cargo
J. Neurosci.
 , 
2004
, vol. 
24
 (pg. 
3907
-
3916
)
42
Banks
G.T.
Haas
M.A.
Line
S.
Shepherd
H.L.
Alqatari
M.
Stewart
S.
Rishal
I.
Philpott
A.
Kalmar
B.
Kuta
A.
, et al.  . 
Behavioral and other phenotypes in a cytoplasmic Dynein light intermediate chain 1 mutant mouse
J. Neurosci.
 , 
2011
, vol. 
31
 (pg. 
5483
-
5494
)
43
Wheeler
V.C.
Auerbach
W.
White
J.K.
Srinidhi
J.
Auerbach
A.
Ryan
A.
Duyao
M.P.
Vrbanac
V.
Weaver
M.
Gusella
J.F.
, et al.  . 
Length-dependent gametic CAG repeat instability in the Huntington's disease knock-in mouse
Hum. Mol. Genet.
 , 
1999
, vol. 
8
 (pg. 
115
-
122
)
44
Lu
Y.M.
Jia
Z.
Janus
C.
Henderson
J.T.
Gerlai
R.
Wojtowicz
J.M.
Roder
J.C.
Mice lacking metabotropic glutamate receptor 5 show impaired learning and reduced CA1 long-term potentiation (LTP) but normal CA3 LTP
J. Neurosci.
 , 
1997
, vol. 
17
 (pg. 
5196
-
5205
)

Author notes

F.M.R. and R.A.D. contribute equally for this manuscript.

Supplementary data